PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of plosonePLoS OneView this ArticleSubmit to PLoSGet E-mail AlertsContact UsPublic Library of Science (PLoS)
 
PLoS One. 2010; 5(12): e14200.
Published online Dec 2, 2010. doi:  10.1371/journal.pone.0014200
PMCID: PMC2996288
A Role for Thrombospondin-1 Deficits in Astrocyte-Mediated Spine and Synaptic Pathology in Down's Syndrome
Octavio Garcia, Maria Torres, Pablo Helguera, Pinar Coskun, and Jorge Busciglio*
Department of Neurobiology and Behavior, Institute for Memory Impairments and Neurological Disorders (iMIND), Center for the Neurobiology of Learning and Memory (CNLM), University of California Irvine, Irvine, California, United States of America
Mel B. Feany, Editor
Brigham and Women's Hospital, Harvard Medical School, United States of America
* E-mail: jbuscigl/at/uci.edu
Conceived and designed the experiments: OG JB. Performed the experiments: OG MT PH PC. Analyzed the data: OG MT PH PC JB. Wrote the paper: OG JB.
Received July 2, 2010; Accepted November 15, 2010.
Background
Down's syndrome (DS) is the most common genetic cause of mental retardation. Reduced number and aberrant architecture of dendritic spines are common features of DS neuropathology. However, the mechanisms involved in DS spine alterations are not known. In addition to a relevant role in synapse formation and maintenance, astrocytes can regulate spine dynamics by releasing soluble factors or by physical contact with neurons. We have previously shown impaired mitochondrial function in DS astrocytes leading to metabolic alterations in protein processing and secretion. In this study, we investigated whether deficits in astrocyte function contribute to DS spine pathology.
Methodology/Principal Findings
Using a human astrocyte/rat hippocampal neuron coculture, we found that DS astrocytes are directly involved in the development of spine malformations and reduced synaptic density. We also show that thrombospondin 1 (TSP-1), an astrocyte-secreted protein, possesses a potent modulatory effect on spine number and morphology, and that both DS brains and DS astrocytes exhibit marked deficits in TSP-1 protein expression. Depletion of TSP-1 from normal astrocytes resulted in dramatic changes in spine morphology, while restoration of TSP-1 levels prevented DS astrocyte-mediated spine and synaptic alterations. Astrocyte cultures derived from TSP-1 KO mice exhibited similar deficits to support spine formation and structure than DS astrocytes.
Conclusions/Significance
These results indicate that human astrocytes promote spine and synapse formation, identify astrocyte dysfunction as a significant factor of spine and synaptic pathology in the DS brain, and provide a mechanistic rationale for the exploration of TSP-1-based therapies to treat spine and synaptic pathology in DS and other neurological conditions.
Down's syndrome (DS) or the triplication of chromosome 21 (trisomy 21) is the most common genetic cause of mental retardation. The cognitive deficits in patients with DS have been associated with structural changes in the architecture and alterations in the number of dendritic spines [1]. Morphological abnormalities such as unusually long spines, shorter spines, and reduced number of spines have been documented in the cortex of DS fetuses and newborns [2], [3]. Similar alterations were observed in the hippocampal formation, and additional reductions in spine number in adult DS patients have been linked to the development of Alzheimer's disease (AD) pathology [4], [5]. Spine pathology is also present in the Ts65Dn mouse model of DS, which shows decreased spine and synaptic density, and aberrant spine morphology including enlarged spines, irregular spine heads, and globular spine shapes [6][8]. Since dendritic spines are the primary sites of excitatory synapses, defects in spine structure and function can result in synaptic and circuit alterations leading to cognitive impairment and the progression of AD pathology in DS patients [9]. Unfortunately, there is little information available on the cellular and molecular mechanisms involved in DS spine malformation.
In recent years, a number of studies indicate that astrocytes regulate the stability, dynamics and maturation of dendritic spines [10][13]. In addition, astrocytes participate in the regulation of synaptic plasticity and synaptic transmission [14][18]. Astrocytes modulate the establishment and maintenance of synaptic contacts through the release of soluble factors such as cholesterol [19] or thrombospondins [20], or by direct physical interaction with neuronal cells [10][13], [21]. Our previous research indicates the presence of mitochondrial dysfunction and energy deficits in DS astrocytes leading to abnormal amyloid precursor protein (APP) processing and secretion, and to intracellular accumulation of amyloid β (Aβ) [22]. To investigate the role of astrocytes in DS spine pathology, we established a coculture system in which rat hippocampal neurons were plated on top of normal (NL) or DS astrocyte monolayers. Using this experimental paradigm, we found abnormal spine development and reduced synaptic density and activity in neurons growing on top of DS astrocytes, and identified thrombospondin 1 (TSP-1) as a critical astrocyte-secreted factor that modulates spine number and morphology. TSP-1 levels were markedly reduced in DS astrocytes and brain homogenates, and restoration of TSP-1 levels prevented spine and synaptic alterations. These results underscore the potential therapeutic use of TSP-1 to treat spine and synaptic pathology in DS and other neurodevelopmental or neurodegenerative conditions.
Rat hippocampal neurons growing on top of human astrocytes develop extensive processes and dendritic spines
Previous reports have established the critical role of astrocytes in synapse formation [16], [17], [19][21] and regulation of dendritic spines [10][13]. However the role of astrocytes in DS spine pathology has not been investigated. Our previous results indicate the presence of mitochondrial dysfunction in DS astrocytes leading to alterations in protein secretion and intracellular Aβ accumulation [22]. To establish whether deficits in DS astrocyte function could be involved in spine pathology, rat hippocampal neurons were cultured on top of NL or DS astrocyte monolayers (Figure 1A). Under these conditions, rat hippocampal neurons survived well for extended periods of time and developed fast-growing axons and dendrites (Figure 1A). No differences in neuronal survival were observed between regular rat hippocampal cultures and rat hippocampal/human astrocyte cocultures (Figure S1). After 21 DIV, neurons developed numerous spines (Figure 1B) exhibiting characteristic shapes including stubby-, mushroom-, thin- and filopodium-like spines [23]. Stubby spines were especially abundant (Figure 1B). In contrast, human cortical neurons exhibited poor spine development in culture (data not shown), precluding their use for this study. Thus, to assess the capacity of DS astrocytes to sustain spine and synapse formation we utilized human cortical astrocyte/rat hippocampal neuron cocultures.
Figure 1
Figure 1
Human astrocyte/rat hippocampal neuron cocultures.
Altered spine number and morphology in hippocampal neurons growing on top of DS astrocytes
We used immunofluorescence to analyze spine formation in the cocultures at 21 DIV. For simplicity, we assessed both stubby- and mushroom-like spines as “stubby”, and both thin- and filopodium-like spines as “filopodium” spines. We found a significant reduction in the total number of spines in neurons growing on top of DS astrocytes compared to neurons growing on top of NL astrocytes (NL: 9.1±0.5 per 50 µm of dendrite; DS: 7.1±0.6 per 50 µm of dendrite)(Figure 2A and B), indicating that DS astrocytes are less efficient than normal astrocytes in supporting dendritic spine formation. The reduction in spine density affected specifically stubby spines (NL: 4.6±0.5 stubby spines per 50 µm dendrite; DS: 2.1±0.3 stubby spines per 50 µm dendrite) (Figure 2C). Conversely, in DS astrocyte/hippocampal neuron cocultures we observed a significant increase in the number and length of filopodium spines (Figure 2A, D and E), which previous studies have characterized as immature spines in hippocampal neurons [24]. Similar alterations in spine number and structure are present in DS brains [2], [3], [25], suggesting that astrocyte dysfunction contributes to spine pathology in DS.
Figure 2
Figure 2
Spine number and morphology are altered in hippocampal neurons grown on top of DS astrocytes.
Soluble factors released by astrocytes such as cholesterol or thrombospondins have been shown to modulate spine formation and the establishment and maintenance of synaptic contacts [19], [20]. We assessed the effect of astrocyte-released factors on spine formation. Pure hippocampal cultures grown on polylysine and maintained with astrocyte conditioned medium (CM) exhibited somewhat lower spine density than their counterparts grown on top of astrocyte monolayers, indicating that physical contact with astrocytes is also relevant for spine formation (Figure 2B). Hippocampal neurons maintained in DS astrocyte CM showed a marked reduction in the number of spines compared to neurons maintained in NL astrocyte CM (NL CM: 6.2±0.5 spines per 50 µm of dendrite; DS CM: 3.6±0.3 spines per 50 µm of dendrite)(Figure 2B). Thus, soluble factors are critically involved in DS astrocyte-mediated spine alterations.
