PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cell Stem Cell. Author manuscript; available in PMC 2010 November 24.
Published in final edited form as:
PMCID: PMC2991120
NIHMSID: NIHMS240191
Wnt signaling in the niche enforces hematopoietic stem cell quiescence and is necessary to preserve self-renewal in vivo
Heather E Fleming, Viktor Janzen, Cristina Lo Celso, Jun Guo, Kathleen M Leahy, Henry M Kronenberg, and David T Scadden
Wingless (Wnt) is a potent morphogen demonstrated in multiple cell lineages to promote the expansion and maintenance of stem and progenitor cell populations. Pharmacologic modification of Wnt signaling has been shown to increase hematopoietic stem cells (HSC). We explored the impact of Wnt signaling in vivo, specifically within the context of the HSC niche. Using an osteoblast-specific promoter to drive the expression of a pan-inhibitor of canonical Wnt signaling, Dickkopf1 (Dkk1), we noted changes in trabecular bone and in HSC. Wnt signaling was inhibited in HSC and the cells exhibited reduced p21Cip1 expression, increased cell cycling and a progressive decline in regenerative function after transplantation. This effect was microenvironment-determined, but irreversible if the cells were transferred to a normal host. Wnt pathway activation in the niche is required to preserve the reconstituting function of endogenous hematopoietic stem cells.
The regulation of hematopoietic stem cell function is a complex and balanced process that requires coordinated input from inherent HSC programs and moderating signals provided by the surrounding microenvironment. Together, these signals permit the maintenance of the stem cell pool for the life of the organism, while also allowing for sufficient steady-state and injury-responsive blood cell production. These somewhat dichotomous aspects of HSC function require mechanisms that both preserve a quiescent population of stem cells and also promote their activation, expansion, differentiation and circulation under appropriate conditions (Akala and Clarke, 2006; Scadden, 2006). The morphogen family of signaling molecules has been identified as a prominent player in the function of numerous stem cell types, including the hematopoietic lineage. The wingless (Wnt) pathway has been studied extensively in the context of hematopoiesis, and the combined impact of multiple family members binding to a range of receptors leads to activation of canonical and non-canonical signaling pathways (Nemeth and Bodine, 2007). Canonical signals are mediated by TCF/LEF transcription factor activity (Daniels and Weis, 2005), and are considered to be largely dependent on the accumulation of nuclear β- (and/or γ-) catenin (Nemeth and Bodine, 2007).Wnt signals have been implicated in mammalian hematopoiesis by studies not intended to assess normal physiology in which Wnt activation had a strong expansive effect on reconstituting HSCs and multipotent progenitors (Baba et al, 2006; Murdoch et al, 2003; Reya et al, 2003; Trowbridge et al, 2006). With enforced, persistent Wnt activation, however, engineered mice developed hematopoietic failure with impaired differentiation of HSC (Kirstetter et al, 2006; Scheller et al, 2006). In contrast, deletion of members of the Wnt / β-catenin cascade under homeostatic conditions had little to no effect on blood cell production by HSCs (Cobas et al, 2004; Jeannet et al, 2007; Koch et al, 2007), raising the question of what physiological role, if any, Wnt signaling has on this cell type. Some of the variation observed may reflect differing influences exerted by canonical versus non-canonical Wnt signals, particularly given a recent report indicating that Wnt5a can modulate canonical signals mediated by Wnt3a (Nemeth et al, 2007). Wnt signals are also regulated by a host of soluble inhibitors that may interact directly with Wnt ligands, such as the frizzled-related proteins (sFRP) or by preventing Wnt binding to its receptors (Kawano and Kypta, 2003). The Dickkopf (Dkk) family of Wnt inhibitors falls into this latter category, by binding the Wnt coreceptor LRP5/6 in combination with a Kremen receptor, and leading to internalization of the complex (Mao et al, 2001; Mao et al, 2002). In order to specifically examine the impact of Wnt activation in an in vivo microenvironment that has been shown to regulate HSC number and function, we utilized mice engineered to overexpress the Wnt inhibitor, Dkk1, under control of the osteoblast specific 2.3kb fraction of the collagen1α promoter. This promoter has been previously shown to direct transgene expression to osteoblastic cells, resulting in changes in the number and function of HSCs (Calvi et al, 2001; Calvi et al, 2003)
We noted very little overt phenotype in the hematopoietic compartment of the Dkk1 tg mice at steady-state, and confirmed that transgene expression did not extend to the primitive hematopoietic fraction itself. Clear alterations of bone morphology were observed, however, including a 20% decrease in trabecular bone (manuscript in preparation). Despite the absence of a steady-state hematopoetic phenotype, TCF/LEF activity was specifically reduced within the HSC-containing fraction of Dkk1 transgenic mice, and stem cell function was altered under specific conditions. For example, a highly significant defect in the maintenance of reconstitution potential of HSC was observed, either in settings of serial transplant, or following secondary transplantation of wildtype donor cells previously used to reconstitute Dkk1 tg hosts. In agreement with the functional data, HSC populations had a marked reduction of cells within the G0 fraction of the cell cycle, and displayed enhanced sensitivity to 5-fluorouracil treatment. Wnt signals therefore appear to participate in mediating HSC quiescence in vivo, a result that was largely unpredicted from previous studies, although recent analysis of Hmgb3 mutant mice also supports this conclusion (Nemeth et al., 2006). Our results highlight the importance of studying the impact of a signaling pathway over long-term experiments, and in a physiologic context when seeking to resolve the effects of manipulations on HSC function. In that context, Wnt signaling plays an unanticipated role in maintaining HSC quiescence, which may underlie its requirement in preserving the self-renewing capability of HSC.
