PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Virology. Author manuscript; available in PMC 2012 January 20.
Published in final edited form as:
PMCID: PMC3008208
NIHMSID: NIHMS252658
Poxvirus interleukin-4 expression overcomes inherent resistance and vaccine-induced immunity: Pathogenesis, prophylaxis and antiviral therapy
Nanhai Chen,a Clifford J. Bellone,b Jill Schriewer,b Gelita Owens,c Torgny Fredrickson,d Scott Parker,b and R. Mark L. Bullerb*
aCurrent address, Genelux Corporation, San Diego Science Center, 3030 Bunker Hill Street, Suite 310, San Diego, CA 92109, USA
bDepartment of Molecular Microbiology and Immunology, Doisy Research Center, 1100 South Grand Boulevard, St. Louis, MO 63104, USA
cCurrent address, Nestle Purina PetCare PTC, 3916 Pettis Rd., St. Joseph, MO 6450
dLaboratory of Immunopathology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, 5640 Fishers lane, Room 1421, Rockville, MD 20852
*Corresponding author: Tel: 314-977-8870; Fax: 314-977-8717; mark.buller/at/gmail.com
In 2001, Jackson et al. reported that murine IL-4 expression by a recombinant ectromelia virus caused enhanced morbidity and lethality in resistant C57BL/6 mice as well as overcame protective immune memory responses. To achieve a more thorough understanding of this phenomenon, and to asses a variety of countermeasures, we constructed a series of ECTV recombinants encoding murine IL-4 under the control of promoters of different strengths and temporal regulation. We showed that the ECTV-IL-4 recombinant expressing the highest level of IL-4 was uniformly lethal for C57BL/6 mice even when previously immunized. The lethality of the ECTV-IL-4 recombinants resulted from virus-expressed IL-4 signaling through the IL-4 receptor, but was not due to IL-4 toxicity. A number of treatment approaches were evaluated against the most virulent IL-4 encoding virus. The most efficacious therapy was a combination of two antiviral drugs (CMX001® and ST-246®) that have different mechanisms of action.
Keywords: immunosuppression, poxvirus, ectromelia virus, lethal infection, IL-4
IL-4 is a prototypic Th2 cytokine produced by T cells, mast cells, basophils and eosinophils. IL-4 plays a central role in shaping the immune response, promoting the development of Th2 responses and inhibiting those of Th1 character. IL-4 is also an important regulator of immunoglobulin (Ig) class switch to IgG1 and IgE in mice, and IgG4 and IgE in humans (Gessner & Rollinghoff, 2000). Although ectopically expressed IL-4 from recombinant viruses would be expected to enhance the Th2 character of the immune response, and result in enhanced pathogenesis, this is not a universal observation. Expression of IL-4 by retroviruses (Benedetti, et al., 1998), adenoviruses (Lukacs, et al., 1997), vesicular stomatitis (Fernandez, et al., 2002) and herpes simplex virus (Andreansky, et al., 1998;Ghiasi, et al., 1999;Ghiasi, et al., 2001;Ikemoto, et al., 1995) resulted in little effect on viral pathogenesis, whereas IL-4 expression by influenza virus (Moran, et al., 1996), respiratory syncytial virus (Fischer, et al., 1997) and vaccinia virus (VACV) (Andrew & Coupar, 1992;Bembridge, et al., 1998;Sharma, et al., 1996) delayed viral clearance or enhanced pathogenesis in mice. The most striking phenotypes were observed with IL-4 expressing recombinants generated from poxviruses ectromelia (ECTV) and myxoma in their natural hosts. Expression of the rabbit IL-4 gene from the SLS strain of myxoma virus resulted in fatal myxomatosis in genetically resistant wild rabbits (Kerr, et al., 2004). Similarly, expression of the murine IL-4 gene by a recombinant ECTV caused enhanced lethality for inherently resistant C57BL/6 mice, and overcame protective immune responses induced by vaccination (Jackson, et al., 2001). The enhanced lethality of the ECTV-IL-4 recombinant was likely due to immunosuppression, although the exact mechanism of action remains to be determined (Mullbacher & Lobigs, 2001;Norazmi, 2001;Stanford & McFadden, 2005).
The Jackson et al. study raised a number of questions. The utilized recombinant may have underestimated the potential of an ECTV-IL-4 recombinant to overcome vaccine-induced immunity as it lacked a functional thymidine kinase (tk) gene (ORF 078) due to insertion of the Escherichia coli lacZ gene (Jackson, et al., 1998;Jackson, et al., 2001). A second possible loss of gene function occurred through insertion of the IL-4 gene and herpes simplex virus tk gene into ORF 030, an orthologue of the VACV F7L gene of unknown function. The herpes simplex virus tk gene produced thymidine kinase activity to only 10% of the ECTV WT level (Coupar, et al., 2000). Furthermore, in the Jackson et al. study memory immunity was generated using an attenuated ECTV recombinant instead of the standard VACV smallpox vaccine. This homologous vaccine/challenge protocol therefore fails to model a variola virus (VARV) challenge of humans vaccinated with the smallpox vaccine. And finally, the study did not evaluate the ability of treatment modalities, such as immune serum and antiviral drugs to protect against the fatal infection by the ECTV-IL-4 recombinant.
To confirm and extend the studies of Jackson et al., we constructed a series of ECTV recombinants with a murine IL-4 gene under the control of promoters of differing strengths and temporal regulations. The ECTV-IL-4 recombinants posed no risk to humans as ECTV does not cause human disease, and murine IL-4 does not efficiently signal through the human IL-4R (Buller & Fenner, 2007;Mosmann, et al., 1987). We showed that ECTV-IL-4 recombinants expressing high levels of IL-4 were uniformly lethal for naïve, disease resistant mice or mice previously immunized with the smallpox vaccine. We evaluated a number of treatment approaches including anti-IL-4 antibody therapy to reduce systemic IL-4 levels, and a treatment with two antivirals (CDV/CMX001® and ST-246®) (Painter & Hostetler, 2004;Parker, et al., 2008;Parker, et al., 2009;Yang, et al., 2005).
Construction and characterization of ECTV recombinants encoding murine IL-4 and non-functional IL-4D116D119 from early and late promoters of differing strengths
To evaluate the maximum potential of ECTV-IL-4 recombinants to cause lethal mousepox in normally resistant mice, we recombined the murine IL-4 gene into the CHO gene of WT ECTV. The CHO gene (~20,500 bases from the left-hand terminus) is one of 26 naturally disrupted ORFs present in the ECTV genome (Chen, et al., 2003). A recombinant ECTV expressing lac z from this locus was previously shown to be as virulent as ECTV-wild type (WT) for A/NCR mice validating this site for expression of the IL-4 gene without affecting the natural life-cycle of the virus (data not shown). IL-4 expression cassettes were constructed with the IL-4 gene under the control of four promoters with different strengths and patterns of temporal regulation. Early (E) and late (L) promoters are active before and after DNA synthesis, respectively. The 7.5E promoter consists of the early element of the 7.5 E/L promoter, which expresses both early and late in the replication cycle. The 7.5 E/L promoter was used in the Jackson et al study to express IL-4 (Jackson, et al., 2001). The strong synthetic early (SSE) promoter is an early promoter whose activity has been increased based on a mutational analysis of several early promoters (Davison & Moss, 1989). The 11KL promoter is a strong late promoter that regulates expression of a VACV structural protein F17 (Bertholet, et al., 1985). As a control, the WT IL-4 gene was mutated by substituting aspartic acid residues for the glutamine and tyrosine residues at positions 116 and 119, respectively. This IL-4D116/D119 mutant bound to the IL-4 receptor α subunit with similar affinity as wild type IL-4 without inducing cellular responses (Grunewald, et al., 1997). The IL-4 and IL-4D116/D119 genes controlled by the various promoters were cloned into a CHO gene targeting vector, and recombined into the ECTV genome by the transient dominant selection system.