Reduced TSP-1 levels in DS astrocytes and DS brains
TSP-1 is an extracellular matrix protein synthesized and released by astrocytes [26], which is highly expressed during development of the nervous system [27]. It promotes neurite outgrowth and survival [28][30], neuronal migration [31], [32] and synaptogenesis [20]. Recently, it has been demonstrated that TSP-1 is necessary for synaptic and motor recovery after stroke [33], suggesting that TSP-1 also participates in neuronal plasticity. Given that TSP-1 is one of the most abundant proteins secreted by human astrocytes (data not shown), and that there are marked deficits in protein secretion in DS astrocytes [22], we next analyzed TSP-1 expression and secretion in DS astrocyte cultures and brain homogenates. We found high TSP-1 expression in human astrocytes and prominent surface localization (Figure 3A-D). TSP-1 subcellular localization and staining pattern was similar in normal and DS astrocytes. Quantification of TSP-1 protein levels by ELISA demonstrated significant reductions in both DS astrocyte cell lysates and CM (Figure 3E), suggesting that reduced TSP-1 expression leads to decreased TSP-1 in DS CM. TSP-1 expression was considerably higher in fetal than in adult brain homogenates (data not shown), consistent with a significant role of TSP-1 during development [27]. A comparison of TSP-1 protein expression in fetal brain lysates showed an average reduction of 57.9% in TSP-1 levels in DS brains despite the average age of DS brain samples being almost 4 weeks younger than the average age of NL brain samples (Figure 3F). qPCR analysis of mRNA expression indicated similar mRNA levels in DS brains than in NL brains for all thrombospondin isoforms (TSP-1, -2, -3 and -4)(Figure S2), suggesting that a post transcriptional mechanism underlies the changes observed in TSP-1 in DS brains and astrocyte cultures.
Figure 3
Figure 3
Reduced TSP-1 levels in DS astrocytes and DS fetal brain tissue.
TSP-1 regulates spine morphology and prevents spine alterations in neurons grown on top of DS astrocytes
We assessed the effect of TSP-1 on spine development in pure hippocampal cultures. Recombinant TSP-1 was added to the culture medium at day 7, and fresh TSP-1 was replenished every 3 days for 14 days. We used a TSP-1 dose of 250 ng/ml because it is in the range of the difference in the level of TSP-1 in CM between NL and DS astrocyte cultures (Figure 3E). TSP-1 increased significantly the number of spines compared to vehicle-treated cultures (control: 6.5±0.7 spines per 50 µm dendrite; TSP-1: 9.0±0.7 spines per 50 µm dendrite)(Figure 4A and B). The effect of TSP-1 on spine number was similar to the effect of BDNF, a well known inducer of spine development in hippocampal neurons [34], [35]. Combined treatment of BDNF+TSP-1 had an additive effect on spine development, suggesting that the two factors act through non-overlapping, complementary signaling pathways (Figure 4A and B). A dose-response assay indicated that concentrations of TSP-1 between 250 ng/ml to 1250 ng/ml produced a gradual and marked increase in the number of dendritic spines in pure neuronal cultures (Figure 4C). Thus, TSP-1 is a strong promoter of spine development.
Figure 4
Figure 4
TSP-1 modulates spine development.
To determine whether depletion of TSP-1 is sufficient to alter spine number and morphology, NL astrocyte/hippocampal neuron cocultures were treated with anti-TSP-1 antibody to neutralize the endogenous TSP-1 secreted by NL human astrocytes. At day 7, anti-TSP-1 was added to the cultures and replenished every 3 days during 14 days. Hippocampal neurons treated with anti-TSP-1 exhibited dramatic changes in spine morphology, including a marked reduction in the density of stubby spines, and a major increase in the frequency and length of filopodium spines (Figure 5 and Figure S3). Anti-TSP-1 previously neutralized with excess TSP-1 and non-immune IgG had no effect on spine morphology (data not shown). Conversely, addition of recombinant TSP-1 to hippocampal neurons growing on top of DS astrocytes exhibited a significant reduction of filopodium spines (Figure 6A), and a marked increase in the number of stubby spines (Figure 6B). A similar effect on spines, although of slightly smaller magnitude, was observed after the addition of BDNF to the cocultures (data not shown). Heat-inactivated TSP-1 did not have any effect on spine morphology or number (Figure 6A and B). These results demonstrate that soluble TSP-1 modulates spine morphology and that reduced expression of TSP-1 in DS astrocytes leads to abnormal spine development.
Figure 5
Figure 5
Depletion of TSP-1 markedly alters spine morphology.
Figure 6
Figure 6
TSP-1 prevents spine alterations in neurons grown on top of DS astrocytes.
Altered spine morphology in neurons growing on top of TSP-1 KO astrocytes
To directly address the role of TSP-1 on the regulation of spine formation, rat hippocampal neurons were grown on top of astrocyte monolayers derived from wild type (WT) or TSP-1 KO mice [36]. There were no significant differences in general morphology, viability, between both cocultures (Figure 7A). However, neurons growing on top of TSP-1 KO astrocytes exhibited a striking increase in the number of filopodium spines and a marked reduction in the number of stubby spines (Figure 7B and C). Treatment of TSP-1 KO cocultures with recombinant TSP-1 for 4 days reduced significantly the number of filopodium spines and increased the number of stubby to similar levels than WT cocultures (Figure 7C). The effect of TSP-1 was more pronounced after 7 days of treatment (Figure 7C). The spine phenotype in TSP-1 KO cocultures is reminiscent to the alterations observed in DS cocultures, providing direct evidence for a role of TSP-1 on spine formation.
Figure 7
Figure 7
Altered spine morphology in neurons growing on top of TSP-1 KO astrocytes.
Synaptic density and the number of functional synapses are reduced in neurons grown on top of DS astrocytes
We investigated the effect of spine alterations and TSP-1 deficits on synapse formation and activity in DS cocultures. Synaptic density was assessed as the frequency of colocalization of the pre- and post-synaptic markers synaptophysin and PSD95 at 21 DIV [37][39]. Consistent with the alterations in spine morphology and density, we found a significant reduction in the number of synaptic contacts (NL: 12.1±1.1 synaptophysin/PSD95 colocalized puncta per 50 µm of dendrite; DS: 5.0±0.5% synaptophysin/PSD95 colocalized puncta per 50 µm of dendrite)(Figure 8A and B). To determine the number of synapses specifically localized in spines (Figure 8C), we measured the frequency of colocalization of synaptophysin, PSD95 and drebrin, (Figure 8D and Figure S4). Of the total number of synapses in the culture, represented by synaptophysin/PSD95 colocalization (Figure 8A and B), more than 50% were localized at dendritic spines, represented by synaptophysin/PSD95/drebrin colocalization (Figure 8C and D), indicating that spines are principal sites of synaptic formation in the cocultures. The number of synapses localized at spines was also markedly reduced in DS cocultures (Figure 7D). To study the presence of functional synapses, we assessed vesicular uptake using the fluorescent cationic styryl fixable dye AM4-64. Depolarization induced by 20 mM KCl causes rapid vesicular uptake of A4-64, allowing the visualization of recycled vesicles [37], which in this case was used as an indicator of active synapses. Depolarization induced massive vesicle recycling in both NL and DS cocultures, indicating the presence of a high number of functional synapses in the cocultures (Figure 8E). However, there was a significantly lower density of A4-64-positive vesicles in DS cocultures after stimulation with KCl (Figure 8F). These findings demonstrate that the total number of synapses, the number of synapses at spines, and the number of active synapses are all reduced in DS cocultures.
Figure 8
Figure 8
Reduced synaptic density in hippocampal neurons grown on top of DS astrocytes can be reversed by treatment with TSP-1.