Osteoblast expression of Dkk1 does not affect blood or marrow primitive hematopoietic cell populations at steady state
The Wnt inhibitor, Dkk1, has been shown to play an important role in bone formation during development (Niehrs, 2006), and is normally expressed by osteoblasts (Grotewold et al., 1999; MacDonald et al., 2004), hence may have regulatory roles as part of the endosteal HSC niche. To examine the impact of Wnt inhibition on hematopoietic stem cells localized to the periendosteal region, Dkk1 was overexpressed within osteoblastic lineage cells under the control of the truncated 2.3kb collagen 1α promoter (manuscript in preparation). Resulting Col1α2.3-Dkk1 transgenic (Dkk1 tg) mice were backcrossed for at least 5 generations to the C57Bl/6 background and examined for bone and blood phenotypic alterations. No significant differences in peripheral white or red blood cell counts were observed (figure S1a). Bone marrow (BM) and spleen cellularity were also unchanged when Dkk1 tg mice and their littermates were compared, although a slight but not significant trend towards reduced body weight and BM cellularity was apparent in transgenic mice (figure S1b and data not shown). In contrast, significant alterations in bone morphology were observed, as is reported elsewhere (manuscript in preparation, and (Li et al, 2006)) Of note, trabecular bone volume was reduced by approximately 20%, whereas cortical bone was unaffected in Dkk1 tg mice (data not shown). Trabecular bone has been shown by us and others to affect HSC number and function (Adams et al, 2007; Calvi et al, 2003; Jung et al, 2007; Zhang et al, 2003). A panel of antibodies using 7 different flurochromes was used for multiparametric analysis of primitive precursors within the BM of Dkk1 tg mice and their littermates, including populations of LT-HSC, ST-HSC, CMP, GMP, MEP and CLP (figure 1a,c). Subpopulations containing primitive HSCs were not significantly altered at steady-state (figure 1b). However, additional cell surface markers revealed a slight but significant increase in the population containing phenotypically-defined common lymphoid progenitors (figure 1d). The calculated absolute cell numbers based on these frequencies indicated a similar pattern of results (figure S2). Despite the elevation of early lymphoid progenitors in the BM of Dkk1 tg mice, no significant changes were observed in the relative proportion of early B lineage progenitor subsets in the BM (data not shown).
Figure 1
Figure 1
Seven color FACS analysis of primitive populations in wt and Dkk1-tg BM
Dkk1-tg HSCs exhibit impaired Wnt signaling in a non-cell autonomous manner
To confirm that the transgenic expression of Dkk1 leads to the inhibition of Wnt/βcatenin signaling in the Dkk1 tg mice, HSC-containing populations were isolated from Dkk1 transgenic mice that had been intercrossed with the Topgal reporter strain. In these Topgal mice (DasGupta and Fuchs, 1999), multiple TCF/LEF binding sites have been inserted to control the expression of the reporter gene, β-galactosidase. Reporter activity using this construct has been shown to correlate with canonical Wnt signaling. Of note, TCF/LEF transcription has recently been shown to proceed even with the combined loss of β-catenin and γ-catenin, suggesting that canonical Wnt signals can be transduced by alternate intermediates (Jeannet et al, 2007). Reporter activity was examined within the LK+S+ (Lineage-cKit+Sca1+), HSC-containing population, and the LK+S− population which is devoid of LT-HSC potential. When the Wnt reporter activity detected in each of these populations was compared, a dramatic reduction (>100 fold reduction) in β-catenin activation was observed in the HSC-containing LK+S+ population isolated from Dkk1 tg mice (figure 2a). A more modest reduction (<5 fold reduction) was observed in the less-actively signaling LK+S− fraction. This finding indicates that despite the unchanged frequency of phenotypically-defined HSC-containing populations in unmanipulated Dkk1 tg animals, there is evidence that these cells are molecularly altered by osteoblast expression of the Wnt inhibitor. These data provide evidence for direct inhibition of Wnt signaling in the HSC population in addition to any effects that might be mediated by decreased trabecular bone mass. Wnt signaling is regulated, in part, via a negative feedback loop by TCF/LEF-dependent transcription of endogenous Dkk1 (Niida et al, 2004). Consistent with the decrease in Topgal reporter activity, expression of endogenous Dkk1 was also inhibited in the LK+S+ population of Dkk1 tg mice (figure 2b). Using primers specific for the Dkk1 tg, and in comparison its expression in wt and Dkk1 tg tibea, sorted LK+S+ cells do not express the Dkk1 transgene (figure 2c). Together, these results confirm that Dkk1 tg mice inhibit Wnt signaling specifically within the HSC compartment in a non-cell autonomous manner.