In vitro evaluation of ECTV recombinants encoding murine IL-4
The recombinant viruses were evaluated for IL-4 protein expression levels and activity. Western blot analysis of culture supernatants from CV-1 cells infected with ECTV-IL-4 recombinants detected species that migrated as major and minor bands at 16.6–17.8 and 13 kDa, respectively. The minor band of 13 kDa was also present in the baculovirus produced IL-4 (BV-IL-4) and probably represented the nonglycoslylated protein since its size is similar to the predicted size of unmodified IL-4 (13.6 kDa). The major band is a doublet that consisted of two closely migrating bands of 16.6 and 17.8 kDa. These apparent molecular weights were larger than the 15.8 kDa of the baculovirus produced IL-4, but smaller than the 20 kDa size reported for natural IL-4 (Figure 1B) (Paul & Ohara, 1987). These differences are likely caused by glycosylation. Glycoslylation is not required for IL-4 bioactivity (Paul & Ohara, 1987). The rank order of accumulation of IL-4 was -11KL-IL-4 >-7.5E/L-IL-4D116/D119 or -7.5E/L-IL-4 >SSE-IL-4 >-7.5 E/IL-4D116/D119 or -7.5E-IL-4. The amount of IL-4 or IL-4D116/D119 expressed in CV-1 cells by the various recombinants was further quantified by ELISA and bioassay (Figure 1C). Supernatants from infections with ECTV-7.5E/L-IL-4 and ECTV-SSE-IL-4 recombinants contained 5.2 and 3.4 times as much IL-4 by ELISA, respectively, as a comparable ECTV-7.5E-IL-4 recombinant infection. The highest level of IL-4 expression was achieved with the 11KL promoter that was 2.1-fold higher than the 7.5E/L promoter. The level of IL-4D116/D119 was ~ 3-fold lower than a comparable promoter construct (7.5E or 7.5E/L) expressing IL-4. This was likely due to different affinities of the ELISA capture antibody for IL-4 and IL-4D116/D119 as no difference in expression level was noted in the western blot analysis that used the same detection antibody as the ELISA (Figure 1B). As verified by bioassay, IL-4 was biologically active, whereas the IL-4D116/D119 was not.
Figure 1
Figure 1
IL-4 expression by ECTV recombinant viruses as a function of promoter strength. (A) A schematic of the pMBEV1.1 plasmid indicating the location of the fragmented CHO gene insertion site flanked by EV014 and EV015 genes. Numbers represent the position (more ...)
In vivo evaluation of ECTV recombinants encoding murine IL-4
Although IL-4 is notoriously difficult to detect in blood, ECTV expressed IL-4 was detected by ELISA in sera of C57BL/6 mice 6 days post footpad (FP) infection with ECTV-IL-4 recombinants. The rank order of IL-4 concentrations was identical to that observed in tissue culture (Figure 1D). The reduced concentration of IL-4D116/D119 in sera of mice infected with ECTV-7.5E-IL-4D116/D119 as compared to ECTV-7.5E-IL-4 was due in part to the differential sensitivity of the ELISA for IL-4 as compared to IL-4D116/D119 (above), and to the more restricted disease as exemplified by lower virus titers in spleens and livers of mice, which were similar to those observed in ECTV-WT infections (Table 1). The sustained levels of IL-4 detected in sera of C57BL/6 mice infected with ECTV-IL-4 recombinants ranged from 107 to 1075 ng/ml. These levels far exceeded that detected in the ECTV-WT infections where IL-4 concentrations were below the level of detection of the ELISA (<2 ng/ml) or a CBA assay (<25 pg/ml, data not shown).
Table 1
Table 1
ECTV recombinants expressing IL-4 from promoters of different strength and temporal regulation are uniformly lethal for disease resistant C57BL/6 mice.
Pathogenesis of fatal disease caused by ECTV-IL-4 recombinants in C57BL/6 mice
Each recombinant virus was tested by the FP route in a lethal dose 50 (LD50) assay in C57BL/6 mice (Reed & Muench, 1938). C57BL/6 mice infected via the FP route are resistant to ECTV-WT infection up to at least 9000 PFU (Parker, et al., 2009). As shown in Table 1, infections with ECTV-IL-4 recombinants yielded higher infectivity levels in spleens and livers, LD50 values of less than 1 PFU/mouse, and mean time to death (MTD) values of ~7 days at a virus dose of 4 × 103 PFU (Table 1, footnote 2). Because the particle/PFU ratio for orthopoxviruses is typically ~20–30 to 1, an LD50 value of < 1 indicates that the mouse is a more sensitive assay for ECTV infectivity than tissue culture. The lethal effects were observed with promoters that expressed at early, late, and early and late times during the virus replication cycle. There were no deaths in mice inoculated with ECTV-WT, ECTV-7.5E-IL-4D116/D119, or ECTV-7.5E/L-IL-4D116/D119 at virus doses exceeding 105 PFU/mouse. The lethality of crude, sucrose-cushion-purified or sucrose-band-purified preparations of ECTV-IL-4 recombinants were similar, suggesting that any contaminating host molecules did not contribute to virulence (data not shown).
Furthermore, the lethality of ECTV-IL-4 recombinants was due to virus expressed IL-4 and not the induction of host IL-4 gene expression as ~100 PFU of ECTV-7.5E-IL-4 was 100% lethal (with an identical MTD) for C57BL/6 mice and C57BL/6-Il4tm1Nnt mice, which lacked the ability to make IL-4 (data not shown). And finally, the IL-4 (IL-4Rα-γc) and/or IL-13 (IL-4Rα-IL-13Rα1) receptor(s) was required for lethal disease of ECTV-IL-4 recombinants as ECTV-SSE-IL-4 caused a lethal infection in VACV (Dryvax™) immunized BALB/cJ mice, but not immunized BALB/c-Il4ratm1Sz, which lack a functional IL-4/IL-13 receptor (Table S1).
To prove that the observed lethality of the ECTV-IL-4 recombinants was not caused by direct toxicity from high levels of IL-4, we administered twice daily (BID) intraperitoneal injections of 3.1 to 100 µg of IL-4 to mock and ECTV-infected C57BL/6 mice during the first 5 days of infection. Uniformly lethal disease was observed in ECTV-infected C57BL/6 mice dosed with 6.3 to 100 µg of IL-4, whereas administration of 100 µg of IL-4 for the same duration to mock-infected animals caused no deaths or weight loss (Figure S1 and Table S2). This data show that the observed lethality of ECTV-IL-4 recombinants infected animals is not directly due to IL-4 toxicity.
