PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cancer Res. Author manuscript; available in PMC Jul 1, 2011.
Published in final edited form as:
PMCID: PMC3014320
NIHMSID: NIHMS244001
Effects of Ionizing Radiation on Self Renewal and Pluripotency of Human Embryonic Stem Cells
Kitchener D. Wilson,1,2,3 Ning Sun,2,3 Mei Huang,2,3 Wendy Y. Zhang,2,3 Andrew S. Lee,2,3 Zongjin Li,2,3 Shan X. Wang,4 and Joseph C. Wu2,3,5
1Department of Bioengineering, Stanford University, Stanford, California 94305, USA.
2Department of Radiology, Stanford University, Stanford, California 94305, USA.
3Department of Medicine, Stanford University, Stanford, California 94305, USA.
4Departments of Electrical Engineering and Materials Science and Engineering, Stanford University, Stanford, California 94305, USA.
5Institute for Stem Cell Biology and Regenerative Medicine, Stanford University, Stanford, California 94305, USA.
Correspondence should be addressed to: Joseph C. Wu, MD, PhD, 300 Pasteur Drive, Grant Building S140, Stanford, CA 94305. joewu/at/stanford.edu, Ph: 650-736-2246, Fax: 650-736-0234
Human embryonic stem cells (hESCs) present a novel platform for in vitro investigation of the early embryonic cellular response to ionizing radiation. Thus far, no study has analyzed the genome-wide transcriptional response to ionizing radiation in hESCs, nor has any study assessed their ability to form teratomas, the definitive test of pluripotency. In this study, we use microarrays to analyze the global gene expression changes in hESCs after low (0.4 Gy), medium (2 Gy), and high (4 Gy) dose irradiation. We identify genes and pathways at each radiation dose that are involved in cell death, p53 signaling, cell cycling, cancer, embryonic and organ development, and others. Using Gene Set Enrichment Analysis (GSEA), we also show that the expression of a comprehensive set of core embryonic transcription factors is not altered by radiation at any dose. Transplantation of irradiated hESCs to immune-deficient mice results in teratoma formation from hESCs irradiated at all doses, definitive proof of pluripotency. Further, using a bioluminescence imaging technique, we have found that irradiation causes hESCs to initially die after transplantation, but the surviving cells quickly recover by two weeks to levels similar to control. To conclude, we demonstrate that similar to somatic cells, irradiated hESCs suffer significant death and apoptosis after irradiation. However, they continue to remain pluripotent and are able to form all three embryonic germ layers. Studies such as this will help define the limits for radiation exposure for pregnant women and also radiotracer reporter probes for tracking cellular regenerative therapies.
Keywords: Human embryonic stem cells, pluripotency, transcriptional profiling, molecular imaging, ionizing radiation
Ionizing radiation is a form of electromagnetic radiation produced by x-ray machines, fluoroscopy, radioactive isotopes, as well as nuclear environmental catastrophe. In pregnant mothers undergoing diagnostic or therapeutic procedures involving ionizing radiation, or who may be exposed to environmental radiation, there is a great potential for damage to the early embryo (1, 2). The current consensus is that exposure to radiation of <0.05 Gy during pregnancy is not related to an elevated risk of malformation, and many diagnostic procedures remain below this threshold (1, 3) (note that the Gray (Gy) is a unit of absorbed dose and reflects the amount of energy deposited into a mass of tissue). However, these data are based on limited human data or on animal models, and so may not accurately reflect the human embryonic response to radiation.
With the growing number of imaging procedures that employ ionizing radiation such as x-rays, computed tomographic (CT) scans (4-6), and positron emission tomography (PET) or single photon emission computed tomography (SPECT) reporter probes that monitor stem cell transplantation for regenerative and anti-oncogenic therapies (7, 8), as well as concerns over terrorist attacks involving radioactive materials (9), there is a need to better understand the effects on human embryonic stem cells (hESCs). A number of reports have studied both UV- and γ-irradiated mouse (10-12) and human (13-17) embryonic stem cells, and have primarily focused on the DNA damage response such as cell cycling, p53 signaling, and apoptosis. Only a two (14, 17) have attempted to characterize the effects of radiation on the defining feature of human embryonic stem cells: pluripotency, or ability to form all three embryonic germ layers. However, these studies focused on the expression of just two embryonic genes (Oct4, Nanog) after irradiation, and none have performed teratoma studies to prove pluripotency.