TSP-1 increases synaptic density and activity in neurons grown on top of DS astrocytes
The ability of TSP-1 to modulate spine formation (Figure 4), to rescue spine defects associated with DS and TSP-1 KO cocultures (Figure 6 and and7),7), and its capacity to stimulate synaptogenesis [20], prompted us to examine the effect of TSP-1 treatment on synapse formation in neurons growing on top of DS astrocytes. Addition of 250 ng/ml TSP-1 resulted in a major increase in both total synaptic density (Figure 8B) and in the number of synapses localized at spines (Figure 8D). Restoration of TSP-1 levels also increased synaptic activity in DS cocultures as measured by A4-64 uptake (Figure 8E and F).
Antioxidants and mitochondrial cofactors have no effect on TSP-1 expression and secretory deficits in DS astrocytes
Protein synthesis and secretory function are highly dependent on mitochondrial energy production and are particularly vulnerable to the effects of intracellular oxidative damage. For example, APP secretory deficits in DS astrocytes are directly linked to impaired mitochondrial metabolism and abnormal secretory function [22], and increased apoptosis of DS neurons can be prevented by antioxidants [40]. To establish whether reduced expression of TSP-1 in DS astrocytes was associated with oxidative stress and/or energy deficits in DS cells, we analyzed the effect of free radical scavengers, antioxidants, and energy substrates on TSP-1 expression. DS astrocytes were treated with sPBN (100 µM), trolox (100 µM), resveratrol (100 µM), nicotinamide (15 mM), nicotinamide adenine dinucleotide (β–NAD, 15 mM), creatine (5 mM) or glucose (5 mM), and TSP-1 levels were quantified 24 hr later. None of the compounds tested were able to modify TSP-1 levels inside the cells or in the CM, suggesting that neither mitochondrial dysfunction nor oxidative stress are primary factors mediating TSP-1 deficits in DS astrocytes (Figure S5).
Dendritic spine abnormalities have long been recognized as structural correlates of mental retardation in DS [1], [9], [41]. However, the origin and mechanisms involved in DS spine alterations are not known. Here, we show that: 1) DS astrocytes play a significant role in spine pathology and reduced synaptic density; 2) both DS brains and DS astrocytes show deficits in TSP-1 levels and secretion; 3) TSP-1 modulates dendritic spine development and morphology; and 4) TSP-1 addition reverts DS astrocyte-mediated spine and synaptic alterations.
Astrocytes are important modulators of neuronal development, metabolism, and synaptic activity [15], [18], [42], [43]. Astrocyte alterations have been linked to diverse neurological conditions such as epilepsy [44][46], AD [47], [48], ischemic injury [49], amyotrophic lateral sclerosis [50], [51], and neurodevelopmental disorders such as Rett's syndrome [52], [53] and fragile X syndrome [54]. However, the role of astrocytes in DS has received less attention. Astrocytes from DS fetal brain tissue and DS mouse models show increased concentration of intracellular calcium [55], [56], altered sensitivity to oxidative stress [57], deficits in mitochondrial energy metabolism [22], [58] and abnormal APP transport and secretion [22]. In addition, there is increased S100 and interleukin-1 expression in astrocytes in DS brain cortex [59], [60]. Together, these results indicate the presence of metabolic alterations in DS astrocytes that can directly affect neuronal survival and development. Supporting this notion, Nelson and colleagues demonstrated that NL neurons co-cultured with TS16 mouse astrocytes exhibit reduced cholinergic function, while TS16 neurons co-cultured with WT mouse astrocytes display normal cholinergic activity [61]. Our data indicate that neurons growing on top of DS astrocytes exhibit abnormal changes in spine morphology and density, and a marked reduction in synaptic density. Hippocampal neurons cocultured on top of DS astrocytes display a high number and longer filopodium spines, and a significant reduction in the number of stubby spines (Figure 2), reminiscent of the spine pathology described in DS infant brains [2], [3], [62]. Filopodium spines are expressed early during hippocampal [63][65] and cortical development [66], [67]. Although the function of filopodium spines is unclear, some studies suggest that they are associated with early stages of synaptic formation including spinogenesis, synaptogenesis and regulation of dendritic braching [24], [64], [68]. At maturity, filopodia disappear in many neurons and are replaced by stubby spines [69], [70]. Astrocytes control the maturation and dynamics of dendritic spines by physical contact with neurons [10][13], and can influence synapse formation through secreted factors such as cholesterol [19], thrombospondins [20] and TNF-α [71]. Thus, functional or metabolic alterations in DS astrocytes may affect normal spine development and plasticity, ultimately leading to abnormal synapse and circuit formation.
Secretory function is integral for astrocytes neuromodulatory role. Astrocytes secrete growth factors, extracellular matrix proteins, proteases, modulators of protease activity, etc [72][74], which regulate neuronal development and survival [75], neuritogenesis [76] and synaptogenesis [19], [20], [77]. Human astrocytes synthesize and secrete TSP-1, an extracellular matrix component involved in cell-cell and cell-matrix communication [26], [78], which is widely expressed in the developing nervous system [27]. In vitro, human astrocytes expressed high levels of TPS-1, which was detected intracellularly and at the cell surface (Figure 3A-D). TSP-1 levels were reduced in both DS astrocyte homogenates and CM, as well as in DS fetal brains, raising the possibility that in DS, TSP-1 deficits could affect critical stages of neuronal development such as neurite outgrowth [28][30], [79], neuronal migration [32], or synaptogenesis [20], [80]. Indeed, reduced TSP-1 activity in cocultures of NL astrocytes is sufficient to dramatically alter spine morphology (Figure 5) and synapse formation (data not shown) in hippocampal neurons. Moreover, neurons growing on top of TSP-1 KO astrocytes developed abnormal spines reminiscent to the spines in DS astrocyte cocultures. Conversely, addition of TSP-1 prevented the alterations in spine morphology and the reductions in both synaptic density and activity in neurons growing on top of DS and TSP-1 KO astrocytes. Interestingly, thrombospondin-deficient mice exhibit deficits in recovery of motor function after stroke [33], and reduced proliferation and differentiation of neuronal progenitors [81]. Thrombospondins are expressed in forebrain of human but not nonhuman primates [82], further suggesting a role for thrombospondins in synaptic plasticity and human cognition. Lastly, the loss of thrombospondins also leads to craniofacial dysmorphism [83], which is a common feature of DS subjects and DS mouse models [84], [85], raising the possibility that reduced TSP-1 levels may be associated with a number of developmental anomalies present in DS.
The stimulatory effect of TSP-1 on spine formation was of similar magnitude to that of BDNF (Figure 4), pointing to a role for TSP-1 not only in synaptogenesis [20], [80], but also in spine formation. Together, TSP-1 and BDNF potentiated their effect, suggesting the presence of non-redundant, complementary pathways for TSP-1 and BDNF action on spines. In this respect, thrombospondins have been shown to act at multiple levels in different signaling pathways [86]. TSP-1 can bind and activate integrin receptors to mediate neurite outgrowth [28], and some studies suggest that TSP-1 can reorganize the actin cytoskeleton through stimulation of phosphoinositide 3-kinase (PI3-K) [87]. TSP-1 can also induce changes in cell morphology through activation of the Src family of kinases, ERK 1/2 or Rac-1 [88]. In addition, many effects of TSP-1 as inhibitor of angiogenesis and tumor growth are mediated by nitric oxide [89], p38 MAPK [90], PI3-K, FAK [91] and the CD36 receptor [92]. Recent studies show that TSP-1 can interact with the α2δ-1 gabapentin receptor [93], and with neuroligin 1 during synaptogenesis [80]. Ongoing experiments are directed to establish which signaling pathway(s) engaged by TSP-1 mediates spine formation and morphology.