To examine in greater detail the effect of virus-expressed IL-4 on pathogenesis, C57BL/6 mice were infected by the FP route with ECTV-WT or ECTV-7.5E/L-IL-4 and tissue viral titers and histopathological changes were monitored at various days p.i. At 3 days p.i., similar virus titers were detected in spleen and livers of ECTV-7.5E/L-IL-4 as compared to ECTV-WT (Table 2). This changed dramatically at day 4 in the liver and day 5 in the spleen. By day 6 p.i. virus titers in spleen and liver homogenates of ECTV-7.5E/L-IL-4 infected C57BL/6 mice had reached 4 × 106 PFU/ml as compared to ECTV-WT values of ~3 × 102 PFU/ml. Histopathologic examination of tissue from sacrificed mice revealed prominent lesions in popliteal and cervical lymph nodes (LNs), bone marrow, thymus, liver, and spleen. Hepatic lesions consisting of focal necrosis were prominent among ECTV-7.5E/L-IL-4 infected C57BL/6 mice by 6 days p.i., and extensive by 7 days p.i. with large areas of the liver showing confluent necrosis. There were no inflammatory cells associated within any areas of necrosis (Figure 2, panel A). In contrast, ECTV-WT infected C57BL/6 mice had fewer numbers and smaller sizes of lesions, which were infiltrated by small lymphocytes (Figure 2, panel C). Another major difference observed in the liver was the presence of large numbers of macrophages in the hepatic vessels of ECTV-7.5E/L-IL-4 infected mice, where ECTV-WT-infected mice showed only a scattering of cells (Figure 2, panels B and D, respectively). The increase in myeloid lineage cells in ECTV-7.5E/L-IL-4 infected C57BL/6 mice was even more prominent in the sternal bone marrow where there was a progressive replacement of normal hematopoietic cells with macrophages. In comparison, the ECTV-WT infected C57BL/6 mice had only a moderate increase in myeloid cells in the sternal bone marrow. In the spleen, histiocytosis and hemorrhage in the red pulp were more prominent in ECTV-7.5E/L-IL-4 than ECTV-WT infected C57BL/6 mice. Although more difficult to evaluate, it appeared that lymphopoiesis (reactivity) was more pronounced in ECTV-WT than ECTV-7.5E/L-IL-4 infected C57BL/6 mice. In the thymus, cortical necrosis was a prominent feature of ECTV-7.5E/L-IL-4 infections, but was undetectable with ECTV-WT. Of the three LNs examined, only the popliteal LN that drained the site of infection showed severe necrotic changes that by day 4 p.i. resulted in complete obliteration of the nodal structure in both ECTV-WT and ECTV-7.5E/L-IL-4 infections. This finding was expected based on the high level of infectivity initially detected in the popliteal LN (data not shown). The cervical and axillary LNs exhibited moderate lymphopoiesis in the ECTV-WT infection with the medulla containing large numbers of immunoblast-like progenitors as well as small lymphocytes. In contrast, similar samples from the ECTV-7.5E/L-IL-4 infections showed little lymphopoietic activity. Table 3 summarizes these observations. In summary, ECTV recombinants expressing IL-4 from promoters of varying strength and temporal regulation were lethal for normally resistant C57BL/6 mice over a wide-range of viral doses. These ECTV-IL-4 recombinants replicated to high titers in spleens and livers correlating with extensive tissue necrosis, and the lack of a detectable inflammatory infiltrate.
Table 2
Table 2
ECTV recombinants expressing IL-4 in resistant C57BL/6 mice replicate to higher titers in spleens and livers than in ECTV-WT infections.
Figure 2
Figure 2
Histopathology of liver from ECTV-7.5E/L-IL-4 infected C57BL/6 mice at 7 days p.i. ECTV-7.5E/L-IL-4 infection. Panel A. Confluent area of necrosis. Mag. 400×; Panel B. A hepatic vessel filled with macrophages. The arrows delineate the boundary (more ...)
Table 3
Table 3
Tissues from ECTV-7.5E/L-IL-4 infected C57BL/6 mice have extensive tissue necrosis without lymphopoiesis.
Transmissibility of ECTV-11KL-IL-4
ECTV-WT is efficiently transmitted from an infected mouse to naïve cage mates over ~ 10 day period (Wallace & Buller, 1985). The transmissibility of ECTV-11KL-IL-4 between C57BL/6 mice is shown in Figure 3. ECTV-WT infected mice transmitted efficiently between 3 and 19 days post-infection. Unexpectedly during the 3 to 5 day p.i. time period, and under conditions where ECTV-WT infected mice transmitted to 3 of 6 (50%) contact mice, ECTV-11KL-IL-4 infected mice failed to transmit to contacts. During the 5 to 7 day p.i. time interval, ECTV-11KL-IL-4 infected mice transmitted to 1 of 6 (17 %) contact mice, while ECTV-WT infected mice transmitted to 6 of 6 (100%) mice. By day 7 the ECTV-11KL-IL-4 infected mice had all died, and therefore from days 7–19 transmissibility data are shown only for ECTV-WT infected mice.
Figure 3
Figure 3
Transmissibility of ECTV-11KL-IL-4 in C57BL/6 mice. Four C57BL/6 mice were infected with 5 × 103 PFU of ECTV-WT or ECTV-11KL-IL-4 in the left rear FP. The infected mice were transferred every 2 days into a new cage containing 6 naïve, (more ...)
Evaluation of VACV vaccination against infection with ECTV-IL-4 recombinants
Vaccination with VACV was evaluated in mousepox resistant C57BL/6, susceptible outbred Swiss Cr:NGP (Swiss), and susceptible inbred A/NCR mice all infected via the FP route (note that C57BL/6 mice are susceptible to infection, but are resistant to lethal mousepox disease as described by (Marchal, 1930). The mousepox susceptible mouse strains are better models for smallpox as human populations are susceptible to disease, and not resistant, to morbidity and mortality following VARV infection. Because the smallpox vaccine is currently the only prophylaxis for controlling an outbreak of smallpox or human monkeypox our first experiment tested the efficacy of a vaccine memory response against challenge with ECTV IL-4 recombinants expressing various amounts of IL-4. Susceptible Swiss and resistant C57BL/6 mice were immunized with 2 × 103 PFU (low dose) or 2 × 104 PFU (high dose) of the Dryvax™ vaccine followed 7 wk later with a challenge of 4 × 104 PFU of ECTV-WT or ECTV-IL-4 recombinants. On a per weight basis the high dose of vaccine is ~100 times greater than the standard vaccine dose used for humans (~2.5 × 105 PFU/dose).
Table 4 summarizes the results of this challenge experiment. As expected the vaccinated mice were completely protected from a lethal challenge with ECTV-WT at both doses of Dryvax™ vaccine. The low dose of vaccine partially protected Swiss mice (5/8 deaths) and fully protected C57BL/6 mice from lethal challenge with ECTV-7.5E-IL-4, which produced the lowest level of IL-4 (Figure 1, 107±16 ng/ml); however, the high dose of vaccine was almost completely protective for Swiss mice (1/8 deaths) and also fully protected C57BL/6 mice. By comparison ECTV-7.5E/L-IL-4 and ECTV-11KL-IL-4, which expressed medium (218±71 ng/ml) and high (1075±413 ng/ml) levels of IL-4 (Figure 1), respectively, were uniformly lethal for Swiss and C57BL/6 mice regardless of the dose of vaccine employed. We also found that immunizing naïve A/NCR mice or C57BL/6 mice with Dryvax™vaccine 7 days prior to challenge with ECTV-11KL-IL-4 did not prevent a uniformly lethal infection (Table S3).
Table 4
Table 4
ECTV-IL-4 recombinants expressing the highest levels of IL-4 cause lethal infections of Swiss and C57BL/6 mice immunized with the Dryvax™ smallpox vaccine.
Dryvax™ immunization followed by ECTV challenge is a heterologous test system in which the vaccine and challenge viruses are different viral species, and therefore not matched antigenically. To test the effectiveness of a homologous test system, C57BL/6 mice were FP “immunized” with ECTV-WT or Dryvax™ and challenged 49 days later with 1,600, 160 or 16 PFU of ECTV-11KL-IL-4 (Table S4). In response to all three ECTV-11KL-IL-4 challenge doses, 18/18 (100%) mock, 15/18 (83%) Dryvax™ and 0/11 (0%) ECTV-WT vaccinated mice died. As compared to mock vaccinated mice, ECTV-WT provided significant protection against death (p=0.0001), but Dryvax™ did not (p=0.23).
Evaluation of prophylaxis with vaccinia immune globulin (VIG)
Vaccinia immunoglobulin is licensed for the treatment of complications of VACV vaccinations in humans, although its efficacy in humans is not well documented (CDC, 2009;Vora, et al., 2008). A/NCR mice were intraperitoneally injected with 2 g/Kg of VIG 4 days prior to FP infection with 130 PFU of ECTV-WT or ECTV-11KL-IL-4. The VIG treatment did not prevent lethal infection with each virus, and did not delay the mean time to death (MTD) as compared to controls receiving placebo (Table S5).
Evaluation of prophylaxis with the antiviral cidofovir (CDV)
CDV is a nucleoside analog of cytosine, and is effective in inhibiting replication of a broad range of DNA viruses including poxviruses through targeting the virus-encoded DNA polymerase (De Clercq & Holy, 2005;De Clercq, 2007;Parker, et al., 2008). A plaque reduction assays yielded a 50% inhibitory concentration of ~10 µM CDV for both ECTV and ECTV-7.5E-IL-4. In addition, the administration of CDV at the time of infection of susceptible A/NCR mice protected against a lethal aerosol challenge of ECTV-WT (Buller, et al., 2004). Table 5 shows CDV protected susceptible A/NCR mice against death following a FP challenge with ECTV-WT and the low IL-4 expressing recombinant, ECTV-7.5E-IL-4 (1/8 mortality), but not recombinants with the higher strength promoters, although the MTD was extended.