To address this lack of knowledge, we perform gene expression profiling of irradiated hESCs at three different doses, allowing us to analyze global pluripotency programs that may be affected by radiation. Taking advantage of novel molecular imaging techniques to track hESC proliferation, we also inject irradiated hESCs into mice and show that despite a transient decrease in cellular proliferation with the highest dose used in this study (4 Gy), these cells are still able to ultimately form teratomas. Taken together, we present definitive proof that hESCs that survive irradiation up to 4 Gy are pluripotent.
hESC culture
Undifferentiated hESCs (H9 line from Wicell, passages 45 to 55) were grown on Matrigel-coated plates in mTeSR1 medium (Stem Cell Technologies, Vancouver, BC, Canada) as previously described (18). Cell media was changed daily, and passaged approximately every 4-6 days using Collagenase IV. For cell counting, hESC colonies were digested to single cells with 0.05% trypsin EDTA and counted with a Countess Automated Cell Counter (Invitrogen).
Irradiation
hESCs were irradiated with 0.4, 2, or 4 Gy of γ-radiation using a Cesium137 irradiator. Immediately after irradiation, cells were returned to the incubator for recovery until the appropriate time point.
RT-PCR
18S was used as housekeeping gene control. The primer sets used in the amplification reaction are as follows:
  • Human CXCL10(IP10) forward primer: 5’- CTGATTTGCTGCCTTATCTTTCT -3’
  • Human CXCL10(IP10) reverse primer: 5’- ACATTTCCTTGCTAACTGCTTTC -3’
  • Human GADD45 forward primer: 5’- TGGAGGAAGTGCTCAGCAAAGCC -3’
  • Human GADD45 reverse primer: 5’- ACGCCTGGATCAGGGTGAAGTGG -3’
  • Human 18S forward primer: 5’- ACACGGACAGGATTGACAGA -3’
  • Human 18S reverse primer: 5’- GGACATCTAAGGGCATCACAG -3’
Immunohistochemical analysis
48 hours after irradiation, hESCs were fixed with 2% formaldehyde in PBS for 2 min, permeabilized with 0.5% tritonX-100 in PBS for 10 min, and blocked with 5% bovine serum albumin in PBS for an hour. Cells were then stained with appropriate primary antibodies and AlexaFluor conjugated secondary antibodies (Invitrogen). The primary antibodies for Oct4 (Santa Cruz), Sox2 (Biolegend), Nanog (Santa Cruz), SSEA-4 (Chemicon), Tra-1-60 (Chemicon), and Tra-1-81 (Chemicon) were used in the staining.
Annexin V flow cytometry analysis
48 hours after irradiation, hESCs were harvested and resuspended in binding buffer and stained with 5 μl of annexin V-fluorescein isothiocyanate and 5 μl propidium iodide (PI) using the Annexin V : FITC Apoptosis Detection Kit II (cat # 556570, BD Pharmingen). The cell suspension was incubated for 15 min at room temperature and analyzed on a FACScan flow cytometer (BD Bioscience). Flow cytometry data were analyzed with FlowJo (Treestar, San Carlos, CA) analysis software.
Microarray hybridization and data acquisition
Total RNA samples were isolated in Trizol (Invitrogen) followed by purification over a Qiagen RNeasy column (Qiagen) from hESCs 48 hours after irradiation. Three independent experiments for each radiation group plus control (for a total of 12 unique samples) were harvested for RNA isolation. Using Agilent Low RNA Input Fluorescent Linear Amplification Kits, cDNA was reverse transcribed from each of 12 RNA samples representing four biological triplicates, as well as the pooled reference control, and cRNA was then transcribed and fluorescently labeled with Cy5/Cy3. cRNA was purified using an RNeasy kit (Qiagen, Valencia, CA, USA). 825 ng of Cy3- and Cy5- labeled and amplified cRNA was hybridized to Agilent 4x44K whole human genome microarrays (G4112F) and processed according to the manufacturer's instructions. The array was scanned using Agilent G2505B DNA microarray scanner. The image files were extracted using Agilent Feature Extraction software version 9.5.1 applying LOWESS background subtraction and dye-normalization.
The data were analyzed using GeneSpring GX 10.0 (Agilent Technologies, Santa Clara, CA) to identify genes which had statistically significantly changed expression between groups. Genes were considered significantly differentially regulated with P-value < 0.05 and fold change ≥ 1.4. For hierarchical clustering, we used Pearson correlation for similarity measure and average linkage clustering. A heatmap was generated using Pearson correlation clustering of a significant gene list after one-way ANOVA of the raw data from all four groups.