Mitochondrial dysfunction and oxidative stress are major factors contributing to DS altered cellular function and survival [22], [40], [94]-[96]. In DS astrocytes, energy depletion leads to abnormal APP metabolism and altered APP secretion, both of which can be prevented by treatment with antioxidants [22]. However, antioxidants or mitochondrial cofactors did not revert TSP-1 deficits in DS astrocytes (Figure S5). One possibility is that mechanism(s) regulating TSP-1 expression such as activation of purinergic receptors [97], muscarinic receptors [74], or nitric oxide-mediated signaling [89], [98] could be altered in DS astrocytes. Alternatively, TSP-1 reduced levels in DS may be linked to the capacity of gamma interferon (IFN-γ) to inhibit both the production and secretion of thrombospondins without changing mRNA levels [99]. IFN-γ levels are elevated in both DS [100], [101] and trisomy 16 mice [102], [103]. DS individuals are hypersensitive to IFN-γ [104][107] and exhibit pronounced dysregulation in the levels of IFN-γ and other cytokines [108], [109]. These actions of INF-γ in DS are likely to be related to the presence of several IFN receptor genes in chromosome 21 including IFNGR2, which is one of the subunits of the IFN-γ receptor [110]. Thus, upregulated IFN-γ signaling in DS astrocytes may lead to a downregulation of TSP-1 protein levels. Furthermore, interferons also inhibit protein glycosylation [111], which is required for TSP-1 secretion. Experiments in progress are directed to understand the role of IFN-γ signaling in the post-transcriptional regulation of TSP-1 in DS.
In summary, we found metabolic alterations in DS astrocytes that cause spine pathology and reduced synaptic density in cocultured neurons. Spine and synaptic alterations were associated with reduced expression of TSP-1, which was also significantly reduced in DS brains. Finally, the identification of a novel role for TSP-1 as a strong modulator of dendritic spine development and morphology supports the exploration of TSP-1 and downstream signaling partners as therapeutic targets to treat spine pathology and cognitive impairment in DS and other neurological conditions.
Ethics Statement
This study is part of an ongoing research protocol approved by the Health and Hospital Corporation of the City of New York, the Albert Einstein College of Medicine Committee on Clinical Investigation and the Internal Review Board of the University of California-Irvine. The protocols for obtaining post-mortem fetal brain tissue comply with all federal and institutional guidelines with special respect for the confidentiality of the donor's identity. Written informed consent was obtained from all tissue donors.
All procedures for the generation of rat hippocampal neuronal suspensions were reviewed and approved by the Institutional Care and Use Committee (IACUC) at the University of California Irvine, protocol number 2008-2779.
Cell Culture
Astrocyte cultures were established from postmortem NL and DS human fetal brain tissue samples as described [22]. Normal and DS fetal human brain samples are procured at the Human Fetal Tissue Repository, Albert Einstein School of Medicine (AECOM), NY, and received and processed in the Busciglio laboratory at UCI. Cortical tissue samples were dissociated into a single-cell suspension by incubation with 0.25% trypsin/40 µg/ml DNAse (Sigma, St Louis, MO) in PBS at 37°C for 30 min, and mechanically dissociated with a fire-polished glass Pasteur pipette. Cells were plated on the bottom of tissue culture dishes or on glass coverslips, and maintained in DMEM (Invitrogen, Grand Island, NY) supplemented with 10% fetal bovine serum (HyClone, Road Logan, UT). After growing to confluence, cells were subjected to two passages to generate pure astrocytic cultures. The identity and purity of the astrocyte cultures was confirmed by immunocytochemistry with anti-GFAP and anti-S100 antibodies. To generate the cocultures, hippocampi were dissected from rat newborn pups, incubated with trypsin, and triturated through a glass Pasteur pipette as described by Kaech and Banker [112]. The neurons were plated on top of NL or DS astrocyte monolayers at 100,000 cells/mm2. Two hr after neuronal plating, the medium was changed to Neurobasal plus N2 and B27 supplements (Invitrogen, Grand Island, NY). Partial medium changes were performed every 5 days. Cultures were maintained for 21 days to allow for the development and maturation of dendritic spines. Under these conditions, there is minimal growth of rat astrocytes in the coculture (Figure S6). Pure hippocampal cultures were maintained in NL or DS astrocyte conditioned medium (CM) obtained from astrocyte cultures. For pure hippocampal cultures, the neurons were plated on coverslips pretreated with 1 mg/ml poly-L-lysine immediately after dissociation (Sigma, St Louis, MO). Two hr after plating, the medium was switched to NL or DS CM. Partial medium changes with fresh CM were performed every 3 days. For some experiments, astrocyte monloayers were generated from the cortex of WT and TSP-1 KO [36] newborn pups following the procedures described above.
Immunofluorescence and image analysis
Cultures were fixed with 4% paraformaldehyde/0.12 M sucrose/PBS for 15 min at 37°C, permeabilized 15 min with 0.2% Triton X-100/PBS, and blocked for 30 min in 5% bovine serum albumin/PBS. Then, the cultures were incubated with one or more of the following primary antibodies: mouse anti-drebrin, a marker of dendritic spines (1[ratio]250, Stressegen, Ann Arbor, MI), GFAP (1[ratio]1000, Sigma, St Louis, MO), anti-β-tubulin isotype III (1[ratio]1000, Sigma, St Louis, MO), mouse anti-thrombospondin-1 (1[ratio]250 Calbiochem, La Jolla, CA), anti-synaptophysin (1[ratio]250, Calbiochem, Gibbstown, NJ), anti-PSD95 (1[ratio]250, Abcam, Cambridge, MA), and anti S-100β (1[ratio]500, R&D systems, Minneapolis, MN), for 1 hr at RT, followed by a 30 min incubation in fluorescent-conjugated secondary antibody (1[ratio]500, Alexa 350, Alexa 488 and Alexa 594, Invitrogen, Eugene, OR). An Axiovert 200 inverted microscope (Zeiss, Jena, Germany) was used for examination, imaging and quantification of various parameters of spine morphology. Images were captured with a digital camera and processed using AxioVision software (Zeiss). When required, Z-stacks were captured at 500 nm intervals, processed and rendered using the Apotome imaging system (Zeiss). Spine-like protrusions were classified according to Hering and Sheng [23]. For spine assessment, dendritic spines were defined as protrusions from the surface of dendritic processes exhibiting a high concentration of drebrin [113], [114]. Morphologically, we identified 2 populations of spines: stubby-/mushroom-like spines, short, small and rounded spines with or without a short neck, and filopodium-like spines, which are typically longer, thin and lack a head. For quantification, 10 neurons per culture were selected from 3–6 separate cultures. Density and morphology of spines were scored in dendritic segments approximately 50 µm away from the cell body. Spine length was measured using the measurement tool of AxioVision. Spine length was defined as the distance from the base of the neck to the tip of the spine. To assess synaptic density, the colocalization of pre- and post-synaptic markers was performed as described [37][39].
TSP-1 measurements
TSP-1 levels were determined in astrocyte cultures and fetal brain homogenates. Astrocytes were plated in 24-well plates. Cultures were washed in ice-cold PBS and collected in Eppendorf tubes in 0.1 M NaOH. The lysates were centrifuged at 14,000 rpm in an Eppendorf microcentrifuge for 30 min at 4°C, and the supernatants were used to determine the intracellular concentration of TSP-1. Aliquots of CM from the same cultures were processed to determine the level of secreted TSP-1. Samples of fetal cortex were homogenized in RIPA buffer plus protease inhibitors (Complete, Roche, Mannheim, Germany) with a Turrax homogenizer (Ika Works, Wilmington, NC), and centrifuged at 14,000 rpm for 30 min at 4°C. TSP-1 levels in the supernatant fraction were determined using a commercial ELISA kit following the vendor's instructions (R&D systems, Minneapolis, MN). For some experiments, the following compounds (purchased from Sigma, St Louis, MO) were added to pure astrocyte cultures, and TSP-1 levels were determined after 24 hr: s-PBN (100 mM), Trolox (100 µM), resveratrol (100 mM), nicotinamide (15 mM), nicotinamide adenine dinucleotide (β–NAD, 15 mM), creatine (5 mM) and glucose (5 mM).
TSP-1 treatments
Cocultures were plated in 24-well plates and human recombinant TSP-1 (R&D system Minneapolis, MN) was added every 3 days at the indicated concentrations. Control cultures were incubated with heat-inactivated TSP-1 (100°C for 5 min). Cocultures were fixed at 21 DIV and analysis of spines was performed as described above. For some experiments, pure hippocampal cultures were treated with TSP-1 (250 ng/ml), BDNF (10 ng/ml, PeproTech Inc, Rocky Hill, NJ) or with TSP-1+BDNF.