Table 5
Table 5
CDV treatment of susceptible A/NCR mice infected with ECTV –IL-4 recombinants.
Evaluation of combinations of treatments
The failure of single modality treatments lead us to evaluate combination treatments. Treatment of A/NCR or C57BL/6 mice with CDV (12.5 mg/kg daily for 5 days) and a monoclonal antibody (mAB; 2 mg/mouse at T=−1, +1, +3 and +5) that specifically neutralizes IL-4 activity protected against an ECTV-11KL-IL-4 lethal challenge, although the anti-IL-4 mAB treatment alone was ineffective for A/NCR mice and only partially effective for C57BL/6 mice (Table S6). Substitution of VIG for the anti-IL-4 mAB did not prevent lethal ECTV-11KL-IL-4 infections when administered with CDV (data not shown).
Mice could be protected from lethal ECTV-11KL-IL-4 infections with CDV if they were first immunized with Dryvax™ and had the memory immunity activated by a second immunization. As shown in Table S7 only mice receiving the prime and boost immunizations and CDV treatment were completely protected from lethal disease at the low (25 PFU) virus challenge dose. Up to 75% protection from death and a significant extension of the MTD was observed at the higher virus challenge doses of 250 and 2,500 PFU.
The above findings suggested that CDV might be effective against the lethal ECTV-11KL-IL-4 infections, if combined with at least one other type of antiviral therapy. Combination antiviral therapy would provide rapid synergistic antiviral activity, whereas a primary or secondary vaccine immunization would have the prerequisite time lag. Preliminary studies evaluated a combination of CDV and ST-246®. ST-246® is an orally available antiviral that is in Phase II clinical trials. ST-246® targets the F13L protein, a major envelope protein required for the production of extracellular virus and consequently virion transport to the surface and virus release (Parker, et al., 2008;Yang, et al, 2005). Administration of CDV and ST-246® consistently provided significant protection against infections with ECTV-11KL-IL-4 (Table S8 and data not shown). Although CDV is suitable for the demonstration of a proof-of-principle, its inherent nephrotoxicity and requirement to be administered intravenously makes it an unsuitable option for wide-scaled human administration. Fortunately, CMX001®, a lipid conjugate of CDV, has an identical intracellular molecular mode of action, is orally administered, is in Phase II clinical trials, and has been shown to be more efficacious against ECTV than CDV. Administration of CMX001® and ST-246® protects ECTV-11KL-IL-4 intranasally infected A/NCR mice from mortality (Table 6) and weight loss (Figure 4).
Table 6
Table 6
Combination therapy with ST-246 and CMX001 protects mice against infection with ECTV-11KM-IL-4
Figure 4
Figure 4
Efficacy of ST-246® and CMX001® combination treatment against ECTV-11KL-IL-4 in A/NCR mice. Female A/NCR (n=5) mice were inoculated intranasally with 200 PFU of ECTV-11KL-IL-4. Commencing at 6 hrs p.i., mice were treated by gavage daily (more ...)
We constructed a series of ECTV recombinants expressing murine IL-4 or non-functional IL-4D116/D119 mutant under the control of different promoters with varying strengths and temporal regulation. The expression of the murine IL-4 gene was consistent with the reported strengths of the tested promoters. Accordingly, the ECTV-7.5E-IL-4 and ECTV-11KL-IL-4 recombinants were observed to produce in vitro and in vivo the lowest and the highest levels of IL-4, respectively. There was no obvious difference in the pathogenesis of disease that could be attributed to promoter strength, unless virus replication was reduced by prophylaxis. In ECTV-7.5E-IL-4 infections, protection from death in the inherently susceptible A/NCR and Swiss strains could be reduced by Dryvax™ immunization or CDV treatment. Based on this observation, we selected the ECTV-11KL-IL-4 recombinant, which produced the highest level of IL-4, as the challenge virus for evaluation of the robustness of the various treatments.
The IL-4 levels generated in vitro by the Jackson et al. ECTV-IL-4 recombinant were not reported, but would likely be comparable to our ECTV-7.5E/L-IL-4 that utilized an identical promoter, but lacked a fully functional tk gene and contained an insertion in the orthologue of the VACV F7L ORF. The IL-4 levels induced by all ECTV recombinants far exceeded that achieved by other vectors. For example, adenovirus and P. aeruginosa vectors achieved maximal systemic levels of 150 pg/ml and ~100ng/ml of IL-4, respectively, following intravenous infection of mice (Giampietri, et al., 2000;Kim, et al., 2000). For the following reasons we conclude the lethality of the ECTV-IL-4 recombinants results from virus-expressed IL-4 signaling through the IL-4 and/or IL-13 receptor and not due to IL-4 toxicity or the contribution of host-expressed IL-4: 1. immunized BALB/c-Il4ratm1Sz mice lacking a functional IL-4 receptor were resistant to lethal infection; 2. administration of 6.3 to 100 µg of exogenous IL-4 was lethal for ECTV-WT-infected, but not mock-infected, C57BL/6 mice; 3. the non-signaling ECTV-IL-4D116/D119 recombinants behaved as ECTV-WT; and 4. C57BL/6-Il4tm1Nnt mice lacking the ability to make IL-4 were equally susceptible to lethal infection.
ECTV expressed IL-4 could exert its effect on cells in two distinct ways. The large amounts of biologically active IL-4 secreted from ECTV-IL-4 infected cells could induce physiological changes through the IL-4 receptor ubiquitously found on a large number of cell types. In addition, virus expressed IL-4 could be non-specifically trapped within the virion during assembly and released within the cell’s cytoplasm in the subsequent replication cycle as previously shown for chloramphenicol acetyl transferase (Franke & Hruby, 1987). Indeed western blot analysis of sucrose gradient, band-purified virions from ECTV-IL-4 infected cells detected ~ 7 × 105 molecules of IL-4/virion (Figure S2); however, for the virion associated IL-4 to have physiological effects, it would need to have access to recently synthesized IL-4 receptor or receptor on the cell surface as no IL-4 receptor independent pathways for IL-4 function has yet to be described.
The Jackson et al. study reported ECTV-IL-4 recombinant infections associated with increased viral titers in spleens, and diminished splenic NK and T cell lytic and IFN-γ responses. In our studies we also observed increased viral titers in assayed tissues. Histopathologic examination of sacrificed mice revealed large areas of the liver showing confluent necrosis without associated inflammatory cells. Another major difference from ECTV-WT infections was the presence in the hepatic vessels of large numbers of macrophages and a progressive replacement of normal hematopoietic cells with macrophages in the bone marrow. This is consistent with a recent study that has shown that exogenously provided IL-4 can also drive expansion of macrophage populations in uninfected mice (Milner, et al., 2010). In ECTV-7.5E/L-IL-4 infections, histiocytosis and hemorrhage in the red pulp of the spleen were more prominent and in general lymphopoiesis was reduced in examined lymphoid tissue. In summary, ECTV-IL-4 recombinants replicated to high titers in lymphoid organs and the liver correlating with extensive tissue necrosis, and the lack of a detectable protective inflammatory infiltrate. We speculate that a major factor contributing to the lethality of ECTV-IL-4 recombinants is its lymphoid tissue tropism, resulting in focal production of extremely high levels of IL-4 at the sites of primary and memory adaptive immune responses. This hypothesis may explain the failure of other virus-IL-4 recombinants to cause similar disease.