Gene Set Enrichment Analysis (GSEA)
GSEA was performed using the GeneSpring GX software and gene sets downloaded from Molecular Signatures Database (MSigDB) (Broad Institute, MIT); a custom list of 26 pluripotency genes was also created based on literature review. Gene sets were considered significant with Q-value <0.25, as recommended (19). Briefly, the primary result of GSEA is the enrichment score (ES), which reflects the degree to which a gene set is overrepresented at the top or bottom of a ranked list of genes. The normalized enrichment score (NES) is the primary statistic for examining gene set enrichment results. By normalizing the enrichment score, GSEA accounts for differences in gene set size and in correlations between gene sets and the expression dataset.
Ingenuity Pathway Analysis (IPA)
Significant gene lists were generated from the GeneSpring software and uploaded to IPA for analysis. IPA assigns biological functions to genes using the Ingenuity Pathways Knowledge Base (Ingenuity Systems, Inc., Redwood City, CA). This information is used to form networks to create an ‘interactome’ of genes that are involved in specific biological processes.
Functional Analysis
The Functional Analysis identified the biological functions and/or diseases that were most significant to the data set. Molecules from the dataset that met the P-value cutoff of 0.05 and fold change cutoff of 1.4 were then associated with biological functions and/or diseases in Ingenuity's Knowledge Base were. Right-tailed Fisher's exact test was used to calculate a P-value determining the probability that each biological function and/or disease assigned to that data set is due to chance alone.
Canonical Pathway Analysis
Canonical pathways analysis identified the pathways from the Ingenuity Pathways Analysis library of canonical pathways that were most significant to the data set. The significance of the association between the data set and the canonical pathway was measured in 2 ways: 1) A ratio of the number of molecules from the data set that map to the pathway divided by the total number of molecules that map to the canonical pathway is displayed. 2) Fisher's exact test was used to calculate a P-value determining the probability that the association between the genes in the dataset and the canonical pathway is explained by chance alone.
Generation of stable reporter gene hESC lines
Enhanced green fluorescent protein (eGFP) and firefly luciferase (Fluc) double fusion reporter gene positive hESCs (Fluc+/eGFP+hESC) have been previously described (20, 21). Briefly, SIN lentivirus was prepared by transient transfection of 293T cells. H9 hESCs were stably transduced with LV-pUB-Fluc-eGFP at a multiplicity of infection (MOI) of 10. The infectivity was determined by eGFP expression as analyzed on a FACScan. eGFP positive cell populations were isolated by fluorescence activated cell sorting (FACS) Vantage SE cell sorter (Becton Dickinson), followed by plating for long-term culture.
Subcutaneous transplantation of hESCs
Animal protocols were approved by the Stanford University Animal Care and Use Committee guidelines. All procedures were performed on 8-10 week old female SCID Beige mice (Charles River Laboratories, Wilmington, MA). Following induction with inhaled isoflurane (2% to 3%), anesthesia was then maintained with 1% to 2.5% isoflurane. 200,000 Fluc+/eGFP+hESCs were suspended in a 50 μl volume of a 1:1 mixture of growth factor reduced-Matrigel and DMEM, then irradiated at the appropriate dosage (0.4, 2 or 4 Gy). Irradiated cell suspensions were each injected subcutaneously into the dorsum of eight SCID mice; injections were performed within 2 hours of irradiation.
Bioluminescence imaging of transplanted cell survival
Bioluminescence imaging was performed using the Xenogen IVIS 200 system (Caliper Life Sciences, Hopkinton, MA). After intraperitoneal injection of the reporter probe D-Luciferin (375 mg Luciferin/kg body weight), animals were imaged for 1-10 minutes. The same mice were imaged for 6 weeks. Regions of interest (ROI) were drawn over the signals using the Igor image analysis software (Wavemetrics, Lake Oswego, OR). BLI signal was standardized for acquisition time and quantified in units of maximum photons per second per square centimeter per steridian (photons/sec/cm2/sr), as described (22).
Postmortem immunohistochemical staining
Animals were sacrificed according to protocols approved by the Stanford Animal Research Committee after the duration of the study. Teratomas were explanted and processed for H&E staining. Slides were interpreted by an expert pathologist (AJC).
Statistical analysis
Non-microarray data are presented as mean±S.D. Data were compared using standard or repeated measures, using ANOVA where appropriate. Differences were considered significant for P<0.05.