Depletion of TSP-1
Cocultures were plated in 24-well plates. Starting at day 7, anti-TSP-1 (1[ratio]1000 Calbiochem, Gibbstown, NJ) was added to the cultures, and fresh anti-TSP-1 was replenished with partial medium changes every 3 days. Control cultures were treated with anti-TSP-1 previously neutralized with an excess of recombinant human TSP-1 or with non-immune rabbit serum. Cocultures were fixed at 21 DIV to assess spine density and morphology.
Assessment of vesicle recycling
To assess activity-dependent vesicle recycling, the cultures were incubated with the fixable fluorescent probe AM4-64 (Biotium Inc, Hayward, CA) for 5 min with or without 20 mM KCl [37]. AM4-64 fluorescent density was quantified using Axiovision.
Statistical analysis
All experiments were repeated three to six times using cultures derived from different brain specimens. Each individual experiment was performed at least in in triplicate samples. Data were analyzed by one-way analysis of variance (ANOVA) followed by Fisher's test. Results were expressed as the mean ± SEM. Significance was assessed at p<0.05. All results shown correspond to individual representative experiments.
Figure S1
Similar viability in neurons growing on top of normal or DS astrocytes and pure rat hippocampal cultures. Hippocampi from rat newborn pups were processed as described (Kaech and Banker, 2006). Rat hippocampal cultures were plated on coverslips precoated with poly-L-lysine. To generate cocultures, the neurons were plated on top of NL or DS astrocyte monolayers. All cultures were fixed after 21 days. Cell viability was evaluated by direct examination of neuronal morphology by a blinded operator. Neurons were visualized after immunofluorescence with anti-beta tubulin class III. Nuclei were counterstained with Hoechst. Neurons with round or oval nuclei showing light blue fluorescence and intact neuronal morphology were considered viable. Cells exhibiting condensed or fragmented nuclei and/or disrupted neuronal processes were considered dead. Fluorescent images were captured at 630X final magnification. Five fields per coverslip from 3-6 independent experiments were randomly selected for scoring of live or dead neurons. Error bars indicate the mean ± SEM. *p<0.05.
(0.68 MB TIF)
Figure S2
Similar TSP-1, -2, -3 and -4 mRNA levels in normal and DS fetal brains. TSP-1, -2, -3 and -4 mRNA levels were quantified in four 18-23 week old DS fetal brains and five age-matched controls. Quantitative real-time PCR was performed with a LightCycler 480 Real-Time PCR System utilizing LightCycler 480 SYBR Green I Master from Roche Applied Biosciences. The expression levels were normalized using 3 housekeeping genes (HKGs), Glucose 6 Phospahate Dehydrogenase (G6DH), β-Actin (Actβ), and TATA binding protein (TBP). None of the housekeeping genes were found differentially expressed between control and DS fetal brains. The graph summarizes the fold differences of each thrombospondin isoform in DS brains compared to normal brains. Each sample was run in triplicates. The primer pairs for each gene from 5- to 3-primus end are as follows: TSP1: GCTGCACTGAGTGTCACTGTC and TCAGGAACTGTGGCATTGG; TSP2: GTGCAGGAGCGTCAGATGT, and GGGTTGGATAAACAGCCATC; TSP3: AATCTCCAGTATCGATGCAATG, and GTGGCCTCC TCC TCA CAC; TSP4: CTACCGCTGTTCCTACAGC, and GAGCCTTCATAAAATCGTACCC; G6DH: GAGCCAGATGCACTTCGTG and GGGCTTCTCCAGCTCAATC; Actβ: CAACCGCGAGAAGATGAC and GTCCATCACGATGCCAGT; TBP: TGAATCTTGGTTGTAAACTTGACC and CTCATGATTACCGCAGCAAA. The thermal cycle protocol consisted of an initial heat denaturation at 95°C for 5 min, followed by 45 cycles each of denaturation at 95°C for 10 sec, annealing at 60°C for 10 sec, and an extension at 72°C for 10 sec for all primer sets. The bars represent SD.
(0.76 MB TIF)
Figure S3
Increased number of filopodium spines after TSP-1 immunodepletion in neurons grown on top of normal astrocytes. The histogram shows the number of filopodium spines per 50 µm of dendrite in control cocultures and cocultures treated with anti-TSP-1 antibody. At day 7, anti-TSP-1 was added to the culture medium and replenished every 3 days during 14 days. The cultures were fixed at day 21, and the number and type of spines was quantified as described in the Methods section. Hippocampal neurons treated with anti-TSP-1 exhibited a significant increase in the frequency and length of filopodium spines. Data were analyzed by ANOVA followed by Fisher's test. Results are expressed as the mean ± SEM. *p<0.05. The experiment was repeated using 3 different cocultures in triplicate or cuadruplicate samples. The graph corresponds to an individual representative experiment.
(0.66 MB TIF)
Figure S4
Colocalization of synaptic and spine markers. Single channel images of triple immunofluorescence showing drebrin (spine marker), PSD95 (post-synaptic marker) and synapthophysin (pre-synaptic marker). The merged image is shown in Figure 7D.
(0.64 MB TIF)
Figure S5
Antioxidants and mitochondrial cofactors have no effect on TSP-1 expression and secretion in DS astrocytes. Astrocyte cultures were treated with the designated compounds as described in the Methods section. TSP-1 levels were quantified by ELISA in soluble fractions and cellular homogenates. Sodium 4-[(tert-butylimino) methyl]benzene-3-sulfonate N-oxide (s-PBN, 100 mM); trolox (100 µM); resveratrol (Resv, 100 mM); nicotinamide (Nico, 15 mM); nicotinamide adenine dinucleotide (NAD, 15 mM); creatine (cre, 5 mM); glucose (Gluco, 5 mM). Data were analyzed by ANOVA followed by Fisher's test. The results are expressed as the mean ± SEM. Values represent the mean from 6 independent experiments. *p<0.05 vs cocultures of NL astrocytes.
(3.26 MB TIF)
Figure S6
Quantification of rat astrocytes in rat hippocampal neuron/human astrocyte cocultures. Hippocampal cell suspensions were incubated for 1 hr with fluorescent microspheres (PS-Speck, Invitrogen, Carlsbad, CA), which are rapidly taken up by viable cells. The microspheres remain in the cytoplasm and do not affect cell function or survival. Then, hippocampal suspensions were plated on top of human astrocyte monolayers, cultured for 21 days, fixed, counterstained with Hoechst, and processed for image analysis. A) DIC and fluorescence image of a microscopic field in which fluorescent microspheres are apparent in one cell (arrow, putative rat astrocyte) and absent in the other three cells in the field (putative human astrocytes). Nuclei were stained with Hoechst. Scale bar: 10 µm. B) Total number of astrocytes in the culture was assessed by scoring astrocyte nuclei, which are easily distinguishable because of their size (3 to 5 times larger than neuronal nuclei). The number of rat astrocytes was assessed by counting astrocyte cells containing fluorescent microspheres in the cytoplasm. Rat astrocytes represented approximately 18% of the total number of astrocytes in the coculture. Data were analyzed by ANOVA followed by Fisher's test. *p<0.05.
(2.48 MB TIF)
Acknowledgments
We thank Michael Hanna for his expert assistance with tissue culture procedures.
Footnotes
Competing Interests: The authors have declared that no competing interests exist.