In spite of replicating to higher titers in examined tissues, surprisingly ECTV-11KL-IL-4 infected mice were less efficient in transmission to contacts suggesting an effect of IL-4 on virus replication in the skin, the primary source of transmissible virus. Based on severe immunosuppression induced in the ECTV-IL-4 recombinant infections and reduced transmissibility, we speculate that a VARV expressing human IL-4 may cause a disease similar to, or more severe than hemorrhagic smallpox. Hemorrhagic smallpox is thought to occur in subjects with varying degrees of immunodeficiency. As compared to ordinary smallpox, it presents with a shorter time to death and more severe disease manifestations that may result in earlier hospitalization and/or isolation, which could result in less efficient person-to-person transmission of VARV.
Treatments using the VACV-based Dryvax™ smallpox vaccine (prime or prime/boost formats) and VIG were thoroughly evaluated and found to be ineffective against ECTV-IL-4 recombinants producing the greatest amounts of IL-4. Prime/boost immunizations failed to protect even when challenges were initiated during a period when high levels of virus specific T cells and antibodies were present in blood. It was of interest to note that prior infection with ECTV-WT completely protected mice from lethal ECTV-IL-4 recombinant infections. This protective effect was also observed by Jackson et al. where an attenuated, recombinant ECTV (ECTV-602) was able to protect 40% of immunized C57BL/6 or BALB/c mice from challenge with an ECTV-IL-4 recombinant employing the 7.5E/L promoter. This differential effect might reflect the differences in antigenicity of VACV as compared to ECTV (even though the genomes of the viruses share ~95% nucleotide identity) and as a consequence of the significantly greater systemic replication competence of ECTV as compared to VACV in mice (Chen, et al., 2003;Bray, et al., 2000;Neyts, et al., 2010;Smee, et al., 2004).
Although it can be problematic to extrapolate conclusions from one system to another, the biology of IL-4 appears to be quite similar in mouse and human species (Okada, et al., 2003). Therefore, it is possible that a VARV-IL-4 recombinant would also break through the immunity generated by a vaccine based on VACV (e.g. Dryvax™, ACAM2000, MVA or Lister). It is possible that a vaccine composed of key protective antigens from VARV could provide improved efficacy against such a VARV-IL-4 recombinant.
We also evaluated small molecule inhibitors of specific steps in the virus replication cycle for their efficacy against ECTV recombinants expressing high levels of IL-4. We confirmed the finding of Robbins et al that the DNA polymerase inhibitor, CDV, was ineffective at protecting inherently susceptible mice from lethal ECTV-IL-4 infections (Robbins, et al., 2005). Similarly, an oral lipid conjugate of CDV, CMX001®, or the virus transport and release inhibitor, ST-246®, failed to protect against lethal ECTV-11KL-IL-4 infections at doses and regimens used in this study; however, the combined administration of CDV or CMX001® and ST-246® significantly protected against lethal IN or FP challenges with ECTV-11KL-IL-4. Although this combination of antivirals worked well, the added presence of memory immunity provided by the licensed smallpox vaccine might provide an additional margin of protection. Also useful would be a third antiviral that specifically targets transcription, which would prevent expression of all transgenes regardless of activity.
The failure of antiviral monotherapy to protect mice from ECTV-IL-4 recombinants is consistent with experimental and clinical data that suggests a functioning immune system is necessary for successful antiviral treatment of robust poxvirus infection. ST-246 protected against lethal challenges in all tested immunocompetent animal models, and provided full protection in some, but not all immunodeficient hosts infected with VACV strain WR (Grosenbach, et al., 2010). Similarly, CDV treatment of vaccinia or cowpox virus infections of athymic nude, SCID, or cyclophosphamide treated mice failed to clear infections (Bray, et al., 2000;Neyts, et al., 2010;Smee, et al., 2004). In 2007, a child with eczema vaccinatum, a life-threatening complication of VACV infection, was treated with VIG alone and then in combination with CDV and finally with a second antiviral, ST-246, prior to clinical progress and recovery was observed (Vora s et al 2008). Similarly, in 2008, a case of progressive vaccinia, a rare and often fatal adverse event to vaccination with smallpox vaccine, was treated with VIG and then in combination with ST-246, Imiquimod, and CMX001 (CDC, 2009). In both cases a monotherapy evolved into a combination therapy due to the lack of clinical response. These two clinical cases, which involved patients with varying degrees of immunodeficiency, the available antiviral studies using immunodeficient animal hosts, and our work here with a virus that induces a profound immunodeficient state suggest that more research is needed to evaluate combination antiviral therapies against poxviruses. This is particularly relevant as a portion of the population is immunosuppressed or immunocompromised (Handley, et al., 2009). Combination antiviral therapy with compounds that target different pathways in virus replication have the added benefit of mitigating against the evolution of resistance, which is the inevitable consequence of monotherapy.
ECTV-IL-4 recombinants could be useful tools for evaluating the potency of candidate antivirals, since they induce a profound immunosuppression in all tested mouse strains whether genetically resistant or susceptible to severe mousepox. Furthermore, our studies indicate it should be possible to develop effective countermeasures against poxviruses expressing IL-4 or other molecules. And finally, the reduced transmissibility of ECTV-11KL-IL-4 for mice suggests that poxviruses expressing IL-4, while lethal for those infected, may or may not initiate an epidemic.
Cells and viruses
BSC-1 cells (ATCC CCL 26) were grown in Eagle’s minimum essential medium (MEM) containing 10% fetal calf serum (FCS) (Hyclone III, Logan, UT), 2 mM L-glutamine (GIBCO, Grand Island, NY), 100 U/ml penicillin (GIBCO, Grand Island, NY), and 100 µg/ml streptomycin (GIBCO, Grand Island, NY). CT4R cells were the kind gift of William Paul and were grown as described in Gros et al. (Le Gros, et al., 1990). A plaque-purified isolate of the MOS strain of ECTV (ATCC VR-1374) designated MOS-3-P2, was propagated in an African green monkey kidney cell line, BSC-1 (Chen, et al., 1992). Virus was purified through a sucrose cushion as described elsewhere (Moss, 1998). Virus infectivity was estimated as described previously (Wallace & Buller, 1985). Briefly, virus suspensions were serially diluted in PBS +1% Fetal Calf Serum (Fetal Clone II, HyClone), absorbed to monolayers for 1 hr at 37° C, and overlaid with a suspension of 1% carboxyl methyl cellulose in DMEM +5 % Fetal clone II. After 4 days at 37°C, virus plaques were visualized and virus inactivated by the addition to each well of 0.5 ml of a 0.3% crystal violet/10% formalin solution.