Fig. 1A gives a schematic of our experimental design. We first confirmed that low dose irradiation (<1 Gy) of hESCs was capable of upregulating known stress-responsive genes: Gadd45, which mediates activation of the p38/JNK pathway via MTK1/MEKK4 kinase, and Cxcl10, a chemokine for receptor CXCR3 that is involved in recruitment of inflammatory cells (Fig. S1). At a higher dose of 4 Gy, we observed massive cell death that was concurrent with the development of holes and patchy regions in hESC colonies at 48 hours (Fig. 1B,C); hole formation has also been reported in colonies six hours after 5 Gy irradiation (14). However, the surviving hESCs continued to express common pluripotency markers such as TRA-1-81, SSEA4, TRA-1-60, and embryonic transcription factors such as Oct4, Sox2, and Nanog that are key regulators of pluripotency and self-renewal (Fig 1C).
Figure 1
Figure 1
Figure 1
Figure 1
Figure 1
(A) Schematic of experimental setup. (B,C) Immunostaining of pluripotency markers in control (B) and irradiated (C) hESCs shows maintenance of marker expression 48 hours after irradiation. (D) Flow cytometry of FITC Annexin V and propidium iodide (PI) (more ...)
We were curious about the relative extent of apoptosis and cell death after irradiation at the different dosages, and so double-stained hESCs with Annexin V (early apoptosis) and PI (cell death) 48 hours after irradiation, and analyzed the cells with flow cytometry (Fig. 1D). Clearly, there is a trend towards increasing apoptosis and cell death at the higher radiation doses (2 and 4 Gy) compared to low dose (0.4 Gy) and control. The majority (>70%) of hESCs are dead after 4 Gy irradiation, though an apoptotic minority (<30%) appears to survive at 48 hrs. This latter population likely represents the surviving cells that continue to express pluripotency markers, as seen in Fig. 1C. However, the definitive test of pluripotency of human cells is the ability to form a teratoma, which we performed next.
To confirm that surviving hESCs are pluripotent, we injected irradiated cells into immuno-compromised mice and monitored for teratoma formation. We tracked their growth kinetics in vivo by using hESCs that constitutively express a Fluc-eGFP double fusion reporter gene (Fig. 2A), enabling longitudinal monitoring of cellular photon emission, and by extension their proliferation, as described (20, 21). After irradiation and injection of Fluc+/eGFP+hESCs, we found that photon emission from the 2 and 4 Gy groups reached a statistical minimum at seven days that was less than photon emission from cells exposed to 0 and 0.4 Gy, suggesting massive cell death (P<0.05, n=8 per group, see Fig. 2B,C). Based on the photon intensities, we estimated that 38±30%, 63±20%, 80±9%, and 83±7% (mean±SEM) of the 0, 0.4, 2, and 4 Gy-irradiated cells, respectively, had died at day 7.
Figure 2
Figure 2
Bioluminescence reporter gene imaging of irradiated hESCs in living animals. (A) The double fusion reporter gene construct carrying firefly luciferase (Fluc) and enhanced green fluorescent protein (eGFP). (B) Diagram of the subcutaneous injection sites (more ...)
We expected that the 2 and 4 Gy groups would continue to die, but surprisingly all four groups emitted similar levels of photons by day 21, indicating that surviving hESCs had recovered from high dose irradiation. We confirmed this result by studying long-term in vitro cultures of irradiated hESCs, and found that cell proliferation was inhibited in the first week after high dose irradiation, but thereafter all groups exhibited similar growth kinetics (Fig. S2). Note that after the post-irradiation “recovery period”, we did not observe any compensatory increase in cell proliferation in the high dose groups. Finally, of the eight mice used in this study, five developed teratomas in the 4 Gy group by the sixth week (see Fig. 2D for representative H&E images, and Fig. S3 for a representative gross image of four teratomas from a single mouse). The three mice that failed to form teratomas in the 4 Gy group likely experienced significant apoptosis and cell death, and not loss of pluripotency. To confirm this, we performed a careful microarray study of the core set of pluripotency genes to determine whether there are any detectable changes in pluripotency programs, however subtle, in response to ionizing radiation.