Funding: This work was supported by grants from The Larry L. Hillblom Foundation and the National Institutes of Health (grant no. HD38466, and Alzheimers Disease Research Center grant no. AG16573). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
1. Benavides-Piccione R, Ballesteros-Yanez I, de Lagran MM, Elston G, Estivill X, et al. On dendrites in Down syndrome and DS murine models: a spiny way to learn. Prog Neurobiol. 2004;74:111–126. [PubMed]
2. Marin-Padilla M. Structural abnormalities of the cerebral cortex in human chromosomal aberrations: a Golgi study. Brain Res. 1972;44:625–629. [PubMed]
3. Marin-Padilla M. Pyramidal cell abnormalities in the motor cortex of a child with Down's syndrome. A Golgi study. J Comp Neurol. 1976;167:63–81. [PubMed]
4. Ferrer I, Gullotta F. Down's syndrome and Alzheimer's disease: dendritic spine counts in the hippocampus. Acta Neuropathol. 1990;79:680–685. [PubMed]
5. Suetsugu M, Mehraein P. Spine distribution along the apical dendrites of the pyramidal neurons in Down's syndrome. A quantitative Golgi study. Acta Neuropathol. 1980;50:207–210. [PubMed]
6. Belichenko PV, Kleschevnikov AM, Salehi A, Epstein CJ, Mobley WC. Synaptic and cognitive abnormalities in mouse models of Down syndrome: exploring genotype-phenotype relationships. J Comp Neurol. 2007;504:329–345. [PubMed]
7. Belichenko PV, Masliah E, Kleschevnikov AM, Villar AJ, Epstein CJ, et al. Synaptic structural abnormalities in the Ts65Dn mouse model of Down Syndrome. J Comp Neurol. 2004;480:281–298. [PubMed]
8. Kurt MA, Kafa MI, Dierssen M, Davies DC. Deficits of neuronal density in CA1 and synaptic density in the dentate gyrus, CA3 and CA1, in a mouse model of Down syndrome. Brain Res. 2004;1022:101–109. [PubMed]
9. Dierssen M, Ramakers GJ. Dendritic pathology in mental retardation: from molecular genetics to neurobiology. Genes Brain Behav. 2006;5(Suppl 2):48–60. [PubMed]
10. Haber M, Zhou L, Murai KK. Cooperative astrocyte and dendritic spine dynamics at hippocampal excitatory synapses. Journal of Neuroscience. 2006;26:8881–8891. [PubMed]
11. Murai KK, Nguyen LN, Irie F, Yamaguchi Y, Pasquale EB. Control of hippocampal dendritic spine morphology through ephrin-A3/EphA4 signaling. Nature Neuroscience. 2003;6:153–160. [PubMed]
12. Nishida H, Okabe S. Direct astrocytic contacts regulate local maturation of dendritic spines. J Neurosci. 2007;27:331–340. [PubMed]
13. Ventura R, Harris KM. Three-dimensional relationships between hippocampal synapses and astrocytes. Journal of Neuroscience. 1999;19:6897–6906. [PubMed]
14. Halassa MM, Fellin T, Takano H, Dong JH, Haydon PG. Synaptic islands defined by the territory of a single astrocyte. J Neurosci. 2007;27:6473–6477. [PubMed]
15. Haydon PG. GLIA: listening and talking to the synapse. Nat Rev Neurosci. 2001;2:185–193. [PubMed]
16. Pfrieger FW, Barres BA. Synaptic efficacy enhanced by glial cells in vitro. Science. 1997;277:1684–1687. [PubMed]
17. Ullian EM, Sapperstein SK, Christopherson KS, Barres BA. Control of synapse number by glia. Science. 2001;291:657–661. [PubMed]
18. Volterra A, Meldolesi J. Astrocytes, from brain glue to communication elements: the revolution continues. Nat Rev Neurosci. 2005;6:626–640. [PubMed]
19. Mauch DH, Nagler K, Schumacher S, Goritz C, Muller EC, et al. CNS synaptogenesis promoted by glia-derived cholesterol. Science. 2001;294:1354–1357. [PubMed]
20. Christopherson KS, Ullian EM, Stokes CC, Mullowney CE, Hell JW, et al. Thrombospondins are astrocyte-secreted proteins that promote CNS synaptogenesis. Cell. 2005;120:421–433. [PubMed]
21. Hama H, Hara C, Yamaguchi K, Miyawaki A. PKC signaling mediates global enhancement of excitatory synaptogenesis in neurons triggered by local contact with astrocytes. Neuron. 2004;41:405–415. [PubMed]
22. Busciglio J, Pelsman A, Wong C, Pigino G, Yuan M, et al. Altered metabolism of the amyloid beta precursor protein is associated with mitochondrial dysfunction in Down's syndrome. Neuron. 2002;33:677–688. [PubMed]
23. Hering H, Sheng M. Dendritic spines: structure, dynamics and regulation. Nat Rev Neurosci. 2001;2:880–888. [PubMed]
24. Ziv NE, Smith SJ. Evidence for a role of dendritic filopodia in synaptogenesis and spine formation. Neuron. 1996;17:91–102. [PubMed]
25. Fiala JC, Spacek J, Harris KM. Dendritic spine pathology: cause or consequence of neurological disorders? Brain Res Brain Res Rev. 2002;39:29–54. [PubMed]
26. Asch AS, Leung LL, Shapiro J, Nachman RL. Human brain glial cells synthesize thrombospondin. Proc Natl Acad Sci U S A. 1986;83:2904–2908. [PubMed]
27. Adams JC, Tucker RP. The thrombospondin type 1 repeat (TSR) superfamily: diverse proteins with related roles in neuronal development. Dev Dyn. 2000;218:280–299. [PubMed]
28. DeFreitas MF, Yoshida CK, Frazier WA, Mendrick DL, Kypta RM, et al. Identification of integrin alpha 3 beta 1 as a neuronal thrombospondin receptor mediating neurite outgrowth. Neuron. 1995;15:333–343. [PubMed]
29. O'Shea KS, Liu LH, Dixit VM. Thrombospondin and a 140 kd fragment promote adhesion and neurite outgrowth from embryonic central and peripheral neurons and from PC12 cells. Neuron. 1991;7:231–237. [PubMed]
30. Yu K, Ge J, Summers JB, Li F, Liu X, et al. TSP-1 secreted by bone marrow stromal cells contributes to retinal ganglion cell neurite outgrowth and survival. PLoS One. 2008;3:e2470. [PMC free article] [PubMed]
31. Blake SM, Strasser V, Andrade N, Duit S, Hofbauer R, et al. Thrombospondin-1 binds to ApoER2 and VLDL receptor and functions in postnatal neuronal migration. EMBO J. 2008;27:3069–3080. [PubMed]
32. O'Shea KS, Rheinheimer JS, Dixit VM. Deposition and role of thrombospondin in the histogenesis of the cerebellar cortex. J Cell Biol. 1990;110:1275–1283. [PMC free article] [PubMed]
33. Liauw J, Hoang S, Choi M, Eroglu C, Sun GH, et al. Thrombospondins 1 and 2 are necessary for synaptic plasticity and functional recovery after stroke. J Cereb Blood Flow Metab. 2008;28:1722–1732. [PubMed]
34. Chapleau CA, Carlo ME, Larimore JL, Pozzo-Miller L. The actions of BDNF on dendritic spine density and morphology in organotypic slice cultures depend on the presence of serum in culture media. J Neurosci Methods. 2008;169:182–190. [PMC free article] [PubMed]
35. Gu J, Firestein BL, Zheng JQ. Microtubules in dendritic spine development. J Neurosci. 2008;28:12120–12124. [PMC free article] [PubMed]
36. Lawler J, Sunday M, Thibert V, Duquette M, George EL, et al. Thrombospondin-1 is required for normal murine pulmonary homeostasis and its absence causes pneumonia. J Clin Invest. 1998;101:982–992. [PMC free article] [PubMed]
37. Deshpande A, Kawai H, Metherate R, Glabe CG, Busciglio J. A role for synaptic zinc in activity-dependent Abeta oligomer formation and accumulation at excitatory synapses. J Neurosci. 2009;29:4004–4015. [PubMed]
38. Deshpande A, Mina E, Glabe C, Busciglio J. Different conformations of amyloid beta induce neurotoxicity by distinct mechanisms in human cortical neurons. J Neurosci. 2006;26:6011–6018. [PubMed]