Construction of ectromelia recombinants expressing murine IL-4
The IL-4 gene was PCR-amplified from the plasmid p2A-E3 (ATCC, 37561) using Deep Vent DNA polymerase (New England Biolabs, Inc., Beverly, MA), and a pair of primers: 5'-GCGCTCGAGGGATCCGAATTCACCATGGGTCTCAACCCCCAGCTAG-3’ (5’-primer) and 5'-GCGCCCGGGAAGCTTCTACGAGTAATCCATTTGC-3' (3’-primer), which created Xho I, BamH I and EcoR I (underlined) at the 5’ terminus, and Sma I and Hind III (underlined) at the 3’ terminus of the gene. The IL-4D116/D119 mutant of was similarly amplified using the same 5’-primer and new 3’ primer (5'-GCGCCCGGGAAGCTTCTACGAGTCATCCATATCCATGATGCTCTTTAGG-3'), resulting in substitution of both glutamine 116 and tyrosine 119 by aspartic acid. The PCR-amplified IL-4 was cloned into pKT1012 (gpt) regulated by Pkt10, a synthetic strong early promoter (SSE) (5'-AAAAATTGAAAAACTAGCGTCTTTTTTTGCTCGA of VACV to yield pKT1012 (gpt)-IL-4 (Tsung, Yim et al., 1996). pKT1012 (gpt) was derived from pKT1012 (kindly provided by Dr. Tsung) by digesting it with Nde I and EcoR V to remove the Escherichia coli guanine phosphoribosyltransferase (E. coli gpt) gene followed by Klenow-blunting and self-ligation. The PCR-amplified IL-4 was digested with BamH I and Sma I, and cloned into pKT0334 under the control of VACV 11K late promoter (11KL) (5'-TAGTAGAATTTCATTTTGTTTTTTTCTATGCTATAAATA. Bold indicates G to A change (Meko, Yim et al., 1995). The SSE- and 11KL-IL-4 expression cassettes were obtained from their respective plasmids and cloned into the Bgl II and Hind III cut ECTV transfer vector pMBEV1.1 (Figure 1A). To optimize the expression of IL-4 in pMBEV-11KL-IL-4, a “C” in the sequence TTTTCTT was changed to a “T”, and a “G” to an “A” in TAAATG by a two-step PCR protocol. pMBEV.1 contains unique Bgl II and Hind III sites flanked by the sequences from the ECTV CHO host range (hr) homologue with the E. coli gpt gene driven by the VACV P7.5 early promoter as a transient dominant selectable marker outside of the flanking sequences. The VACV P7.5 early promoter (5'-AAAAGTAGAAAATATATTCTAATTTATTGCACGG. was synthesized by annealing the following oligonucleotides: 5'-GATCTAGAAAAGTAGAAAATATATTCTAATTTATTGCACG GATCCGAATTCA-3' (sense strand) and 5'-AGCTTGAATTCGGATCCGTGCAATAAATT AGAATATATTTTCTACTTTTCTA-3' (anti-sense strand), and ligated into pMBEV.1 which was cut by Bgl II and Hind III. The PCR-amplified IL-4D116/D119 gene digested by EcoR I and Hind III were cloned into the same-cut pMBEV-7.5E downstream from the promoter 7.5E to yield pMBEV-7.5E-IL-4 and pMBEV-7.5E-IL-4D116/D119, respectively. The 11KL-IL-4D116/D119 construct was generated by replacing the IL-4 gene of pMBEV-11KL-IL-4 with the IL-4D116/D119 gene from pMBEV-7.5E-IL-4D116/D119. The VACV P7.5 early/late promoter (7.5EL) (5'-GGTAGTTGCGATATACATAAACTGATCACTAATTCCAAACCCACCCGCTTTTTATAGTAAGTT TTTCACCCATAAATAATAAATACAATAATTAATTTCTCGTAAAAGTAGAAAATATATTCTAA TTTATTGCACGG. was PCR-amplified from VACV WR using following pair of primers: 5'-GCGAGATCTGGTAGTTGCGATATACATAAACTG-3' and 5'-GCGGAATTCGGATCCGTGCAATAAATTAGAATATATTTTCTAC-3' which created Bgl II (underlined) at the 5’ terminus, and EcoR I and BamH I (underlined) at the 3’ terminus. This p7.5EL was cloned into pMBEV-7.5E-IL-4 and pMBEV-7.5E-IL-4D116/D119 replacing the p7.5E. The DNA sequence of all final constructs was verified by sequencing. The methods for generation and screening of recombinant ECTV have been described previously for VACV (Falkner & Moss, 1990).
Quantitation of IL-4 expression by recombinant ectromelia viruses
IL-4 in culture supernatant was detected by Western blot using a 15% SDS-PAGE, PVDF membrane, and a biotinylated anti-mouse IL-4 antibody (Cat# BAF404, R&D Systems, Inc., Minneapolis, MN). The signal was developed with an ECL plus Western Blotting Detection System (Amersham Pharmacia Biotech Inc., Piscataway, NJ). The ELISA utilized a rat anti-IL-4 monoclonal and biotinylated goat anti-IL-4 polyclonal as a capture and detection antibodies, respectively (Cat# MAB404 (clone 30340) and BAF404, R & D Systems, Inc.). The IL-4 bioassay utilized a CT.4R cells which proliferate in response to IL-4. Proliferation was measured by 3H-thymidine incorporation. For each assay, IL-4 was quantitated using a standard curve generated from purified baculovirus-expressed recombinant mouse IL-4 (Pharmingen, San Diego, CA).
Animals
Four to six week old female (C57BL/6, A/NCr, Cr:NGP, BALB/c, C57BL/6-Il4tm1Nnt and BALB/c-Il4ratm1Sz mice were obtained from Charles River Laboratories, Inc., Wilmington, MA or from Jackson Laboratory, Bar Harbor, MA., housed in filter-top microisolator cages and fed commercial mouse chow and water, ad libitum. The mice were housed in an animal biosafety level 3 containment areas. Indicated viruses were introduced into the mice by needle inoculation into a single FP. All mice were housed under pathogen-free condition in the AAALAC accredited Comparative Medicine Department of Saint Louis University School of Medicine. All experimentation was performed in a BSL-3 facility within the vivarium in order to protect the mouse stocks from inadvertent infection with ECTV. All experiments were carried out in accordance with regulations set forth by Saint Louis University, complying with all laws and regulations of USDA and PHS (OLAW/NIH).
Viral infections, tissue assays and histopathology
Mice were anesthetized with a CO2 80%/O2 20% gas mixture, and inoculated in the right rear footpad with 10–25 µl of ECTV-WT or recombinant viruses in the form of crude cellular, sucrose cushion purified or sucrose band purified preparations as described before. Mice were observed daily for disease signs. In certain experiments mice were weighed daily or every other day to record weight change.
Mice were bled via the orbital sinus with micro-hematocrit capillary tubes to measure serum levels of IL-4 and/or sacrificed at various times after infection in a CO2 80%/O2 20% gas mixture to examine tissue for pathology and to measure virus infectivity levels in spleen, and liver tissues. Tissue was ground in PBS (10% w/v), frozen and thawed three times, and sonicated for 20 seconds followed by titration on BSC-1 monolayers. Tissues were fixed in phosphate-buffered formalin, embedded in paraffin, sectioned into 4-µm sections, and stained with hematoxylin and eosin before being examined by light microscopy. The following tissues were examined: lung (inflated), heart, esophagus, thymus, salivary glands, cervical LNs, kidney, liver, spleen, ileum, sternal bone marrow, popliteal LN, axillary LN and pancreas.
Remaining mice were observed for clinical signs of disease (morbidity) and mortality. Mice found in a moribund condition (hunched posture and labored breathing) were sacrificed. On termination of certain experiment, mice were sacrificed, and spleen and liver tissues were harvested and tested for residual virus infectivity.
Treatments
The Dryvax™ vaccine was obtained from CDC and reconstituted as recommended by the manufacturer. Mice were vaccinated at the base of the tail or in the FP. CDV (CDV; [S]-1-[3-hydroxy-2-phosphonylmethoxypropyl]cytosine, HPMPC) was provided as a gift by Gilead Sciences, Inc. (Foster City, CA) under the trademark name Vistide®. It was injected by the intraperitoneal route. A lipid conjugate of CDV, CMX001® (Chimerix Inc. Durham, NC), and/or ST-246® (SIGA Technologies Inc, New York, NY) were administered by oral gavage in a volume of 100 µl. On the first day ST-246® (100 mg/kg) or ST-246® vehicle was administered at ~ 4 PM, 6 hrs after infection. On days 1–14, CMX001® (4 mg/kg) or CMX001® vehicle was administered at ~8:00 AM and ST-246® (100 mg/kg) or ST-246® vehicle was administered at ~4:00 PM. A rat anti-IL-4 mAB (clone 11B11, IgG1) or a rat isotype control mAB (anti-muLVgag30, clone R187, IgG1) were injected by the intraperitoneal route. The antibodies were produced in Integra CL 350 growth chambers (INTEGRA Biosciences, Inc.) purified by ion-exchange and size exclusion chromatography, and determined to be ~ 80% pure by SDS-PAGE followed by silver staining.
Statistics
An unpaired two-tailed t-test was used to compare the means of two groups of mice. P values below 0.05 were considered statistically significant. Mortality rates were compared using Fisher’s exact test. LD50 values were calculated as described (Reed & Muench, 1938).