For the transcriptomic analysis of irradiated hESCs, RNA was isolated from cells 24 hours after irradiation, then labeled and hybridized to microarrays (raw data files have been uploaded to GEO under accession number GSE20951). When analyzing microarray data, it is often informative to start from a system-wide rather than individual-gene view of the resulting data, especially when the overall gene fold changes are no more than seven-fold (Table S1). An overview of the gene profiles can be seen in the heatmap of Fig. 3A. Most apparent is the co-clustering of the control and low dose samples (0 and 0.4 Gy), which were distinct from the co-clustering of the high dose samples (2 and 4 Gy). This pattern is also evident in Fig. 3B, in which global Pearson correlation shows 95% correlation between the 2 and 4 Gy groups, but only 86% correlation with the low-dose 0.4 Gy group. A Venn diagram of the entities that are significantly different (P<0.05, fold change ≥1.4) between radiation dosage and control further illustrates this pattern (Fig. 3C, note that microarrays often contain multiple probes, or “entities”, for a given gene). Again, we observe the same grouping as in the Pearson correlation: the 2 and 4 Gy-irradiated samples exhibit a higher degree of overlap between themselves than they do with the 0.4 Gy group.
Figure 3
Figure 3
Microarray analysis of hESCs 24 hours after irradiation. (A) Pearson clustering of the data for 0, 0.4, 2, and 4 Gy irradiated hESCs (n=3 biological replicates per group). Note that one replicate from the 0.4 Gy group was lost due to poor array hybridization. (more ...)
We next used Ingenuity Pathways Analysis (Ingenuity® Systems, www.ingenuity.com) and Gene Set Enrichment Analysis (GSEA) (19) to further analyze the microarray data. Selected canonical pathways and functions that are disrupted after 4 Gy irradiation (vs. control) are summarized in Table 1; full data sets can be found in Tables S2 and S3. After 4 Gy irradiation, canonical pathways such as VDR/RXR activation, p53 signaling, aryl hydrocarbon signaling, and functions such as cancer, cell death, cell cycle, growth and proliferation, and embryonic development are significantly affected in hESCs. Specifically, several tumor protein p53 associated genes such as TP53Inp1 (up 2.6-fold) and target genes such as Cdkn1A (up 2-fold) and Mdm2 (up 1.7-fold) (23), as well as several tumor necrosis factor receptor superfamily members, were disregulated after irradiation. A small group of genes associated with development also exhibited differential expression, including Hes1 (down 1.8-fold, (24)), Runx1 (up 1.5 fold), and Pbx1 (down 1.8-fold); note that many of these genes are also associated with cancer (Table 1). Supporting the observation that genes related to cancer are disregulated with radiation, GSEA, a method for analyzing a priori gene sets within microarray data, revealed upregulation of gene sets that have also been reported in cells after treatment with chemotherapeutic drugs (25-27) (Table 2).
Table 1
Table 1
Selected genes and biological processes affected by 4 Gy irradiation of hESCs
Table 2
Table 2
Gene Set Enrichment Analysis (GSEA) of 4 vs. 0 Gy irradiated hESCs
We have also analyzed the progression of gene and pathway changes that occur in hESCs at each increasing radiation dose: between 0 and 0.4 Gy (Tables S4-S6), 0.4 and 2 Gy (Tables S7-S9), and 2 and 4 Gy (Tables S10-S12). Similar to 4 Gy radiation, 0.4 Gy irradiation affects cellular functions such as cell death, cancer, and signaling pathways such as p53, though not important p53 downstream target genes such as Cdkn1A and Mdm2. Because Cdkn1A is an important negative regulator of cell cycling (28), the lack of upregulation of Cdkn1A by 0.4 Gy irradiation could partly explain why we did not observe a similar reduction in cell proliferation as in the 2 and 4 Gy groups. Relative to 0.4 Gy irradiation, 2 Gy irradiation affects canonical TFG-β and Wnt/β-catenin signaling, including the genes Tgfbr2 (up 1.4-fold), Wnt1 (up 1.4-fold), Wnt10A (up 2.1-fold) and Wnt9a (up 1.8-fold); notably, Wnt proteins play important and diverse roles in embryonic stem cells (29). 2 Gy irradiation also induces Cdkn1A upregulation by 2.3-fold, but not Mdm2. Interestingly, many genes involved in functions such as cellular compromise, amino acid metabolism, molecular transport, and cell morphology, in addition to cancer and cell death, were significantly disrupted by 2 Gy of radiation, including a number of solute carrier family proteins such as Slc6a13 (up 2-fold) and Slc25a13 (down 2.2-fold). Clearly there is an overall significant increase in cellular dysfunction after 2 Gy irradiation, which explains the results from our in vivo and in vitro studies (Figs. 1 and and2).2). Finally, in the 2 vs. 4 Gy group, the overall gene changes were not large, but a small group of genes related to organ and tissue development did have altered expression, such as Tnfsf11 (up 1.6-fold), Otx1 (down 1.6-fold), B4galt1 (down 1.4-fold), and Mef2C (up 1.9-fold). Presumably there are subtle development and differentiation processes that are activated with 4 Gy irradiation, but are not robust enough to cause loss of pluripotency, as evidenced by successful formation of teratomas from 4 Gy-irradiated hESCs. Furthermore, the gene expression profiles of irradiated cells showed no increased correlation with previously reported data for differentiated hESCs and primary cell types (20, 30, 31), giving additional evidence that differentiation is not significantly increased with ionizing radiation (Fig. S4).