39. Deshpande A, Win KM, Busciglio J. Tau isoform expression and regulation in human cortical neurons. FASEB J. 2008;22:2357–2367. [PubMed]
40. Busciglio J, Yankner BA. Apoptosis and increased generation of reactive oxygen species in Down's syndrome neurons in vitro. Nature. 1995;378:776–779. [PubMed]
41. Kaufmann WE, Moser HW. Dendritic anomalies in disorders associated with mental retardation. Cereb Cortex. 2000;10:981–991. [PubMed]
42. Lovatt D, Sonnewald U, Waagepetersen HS, Schousboe A, He W, et al. The transcriptome and metabolic gene signature of protoplasmic astrocytes in the adult murine cortex. J Neurosci. 2007;27:12255–12266. [PubMed]
43. Mori T, Buffo A, Gotz M. The novel roles of glial cells revisited: the contribution of radial glia and astrocytes to neurogenesis. Curr Top Dev Biol. 2005;69:67–99. [PubMed]
44. Oberheim NA, Tian GF, Han X, Peng W, Takano T, et al. Loss of astrocytic domain organization in the epileptic brain. J Neurosci. 2008;28:3264–3276. [PubMed]
45. Tian GF, Azmi H, Takano T, Xu Q, Peng W, et al. An astrocytic basis of epilepsy. Nat Med. 2005;11:973–981. [PMC free article] [PubMed]
46. Wetherington J, Serrano G, Dingledine R. Astrocytes in the epileptic brain. Neuron. 2008;58:168–178. [PubMed]
47. Nagele RG, D'Andrea MR, Lee H, Venkataraman V, Wang HY. Astrocytes accumulate A beta 42 and give rise to astrocytic amyloid plaques in Alzheimer disease brains. Brain Res. 2003;971:197–209. [PubMed]
48. Nagele RG, Wegiel J, Venkataraman V, Imaki H, Wang KC. Contribution of glial cells to the development of amyloid plaques in Alzheimer's disease. Neurobiol Aging. 2004;25:663–674. [PubMed]
49. Takano T, Oberheim N, Cotrina ML, Nedergaard M. Astrocytes and ischemic injury. Stroke. 2009;40:S8–12. [PMC free article] [PubMed]
50. Nagai M, Re DB, Nagata T, Chalazonitis A, Jessell TM, et al. Astrocytes expressing ALS-linked mutated SOD1 release factors selectively toxic to motor neurons. Nat Neurosci. 2007;10:615–622. [PubMed]
51. Yamanaka K, Chun SJ, Boillee S, Fujimori-Tonou N, Yamashita H, et al. Astrocytes as determinants of disease progression in inherited amyotrophic lateral sclerosis. Nature Neuroscience. 2008;11:251–253. [PMC free article] [PubMed]
52. Ballas N, Lioy DT, Grunseich C, Mandel G. Non-cell autonomous influence of MeCP2-deficient glia on neuronal dendritic morphology. Nat Neurosci. 2009;12:311–317. [PMC free article] [PubMed]
53. Maezawa I, Swanberg S, Harvey D, LaSalle JM, Jin LW. Rett syndrome astrocytes are abnormal and spread MeCP2 deficiency through gap junctions. J Neurosci. 2009;29:5051–5061. [PMC free article] [PubMed]
54. Jacobs S, Doering LC. Astrocytes prevent abnormal neuronal development in the fragile x mouse. J Neurosci. 30:4508–4514. [PubMed]
55. Bambrick LL, Golovina VA, Blaustein MP, Yarowsky PJ, Krueger BK. Abnormal calcium homeostasis in astrocytes from the trisomy 16 mouse. Glia. 1997;19:352–358. [PubMed]
56. Bambrick LL, Yarowsky PJ, Krueger BK. Altered astrocyte calcium homeostasis and proliferation in theTs65Dn mouse, a model of Down syndrome. J Neurosci Res. 2003;73:89–94. [PubMed]
57. Sebastia J, Cristofol R, Pertusa M, Vilchez D, Toran N, et al. Down's syndrome astrocytes have greater antioxidant capacity than euploid astrocytes. European Journal of Neuroscience. 2004;20:2355–2366. [PubMed]
58. Shukkur EA, Shimohata A, Akagi T, Yu W, Yamaguchi M, et al. Mitochondrial dysfunction and tau hyperphosphorylation in Ts1Cje, a mouse model for Down syndrome. Hum Mol Genet. 2006;15:2752–2762. [PubMed]
59. Griffin WS, Stanley LC, Ling C, White L, MacLeod V, et al. Brain interleukin 1 and S-100 immunoreactivity are elevated in Down syndrome and Alzheimer disease. Proc Natl Acad Sci U S A. 1989;86:7611–7615. [PubMed]
60. Jorgensen OS, Brooksbank BW, Balazs R. Neuronal plasticity and astrocytic reaction in Down syndrome and Alzheimer disease. J Neurol Sci. 1990;98:63–79. [PubMed]
61. Nelson PG, Fitzgerald S, Rapoport SI, Neale EA, Galdzicki Z, et al. Cerebral cortical astroglia from the trisomy 16 mouse, a model for down syndrome, produce neuronal cholinergic deficits in cell culture. Proc Natl Acad Sci U S A. 1997;94:12644–12648. [PubMed]
62. Takashima S, Iida K, Mito T, Arima M. Dendritic and histochemical development and ageing in patients with Down's syndrome. J Intellect Disabil Res. 1994;38(Pt 3):265–273. [PubMed]
63. Dailey ME, Smith SJ. The dynamics of dendritic structure in developing hippocampal slices. J Neurosci. 1996;16:2983–2994. [PubMed]
64. Fiala JC, Feinberg M, Popov V, Harris KM. Synaptogenesis via dendritic filopodia in developing hippocampal area CA1. J Neurosci. 1998;18:8900–8911. [PubMed]
65. Papa M, Bundman MC, Greenberger V, Segal M. Morphological analysis of dendritic spine development in primary cultures of hippocampal neurons. J Neurosci. 1995;15:1–11. [PubMed]
66. Holtmaat AJ, Trachtenberg JT, Wilbrecht L, Shepherd GM, Zhang X, et al. Transient and persistent dendritic spines in the neocortex in vivo. Neuron. 2005;45:279–291. [PubMed]
67. Zuo Y, Lin A, Chang P, Gan WB. Development of long-term dendritic spine stability in diverse regions of cerebral cortex. Neuron. 2005;46:181–189. [PubMed]
68. Marrs GS, Green SH, Dailey ME. Rapid formation and remodeling of postsynaptic densities in developing dendrites. Nat Neurosci. 2001;4:1006–1013. [PubMed]
69. Harris KM. Structure, development, and plasticity of dendritic spines. Curr Opin Neurobiol. 1999;9:343–348. [PubMed]
70. Wong WT, Wong RO. Rapid dendritic movements during synapse formation and rearrangement. Curr Opin Neurobiol. 2000;10:118–124. [PubMed]
71. Beattie EC, Stellwagen D, Morishita W, Bresnahan JC, Ha BK, et al. Control of synaptic strength by glial TNF alpha. Science. 2002;295:2282–2285. [PubMed]
72. Dowell JA, Johnson JA, Li L. Identification of astrocyte secreted proteins with a combination of shotgun proteomics and bioinformatics. J Proteome Res. 2009;8:4135–4143. [PMC free article] [PubMed]
73. Keene SD, Greco TM, Parastatidis I, Lee SH, Hughes EG, et al. Mass spectrometric and computational analysis of cytokine-induced alterations in the astrocyte secretome. Proteomics. 2009;9:768–782. [PMC free article] [PubMed]
74. Moore NH, Costa LG, Shaffer SA, Goodlett DR, Guizzetti M. Shotgun proteomics implicates extracellular matrix proteins and protease systems in neuronal development induced by astrocyte cholinergic stimulation. J Neurochem. 2009;108:891–908. [PMC free article] [PubMed]
75. Booth GE, Kinrade EF, Hidalgo A. Glia maintain follower neuron survival during Drosophila CNS development. Development. 2000;127:237–244. [PubMed]
76. Guizzetti M, Moore NH, Giordano G, Costa LG. Modulation of neuritogenesis by astrocyte muscarinic receptors. J Biol Chem. 2008;283:31884–31897. [PubMed]
77. Hughes EG, Elmariah SB, Balice-Gordon RJ. Astrocyte secreted proteins selectively increase hippocampal GABAergic axon length, branching, and synaptogenesis. Mol Cell Neurosci. 43:136–145. [PMC free article] [PubMed]