01
Figure 1S. Weight changes of ECTV-WT infected mice administered exogenous IL-4. C57BL/6 mice (n=5) were FP administered saline (indicated with −) or 3 × 104 PFU of ECTV-WT (indicated with +). Commencing at 4 hrs p.i., mice were treated by the intraperitoneal route twice daily for 5 consecutive days with sterile water or the indicated dose of IL-4. Mice were weighed three times weekly. Veh indicates IL-4 placebo. For clarity, error bars have not been shown; however, they do indicate similar kinetics of weight change.
Figure 2S. IL-4 is associated with virions of ECTV-11KL-IL-4. ECTV-WT and ECTV-11KL-IL-4 virions were purified from infected cells by differential centrifugation, sedimentation through a 36% sucrose cushion and banding in 24–40% sucrose gradients (Moss & Earl, 2001). Two µg of each virion preparation and a dilution series of baculovirus expressed IL-4 were separated on a 4–20% gradient NuPage gel and IL-4 protein detected by western blot.
Acknowledgments
This work was supported by NIAID NOI-AI-15436 and subcontract 25XS065. We thank Ed Hembrador for assaying virus infectivity, and Elsa Taricone, and Christina Oberle for technical assistance. We also thank Drs. Michael Bray, Heather Greenstone, Dennis Dixon, Denis Hruby, Guna Karupiah, Peter Jahrling, Cliff Lane, George Painter, and Jorge Tavel for helpful discussions.
Footnotes
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
  • Andreansky S, He B, van Cott J, McGhee J, Markert JM, Gillespie GY, Roizman B, Whitley RJ. Treatment of intracranial gliomas in immunocompetent mice using herpes simplex viruses that express murine interleukins. Gene Ther. 1998;5:121–130. [PubMed]
  • Andrew ME, Coupar BE. Biological effects of recombinant vaccinia virus-expressed interleukin 4. Cytokine. 1992;4:281–286. [PubMed]
  • Bembridge GP, Lopez JA, Cook R, Melero JA, Taylor G. Recombinant vaccinia virus coexpressing the F protein of respiratory syncytial virus (RSV) and interleukin-4 (IL-4) does not inhibit the development of RSV-specific memory cytotoxic T lymphocytes, whereas priming is diminished in the presence of high levels of IL-2 or gamma interferon. J.Virol. 1998;72:4080–4087. [PMC free article] [PubMed]
  • Benedetti S, Di Meco F, Cirenei N, Bruzzone MG, Pollo B, Florio N, Caposio L, Colombo MP, Cattaneo E, Finocchiaro G. IL-4 gene transfer for the treatment of experimental gliomas. Adv.Exp.Med.Biol. 1998;451:315–321. [PubMed]
  • Bertholet C, Drillien R, Wittek R. One hundred base pairs of 5' flanking sequence of a vaccinia virus late gene are sufficient to temporally regulate late transcription. Proc.Natl.Acad.Sci.U.S.A. 1985;82:2096–2100. [PubMed]
  • Bray M, Martinez M, Smee DF, Kefauver D, Thompson E, Huggins JW. Cidofovir protects mice against lethal aerosol or intranasal cowpox virus challenge. J.Infect.Dis. 2000;181:10–19. [PubMed]
  • Buller RM, Owens G, Schriewer J, Melman L, Beadle JR, Hostetler KY. Efficacy of oral active ether lipid analogs of cidofovir in a lethal mousepox model. Virology. 2004;318:474–481. [PubMed]
  • Buller RML, Fenner F. The mouse in biomedical research. New York: Elsevier; 2007.
  • CDC. Progressive Vaccinia in a military Smallpox Vaccinee - United States. MMWR. 2009;58:1–4. [PubMed]
  • Chen N, Danila MI, Feng Z, Buller RM, Wang C, Han X, Lefkowitz EJ, Upton C. The genomic sequence of ectromelia virus, the causative agent of mousepox. Virology. 2003;317:165–186. [PubMed]
  • Chen W, Drillien R, Spehner D, Buller RM. Restricted replication of ectromelia virus in cell culture correlates with mutations in virus-encoded host range gene. Virology. 1992;187:433–442. [PubMed]
  • Coupar BE, Oke PG, Andrew ME. Insertion sites for recombinant vaccinia virus construction: effects on expression of a foreign protein. J.Gen.Virol. 2000;81:431–439. [PubMed]
  • Davison AJ, Moss B. Structure of vaccinia virus early promoters. J.Mol.Biol. 1989;210:749–769. [PubMed]
  • De Clercq E. Acyclic nucleoside phosphonates: past, present and future. Bridging chemistry to HIV, HBV, HCV, HPV, adeno-, herpes-, and poxvirus infections: the phosphonate bridge. Biochem.Pharmacol. 2007;73:911–922. [PubMed]
  • De Clercq E, Holy A. Acyclic nucleoside phosphonates: a key class of antiviral drugs. Nat.Rev.Drug Discov. 2005;4:928–940. [PubMed]
  • Falkner FG, Moss B. Transient dominant selection of recombinant vaccinia viruses. J.Virol. 1990;64:3108–3111. [PMC free article] [PubMed]
  • Fernandez M, Porosnicu M, Markovic D, Barber GN. Genetically engineered vesicular stomatitis virus in gene therapy: application for treatment of malignant disease. J.Virol. 2002;76:895–904. [PMC free article] [PubMed]
  • Fischer JE, Johnson JE, Kuli-Zade RK, Johnson TR, Aung S, Parker RA, Graham BS. Overexpression of interleukin-4 delays virus clearance in mice infected with respiratory syncytial virus. J.Virol. 1997;71:8672–8677. [PMC free article] [PubMed]
  • Franke CA, Hruby DE. Association of non-viral proteins with recombinant vaccinia virus virions. Arch.Virol. 1987;94:347–351. [PubMed]
  • Gessner A, Rollinghoff M. Biologic functions and signaling of the interleukin-4 receptor complexes. Immunobiology. 2000;201:285–307. [PubMed]
  • Ghiasi H, Cai S, Slanina SM, Perng GC, Nesburn AB, Wechsler SL. The role of interleukin (IL)-2 and IL-4 in herpes simplex virus type 1 ocular replication and eye disease. J.Infect.Dis. 1999;179:1086–1093. [PubMed]
  • Ghiasi H, Osorio Y, Perng GC, Nesburn AB, Wechsler SL. Recombinant herpes simplex virus type 1 expressing murine interleukin-4 is less virulent than wild-type virus in mice. J.Virol. 2001;75:9029–9036. [PMC free article] [PubMed]
  • Giampietri A, Grohmann U, Vacca C, Fioretti MC, Puccetti P, Campanile F. Dual effect of IL-4 on resistance to systemic gram-negative infection and production of TNF-alpha. Cytokine. 2000;12:417–421. [PubMed]
  • Grosenbach DW, Berhanu A, King DS, Mosier S, Jones KF, Jordan RA, Bolken TC, Hruby DE. Efficacy of ST-246 versus lethal poxvirus challenge in immunodeficient mice. Proc.Natl.Acad.Sci.U.S A. 2010;12:838–843. [PubMed]
  • Grunewald SM, Kunzmann S, Schnarr B, Ezernieks J, Sebald W, Duschl A. A murine interleukin-4 antagonistic mutant protein completely inhibits interleukin-4-induced cell proliferation, differentiation, and signal transduction. J.Biol.Chem. 1997;272:1480–1483. [PubMed]
  • Handley LM, Buller RL, Frey SE, Bellone CJ, Parker S. The new ACAM200 vaccine and other therapies to control orthopoxvirus outbreaks and bioterror attacks. Expert Reviews. 2009;8:841–850. [PubMed]
  • Ikemoto K, Pollard RB, Fukumoto T, Morimatsu M, Suzuki F. Small amounts of exogenous IL-4 increase the severity of encephalitis induced in mice by the intranasal infection of herpes simplex virus type 1. J.Immunol. 1995;155:1326–1333. [PubMed]
  • Jackson RJ, Maguire DJ, Hinds LA, Ramshaw IA. Infertility in mice induced by a recombinant ectromelia virus expressing mouse zona pellucida glycoprotein 3. Biol.Reprod. 1998;58:152–159. [PubMed]
  • Jackson RJ, Ramsay AJ, Christensen CD, Beaton S, Hall DF, Ramshaw IA. Expression of mouse interleukin-4 by a recombinant ectromelia virus suppresses cytolytic lymphocyte responses and overcomes genetic resistance to mousepox. J. Virol. 2001;75:1205–1210. [PMC free article] [PubMed]
  • Kerr PJ, Perkins HD, Inglis B, Stagg R, McLaughlin E, Collins SV, van Leeuwen BH. Expression of rabbit IL-4 by recombinant myxoma viruses enhances virulence and overcomes genetic resistance to myxomatosis. Virology. 2004;324:117–128. [PubMed]
  • Kim SH, Evans CH, Kim S, Oligino T, Ghivizzani SC, Robbins PD. Gene therapy for established murine collagen-induced arthritis by local and systemic adenovirus-mediated delivery of interleukin-4. Arthritis Res. 2000;2:293–302. [PMC free article] [PubMed]
  • Le Gros G, Ben Sasson SZ, Seder R, Finkelman FD, Paul WE. Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro: IL-2 and IL-4 are required for in vitro generation of IL-4-producing cells. J.Exp.Med. 1990;172:921–929. [PMC free article] [PubMed]
  • Lukacs NW, Addison CL, Gauldie J, Graham F, Simpson K, Strieter RM, Warmington K, Chensue SW, Kunkel SL. Transgene-induced production of IL-4 alters the development and collagen expression of T helper cell 1-type pulmonary granulomas. J.Immunol. 1997;158:4478–4484. [PubMed]
  • Marchal J. Infectious ectromelia. A hitherto undescribed virus disease of mice. J.Pathol.Bacteriol. 1930;33:713–718.