With these observations, we were particularly interested to understand whether core pluripotency genes were also affected by radiation. Importantly, well-known embryonic transcription factors such as Oct4 (Pou5f1), Sox2, and Nanog, which are expressed exclusively or predominantly in hESCs and are critical for maintaining pluripotency and self-renewal, were not present in any of our significant gene lists across all radiation dosages. Moving beyond individual genes, we created a gene set of 26 known factors that are well-known to be specific to hESCs (bottom row of Table 2). GSEA revealed no significant up- or down-regulation of this set in the microarray data for the highest radiation dose, 4 Gy (P=0.4, Q=0.5, NES=-1.0). This finding agrees with a previous report that showed normalization of Oct4 and Nanog after only 24 hours in 2 Gy-irradiated hESCs (14). We therefore conclude that pluripotency gene programs are not significantly affected by high dose radiation, and this accounts for the observation that surviving hESCs are still capable of forming all three embryonic germ layers.
In pregnant mothers undergoing diagnostic or therapeutic procedures involving ionizing radiation, or who may be exposed to environmental radiation, there is a great potential for damage to the early embryo. Although the embryo is somewhat protected by the uterus, it is particularly sensitive to ionizing radiation, and the developmental consequences can be quite serious (2). Data regarding the potential biological effects on the embryo after in utero irradiation are based on the results of animal studies (32-35) and a limited number of human exposures such as the 1945 atomic bomb survivors from Hiroshima and Nagasaki. Based on these collective data, it has been well established that the dose of ionizing radiation, and the developmental stage of the embryo, are the determining factors for reproductive toxicity in embryonic development (1). Above poorly-defined threshold doses, the major effects of ionizing radiation are lethality during the preimplantation–preorganogenetic period, and malformations and growth retardation during organogenesis (1, 3). Other sequelae later in life may include severe mental retardation, a reduced intelligence quotient, and childhood cancer (1, 3, 36). Unfortunately the absolute incidence and radiation dose at which these changes occur, as well as the mechanisms of damage, remain unclear.
Because the in utero embryonic response to ionizing radiation is not well understood due to the obvious ethical concerns of exposing pregnant mothers to radiation, hESCs present a novel in vitro platform for studying the human embryonic response to irradiation. These cells are derived from the inner cell mass of the blastocyst during embryonic development, and are therefore closely related to the early stage human embryo. Admittedly, hESCs are still different from the early embryo in that they lack the complex and dynamic signaling environment of the uterus and are instead maintained long-term in relatively simple in vitro cultures. However, the advantage is that we can begin to tease out the embryonic response to irradiation in a human rather than murine system. Furthermore, because radiotracers and PET reporter genes that monitor cellular transplantation for emerging regenerative and anti-oncogenic therapies are being increasingly employed in laboratory research (8), and one day may even achieve routine clinical application (7), it will be important to determine whether such radioactive probes can directly affect the viability and function of the transplanted cells. For these reasons, we decided that a broad survey of the functional and global molecular response of hESCs to irradiation, and in particular the radiation's effect on pluripotency, was a critical area of investigation.
Not surprisingly, our results show that high doses of radiation cause massive cell death, with a trend towards increasing apoptosis and death at the higher radiation doses (2 and 4 Gy) compared to low dose (0.4 Gy) and control. Interestingly, an apoptotic minority does appear to survive at 48 hours. Using a bioluminescence imaging technique, we confirmed that the higher doses of radiation cause hESCs to initially die after transplantation, but the surviving cells recover by two weeks to levels similar to control. Regardless of the radiation dose used in our study, all groups of irradiated hESCs were able to form teratomas, the definitive test of pluripotency. Our genome-wide analysis of gene expression revealed genes and pathways at each radiation dose that are involved in cell death, p53 signaling, cell cycling, cancer, embryonic and organ development, and others. Importantly, GSEA showed that the expression of a comprehensive set of core embryonic transcription factors is not significantly altered by radiation at any dose, and helps explain how irradiated hESCs are still able to form teratomas.