78. Chen H, Herndon ME, Lawler J. The cell biology of thrombospondin-1. Matrix Biol. 2000;19:597–614. [PubMed]
79. Osterhout DJ, Frazier WA, Higgins D. Thrombospondin promotes process outgrowth in neurons from the peripheral and central nervous systems. Dev Biol. 1992;150:256–265. [PubMed]
80. Xu JY, Xiao N, Xia J. Thrombospondin 1 accelerates synaptogenesis in hippocampal neurons through neuroligin 1. Nature Neuroscience. 2010;13:22–24. [PubMed]
81. Lu ZJ, Kipnis J. Thrombospondin 1-a key astrocyte-derived neurogenic factor. Faseb Journal. 2010;24:1925–1934. [PubMed]
82. Caceres M, Suwyn C, Maddox M, Thomas JW, Preuss TM. Increased cortical expression of two synaptogenic thrombospondins in human brain evolution. Cereb Cortex. 2007;17:2312–2321. [PubMed]
83. Nishiwaki T, Yamaguchi T, Zhao C, Amano H, Hankenson KD, et al. Reduced expression of thrombospondins and craniofacial dysmorphism in mice overexpressing Fra1. Journal of Bone and Mineral Research. 2006;21:596–604. [PubMed]
84. Olson LE, Richtsmeier JT, Leszl J, Reeves RH. A chromosome 21 critical region does not cause specific Down syndrome phenotypes. Science. 2004;306:687–690. [PubMed]
85. Richtsmeier JT, Baxter LL, Reeves RH. Parallels of craniofacial maldevelopment in Down syndrome and Ts65Dn mice. Dev Dyn. 2000;217:137–145. [PubMed]
86. Lawler J. The functions of thrombospondin-1 and-2. Curr Opin Cell Biol. 2000;12:634–640. [PubMed]
87. Greenwood JA, Pallero MA, Theibert AB, Murphy-Ullrich JE. Thrombospondin signaling of focal adhesion disassembly requires activation of phosphoinositide 3-kinase. J Biol Chem. 1998;273:1755–1763. [PubMed]
88. Giehl K, Graness A, Goppelt-Struebe M. The small GTPase Rac-1 is a regulator of mesangial cell morphology and thrombospondin-1 expression. Am J Physiol Renal Physiol. 2008;294:F407–413. [PubMed]
89. Isenberg JS, Martin-Manso G, Maxhimer JB, Roberts DD. Regulation of nitric oxide signalling by thrombospondin 1: implications for anti-angiogenic therapies. Nature Reviews Cancer. 2009;9:182–194. [PMC free article] [PubMed]
90. Jimenez B, Volpert OV, Crawford SE, Febbraio M, Silverstein RL, et al. Signals leading to apoptosis-dependent inhibition of neovascularization by thrombospondin-1. Nat Med. 2000;6:41–48. [PubMed]
91. Lymn JS, Rao SJ, Clunn GF, Gallagher KL, O'Neil C, et al. Phosphatidylinositol 3-kinase and focal adhesion kinase are early signals in the growth factor-like responses to thrombospondin-1 seen in human vascular smooth muscle. Arterioscler Thromb Vasc Biol. 1999;19:2133–2140. [PubMed]
92. Dawson DW, Pearce SF, Zhong R, Silverstein RL, Frazier WA, et al. CD36 mediates the In vitro inhibitory effects of thrombospondin-1 on endothelial cells. J Cell Biol. 1997;138:707–717. [PMC free article] [PubMed]
93. Eroglu C, Allen NJ, Susman MW, O'Rourke NA, Park CY, et al. Gabapentin receptor alpha2delta-1 is a neuronal thrombospondin receptor responsible for excitatory CNS synaptogenesis. Cell. 2009;139:380–392. [PMC free article] [PubMed]
94. Busciglio J, Andersen JK, Schipper HM, Gilad GM, McCarty R, et al. Stress, aging, and neurodegenerative disorders. Molecular mechanisms. Ann N Y Acad Sci. 1998;851:429–443. [PubMed]
95. Helguera P, Pelsman A, Pigino G, Wolvetang E, Head E, et al. ets-2 promotes the activation of a mitochondrial death pathway in Down's syndrome neurons. J Neurosci. 2005;25:2295–2303. [PubMed]
96. Pelsman A, Hoyo-Vadillo C, Gudasheva TA, Seredenin SB, Ostrovskaya RU, et al. GVS-111 prevents oxidative damage and apoptosis in normal and Down's syndrome human cortical neurons. Int J Dev Neurosci. 2003;21:117–124. [PubMed]
97. Tran MD, Neary JT. Purinergic signaling induces thrombospondin-1 expression in astrocytes. Proc Natl Acad Sci U S A. 2006;103:9321–9326. [PubMed]
98. Roberts DD, Isenberg JS, Ridnour LA, Wink DA. Nitric oxide and its gatekeeper thrombospondin-1 in tumor angiogenesis. Clin Cancer Res. 2007;13:795–798. [PubMed]
99. Nickoloff BJ, Riser BL, Mitra RS, Dixit VM, Varani J. Inhibitory effect of gamma interferon on cultured human keratinocyte thrombospondin production, distribution, and biologic activities. J Invest Dermatol. 1988;91:213–218. [PubMed]
100. Franciotta D, Verri A, Zardini E, Andreoni L, De Amici M, et al. Interferon-gamma- and interleukin-4-producing T cells in Down's syndrome. Neurosci Lett. 2006;395:67–70. [PubMed]
101. Guazzarotti L, Trabattoni D, Castelletti E, Boldrighini B, Piacentini L, et al. T lymphocyte maturation is impaired in healthy young individuals carrying trisomy 21 (Down syndrome). Am J Intellect Dev Disabil. 2009;114:100–109. [PubMed]
102. Hallam DM, Capps NL, Travelstead AL, Brewer GJ, Maroun LE. Evidence for an interferon-related inflammatory reaction in the trisomy 16 mouse brain leading to caspase-1-mediated neuronal apoptosis. J Neuroimmunol. 2000;110:66–75. [PubMed]
103. Hallam DM, Maroun LE. Anti-gamma interferon can prevent the premature death of trisomy 16 mouse cortical neurons in culture. Neurosci Lett. 1998;252:17–20. [PubMed]
104. Iwamoto T, Yamada A, Yuasa K, Fukumoto E, Nakamura T, et al. Influences of interferon-gamma on cell proliferation and interleukin-6 production in Down syndrome derived fibroblasts. Arch Oral Biol. 2009;54:963–969. [PubMed]
105. Tan YH. Chromosome 21 and the cell growth inhibitory effect of human interferon preparations. Nature. 1976;260:141–143. [PubMed]
106. Tan YH, Schneider EL, Tischfield J, Epstein CJ, Ruddle FH. Human chromosome 21 dosage: effect on the expression of the interferon induced antiviral state. Science. 1974;186:61–63. [PubMed]
107. Zihni L. Down's syndrome, interferon sensitivity and the development of leukaemia. Leuk Res. 1994;18:1–6. [PubMed]
108. Maroun LE. Interferon action and chromosome 21 trisomy (Down syndrome): 15 years later. J Theor Biol. 1996;181:41–46. [PubMed]
109. Murphy M, Friend DS, Pike-Nobile L, Epstein LB. Tumor necrosis factor-alpha and IFN-gamma expression in human thymus. Localization and overexpression in Down syndrome (trisomy 21). J Immunol. 1992;149:2506–2512. [PubMed]
110. Hattori M, Fujiyama A, Taylor TD, Watanabe H, Yada T, et al. The DNA sequence of human chromosome 21. Nature. 2000;405:311–319. [PubMed]
111. Maheshwari RK, Banerjee DK, Waechter CJ, Olden K, Friedman RM. Interferon treatment inhibits glycosylation of a viral protein. Nature. 1980;287:454–456. [PubMed]
112. Kaech S, Banker G. Culturing hippocampal neurons. Nat Protoc. 2006;1:2406–2415. [PubMed]
113. Hayashi K, Ishikawa R, Ye LH, He XL, Takata K, et al. Modulatory role of drebrin on the cytoskeleton within dendritic spines in the rat cerebral cortex. J Neurosci. 1996;16:7161–7170. [PubMed]
114. Kobayashi C, Aoki C, Kojima N, Yamazaki H, Shirao T. Drebrin a content correlates with spine head size in the adult mouse cerebral cortex. J Comp Neurol. 2007;503:618–626. [PMC free article] [PubMed]
Articles from PLoS ONE are provided here courtesy of
Public Library of Science