  • Meko JB, Yim JH, Tsung K, Norton JA. High cytokine production and effective antitumor activity of a recombinant vaccinia virus encoding murine interleukin 12. Cancer Res. 1995;55:4765–4770. [PubMed]
  • Milner JD, Orekov T, Ward JM, Cheng L, Torres-Velez F, Junttila I, Sun G, Buller M, Morris SC, Finkelman FD, Paul WE. Sustained IL-4 exposure leads to a novel pathway for hemophagocytosis, inflammation and tissue macrophage accumulation. Blood. 2010 [PubMed]
  • Moran TM, Isobe H, Fernandez-Sesma A, Schulman JL. Interleukin-4 causes delayed virus clearance in influenza virus-infected mice. J.Virol. 1996;70:5230–5235. [PMC free article] [PubMed]
  • Mosmann TR, Yokota T, Kastelein R, Zurawski SM, Arai N, Takebe Y. Species-specificity of T cell stimulating activities of IL 2 and BSF-1 (IL 4): comparison of normal and recombinant, mouse and human IL 2 and BSF-1 (IL 4) J.Immunol. 1987;138:1813–1816. [PubMed]
  • Moss BaEPL. Current Protocols in Molecular Biology. Wiley; 1998. Expression of proteins in mammalian cells using vaccinia cirus vectors. Overview of the vaccinia virus expression system; pp. 16.15.1–16.15.5.
  • Moss B, Earl PL. Overview of the vaccinia virus expression system. Curr.Protoc.Protein Sci. 2001;Chapter 5 Unit5. [PubMed]
  • Mullbacher A, Lobigs M. Creation of killer poxvirus could have been predicted. J.Virol. 2001;75:8353–8355. [PMC free article] [PubMed]
  • Neyts J, leyssen P, Verbeken E, De Clercq E. Efficacy of cidofovir in a murine model of disseminated progressive vaccinia. Antimicrob.Agents Chemother. 2010;48:2267–2273. [PMC free article] [PubMed]
  • Norazmi MN. Possible mechanism for the enhanced lethality of an interleukin-4-expressing mousepox virus. J.Med.Microbiol. 2001;50:936. [PubMed]
  • Okada H, Banchereau j, Lotze M. Interleukin-4A. In: Thomson A, Lotze M, editors. The cytokine handbook. London: Elsevier; 2003.
  • Painter GR, Hostetler KY. Design and development of oral drugs for the prophylaxis and treatment of smallpox infection. Trends Biotechnol. 2004;22:423–427. [PubMed]
  • Parker S, Handley L, Buller RM. Therapeutic and prophylactic drugs to treat orthopoxvirus infections. Future Virology. 2008;3:595–612. [PMC free article] [PubMed]
  • Parker S, Siddiqui AM, Oberle C, Hembrador E, Lanier R, Painter G, Robertson A, Buller RM. Mousepox in the C57BL/6 strain provides an improved model for evaluating anti-poxvirus therapies. Virology. 2009;385:11–21. [PMC free article] [PubMed]
  • Parker S, Touchette E, Oberle C, Almond M, Robertson A, Trost LC, Lampert B, Painter G, Buller RM. Efficacy of therapeutic intervention with an oral ether-lipid analogue of cidofovir (CMX001) in a lethal mousepox model. Antiviral Res. 2008;77:39–49. [PubMed]
  • Paul WE, Ohara J. B-cell stimulatory factor-1/interleukin 4. Annu.Rev.Immunol. 1987;5:429–459. [PubMed]
  • Reed LJ, Muench HA. A simple method of estimating fifty percent endpoints. Am.J.Hygiene. 1938;27:493–497. Ref Type: Journal (Full)
  • Robbins SJ, Jackson RJ, Fenner F, Beaton S, Medveczky J, Ramshaw IA, Ramsay AJ. The efficacy of cidofovir treatment of mice infected with ectromelia (mousepox) virus encoding interleukin-4. Antiviral Res. 2005;66:1–7. [PubMed]
  • Sharma DP, Ramsay AJ, Maguire DJ, Rolph MS, Ramshaw IA. Interleukin-4 mediates down regulation of antiviral cytokine expression and cytotoxic T-lymphocyte responses and exacerbates vaccinia virus infection in vivo. J.Virol. 1996;70:7103–7107. [PMC free article] [PubMed]
  • Smee DF, Wong MH, Bailey KW, Beadle JR, Hostetler KY, Sidwell RW. Effects of four antiviral substances on lethal vaccinia virus (IHD strain) respiratory infections in mice. Int.J.Antimicrob.Agents. 2004;23:430–437. [PubMed]
  • Stanford MM, McFadden G. The 'supervirus'? Lessons from IL-4-expressing poxviruses. Trends Immunol. 2005;26:339–345. [PubMed]
  • Tsung K, Yim JH, Marti W, Buller RM, Norton JA. Gene expression and cytopathic effect of vaccinia virus inactivated by psoralen and long-wave UV light. J.Virol. 1996;70:165–171. [PMC free article] [PubMed]
  • Vora S, Damon I, Fulginiti V, Weber SG, Kahana M, Stein SL, Gerber SI, Garcia-Houchins S, Lederman E, Hruby D, Collins L, Scott D, Thompson K, Barson JV, Regnery R, Hughes C, Daum RS, Li Y, Zhao H, Smith S, Braden Z, Karem K, Olson V, Davidson W, Trindale GBT, Jordan R, Tien D, Marcinak J. Severe eczema vaccinatum in a household contact of a smallpox vaccinee. Clin Infect Dis. 2008;15:1555–1561. [PubMed]
  • Wallace GD, Buller RM. Kinetics of ectromelia virus (mousepox) transmission and clinical response in C57BL/6j, BALB/cByj and AKR/J inbred mice. Lab Anim Sci. 1985;35:41–46. [PubMed]
  • Yang G, Pevear DC, Davies MH, Collett MS, Bailey T, Rippen S, Barone L, Burns C, Rhodes G, Tohan S, Huggins JW, Baker RO, Buller RL, Touchette E, Waller K, Schriewer J, Neyts J, DeClercq E, Jones K, Hruby D, Jordan R. An orally bioavailable antipoxvirus compound (ST-246) inhibits extracellular virus formation and protects mice from lethal orthopoxvirus Challenge. J.Virol. 2005;79:13139–13149. [PMC free article] [PubMed]