In summary, this is the first study of hESC genome-wide transcriptional changes induced by ionizing radiation, and is a preliminary step towards a better understanding of not only hESC molecular changes but also the in utero embryonic gene expression response. We have shown that, similar to somatic cells, irradiated hESCs suffer significant death and apoptosis after irradiation. Though some gene programs involved in developmental pathways are altered with high dose radiation, the expression of pluripotency genes is unaffected, and these cells can still form teratomas. Studies such as this may help define the limits for radiation exposure for pregnant women and also radiotracer reporter probes for tracking cellular regenerative therapies.
Supplementary Material
ACKNOWLEDGEMENTS
We are grateful to Pauline Chu and Andrew J. Connolly for assistance with tissue processing and histological analysis. This work was funded by Stanford Bio-X Fellowship (KDW), R21 HL091453 (JCW), and R33 HL089027 (JCW).
1. Brent RL. Utilization of developmental basic science principles in the evaluation of reproductive risks from pre- and postconception environmental radiation exposures. Teratology. 1999;59:182–204. [PubMed]
2. McCollough CH, Schueler BA, Atwell TD, et al. Radiation exposure and pregnancy: when should we be concerned? Radiographics. 2007;27:909–17. discussion 17. [PubMed]
3. De Santis M, Cesari E, Nobili E, Straface G, Cavaliere AF, Caruso A. Radiation effects on development. Birth Defects Research Part C, Embryo Today. 2007;81:177–82. [PubMed]
4. Einstein AJ, Moser KW, Thompson RC, Cerqueira MD, Hanzlova MJ. Radiation dose to patients from cardiac diagnostic imaging. Circulation. 2007;11:1290–305. [PubMed]
5. Fazel R, Krumholz HM, Wang Y, et al. Exposure to low-dose ionizing radiation from medical imaging procedures. The New England Journal of Medicine. 2009;361:849–57. [PubMed]
6. Smith-Bindman R, Lipson J, Marcus R, et al. Radiation dose associated with common computed tomography examinations and the associated lifetime attributable risk of cancer. Archives of Internal Medicine. 2009;169:2078–86. [PubMed]
7. Yaghoubi S, Jensen M, Satyamurthy N, et al. Noninvasive detection of therapeutic cytolytic T cells with 18F-FHBG PET in a patient with glioma. Nature Clinical Practice Oncology. 2009;6:53–8. [PMC free article] [PubMed]
8. Narsinh K, Cao F, Wu J. Molecular imaging of human embryonic stem cells. Methods in Molecular Biology. 2009;515:13–32. [PubMed]
9. Hogan D, Kellison T. Nuclear terrorism. The American Journal of the Medical Sciences. 2002;323:341–9. [PubMed]
10. Aladjem MI, Spike BT, Rodewald LW, et al. ES cells do not activate p53-dependent stress responses and undergo p53-independent apoptosis in response to DNA damage. Current Biology. 1998;8:145–55. [PubMed]
11. Hong Y, Stambrook P. Restoration of an absent G1 arrest and protection from apoptosis in embryonic stem cells after ionizing radiation. Proceedings of the National Academy of Sciences of the United States of America. 2004;101:14443–8. [PubMed]
12. Solozobova V, Rolletschek A, Blattner C. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage. BMC Cell Biology. 2009;10:46. [PMC free article] [PubMed]
13. Filion T, Qiao M, Ghule P, et al. Survival responses of human embryonic stem cells to DNA damage. Journal of Cellular Physiology. 2009;220:586–92. [PMC free article] [PubMed]
14. Momcilovic O, Choi S, Varum S, Bakkenist C, Schatten G, Navara C. Ionizing radiation induces ataxia telangiectasia mutated-dependent checkpoint signaling and G(2) but not G(1) cell cycle arrest in pluripotent human embryonic stem cells. Stem Cells. 2009;27:1822–35. [PMC free article] [PubMed]
15. Qin H, Yu T, Qing T, et al. Regulation of apoptosis and differentiation by p53 in human embryonic stem cells. The Journal of Biological Chemistry. 2007;282:5842–52. [PubMed]
16. Becker K, Stein J, Lian J, van Wijnen A, Stein G. Establishment of histone gene regulation and cell cycle checkpoint control in human embryonic stem cells. Journal of Cellular Physiology. 2007;210:517–26. [PubMed]
17. Sokolov M, Panyutin I, Onyshchenko M, Panyutin I, Neumann R. Expression of pluripotency-associated genes in the surviving fraction of cultured human embryonic stem cells is not significantly affected by ionizing radiation. Gene. 2010;455:8–15. [PMC free article] [PubMed]
18. Ludwig TE, Levenstein ME, Jones JM, et al. Derivation of human embryonic stem cells in defined conditions. Nature biotechnology. 2006;24:185–7. [PubMed]
19. Subramanian A, Tamayo P, Mootha V, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences of the United States of America. 2005;102:15545–50. [PubMed]
20. Cao F, Wagner RA, Wilson KD, et al. Transcriptional and functional profiling of human embryonic stem cell-derived cardiomyocytes. PloS One. 2008;3:e3474–e. [PMC free article] [PubMed]
21. Wilson KD, Huang M, Wu JC. Bioluminescence reporter gene imaging of human embryonic stem cell survival, proliferation, and fate. Methods Mol Biol. 2009;574:87–103. [PubMed]
22. Li Z, Wu JC, Sheikh AY, et al. Differentiation, survival, and function of embryonic stem cell derived endothelial cells for ischemic heart disease. Circulation. 2007;116:I46–54. [PubMed]
23. Shu K- X, Li B, Wu L- X. The p53 network: p53 and its downstream genes. Colloids and Surfaces B: Biointerfaces. 2007;55:10–8. [PubMed]
24. Kobayashi T, Mizuno H, Imayoshi I, Furusawa C, Shirahige K, Kageyama R. The cyclic gene Hes1 contributes to diverse differentiation responses of embryonic stem cells. Genes & Development. 2009;23:1870–5. [PubMed]
25. Brachat A, Pierrat B, Xynos A, et al. A microarray-based, integrated approach to identify novel regulators of cancer drug response and apoptosis. Oncogene. 2002;21:8361–71. [PubMed]
26. Chuang Y- YE, Chen Y, Gadisetti, et al. Gene expression after treatment with hydrogen peroxide, menadione, or t-butyl hydroperoxide in breast cancer cells. Cancer Research. 2002;62:6246–54. [PubMed]
27. Islaih M, Li B, Kadura I, et al. Comparison of gene expression changes induced in mouse and human cells treated with direct-acting mutagens. Environmental and Molecular Mutagenesis. 2004;44:401–19. [PubMed]
28. Besson A, Dowdy S, Roberts J. CDK inhibitors: cell cycle regulators and beyond. Developmental Cell. 2008;14:159–69. [PubMed]
29. Nusse R, Fuerer C, Ching W, et al. Wnt signaling and stem cell control. Cold Spring Harbor symposia on quantitative biology. 2008;73:59–66. [PubMed]
30. Li Z, Wilson KD, Smith B, et al. Functional and transcriptional characterization of human embryonic stem cell-derived endothelial cells for treatment of myocardial infarction. PloS One. 2009;4:e8443–e. [PMC free article] [PubMed]
31. Jia F, Wilson KD, Sun N, et al. A nonviral minicircle vector for deriving human iPS cells. Nature Methods. 7:197–9. [PMC free article] [PubMed]
32. Russell WL. Mutation frequencies in female mice and the estimation of genetic hazards of radiation in women. Proceedings of the National Academy of Sciences of the United States of America. 1977;74:3523–7. [PubMed]
33. Jacquet P. Sensitivity of germ cells and embryos to ionizing radiation. Journal of Biological Regulators and Homeostatic Agents. 2004;18:106–14. [PubMed]
34. Brent RL, Bolden BT. The indirect effect of irradiation on embryonic development. 3. The contribution of ovarian irradiation, uterine irradiation, oviduct irradiation, and zygote irradiation to fetal mortality and growth retardation in the rat. Radiation Research. 1967;30:759–73. [PubMed]
35. Jacquet P, de Saint-Georges L, Vankerkom J, Baugnet-Mahieu L. Embryonic death, dwarfism and fetal malformations after irradiation of embryos at the zygote stage: studies on two mouse strains. Mutation Research. 1995;332:73–87. [PubMed]
36. Wakeford R, Little MP. Risk coefficients for childhood cancer after intrauterine irradiation: a review. International Journal of Radiation Biology. 2003;79:293–309. [PubMed]