Figure 2
Figure 2
Assessment of canonical Wnt signal activity in HSC-containing populations of Dkk1-tg mice
Functional impact of the Dkk1 transgene on BM reconstitution
Analysis of stem/progenitor activity cannot rely exclusively on the quantitation of precursors according to phenotypically-defined parameters. Using functional measures, we detected a consistent defect in multilineage and myeloid colony formation on a per cell basis in BM isolated from Dkk1 transgenic mice (figure 3a). This result was despite the absence of significant alteration of myeloid and more primitive progenitors by immunophenotype, possibly reflecting the elevated lymphoid fraction, whose progeny are not read out under these culture conditions. In vitro methods such as the CFU assay offer an entry-level analysis of hematopoietic activity, however functional reconstitution in vivo more accurately examines true HSC function (Purton and Scadden, 2007). Therefore, in order to better assess the functional capacity of HSCs isolated from the Dkk1 transgenic environment, BM was transplanted from wt or Dkk1 tg littermates with an equivalent dose of competing marrow from congenic donor mice into lethally irradiated recipients. Donor marrow was isolated from a single wt or transgenic mouse to assess any individual-to-individual variation. Following six months of engraftment, no significant changes in reconstitution were observed across the groups of recipients receiving BM isolated from individual wt or Dkk1 tg environments, although a range of reconstitution capacity was apparent in both groups (figure S3a). Using a limiting dilution assay to determine the frequency of repopulating cells present in BM isolated from individual Dkk1-expressing animals revealed a two-fold elevation in the number of functional reconstituting HSCs (Figure 3b). These transplant results indicate that cells isolated from the Dkk1-epressing niche are capable of reconstituting irradiated recipients, and appear to be present at a higher frequency when Wnt has been inhibited in this location. An important additional parameter to test when investigating HSC function is their longevity, or ability to respond to repeated rounds of expansion stress. To assay the longevity of HSCs isolated from Dkk1 tg mice, noncompetitive serial transplants were performed. As expected from the previous transplant experiments, Dkk1 tg BM was able to completely reconstitute wt irradiated recipients (data not shown). However, following two subsequent transplantations, each after a period of 14 weeks of reconstitution, Dkk1 tg-derived HSCs were unable to rescue irradiated hosts under the same conditions supported by littermate BM donors (figure 3c). Highly significant differences in the survival curves of the tertiary transplanted recipients are depicted, and were similar in an independent serial transplant experiment using multiple donors. Consistent with the decrease in survival after multiple transplants, a reduction in the frequency of phenotypic LT-HSCs was also detected in the BM of Dkk1 tg secondary hosts used as donors for tertiary transplants (figure 3d). Together, these results demonstrate that HSCs are functional following isolation from a Dkk1-expressing endosteal environment, but their long-term function is not maintained over sequential transplantations. A forced, repeated expansion requirement imposed on cells that have once been exposed to the Wnt-inhibited environment results in their early expiration.
Figure 3
Figure 3
Functional assessment of HSCs isolated from Dkk1-tg mice
Effect of temporary exposure to endosteal Dkk1 on HSC function
Transplantation of BM cells from unmanipulated Dkk1 tg donors allows the assessment of the functional capacity of HSCs following chronic exposure to a Wnt-inhibited environment, as the assayed cells have been exposed to the transgenic osteoblastic cells throughout development. To investigate the impact of temporary exposure to osteoblast-produced Dkk1 on HSC function in a situation of stress, wt or Dkk1 tg mice were lethally irradiated and then transplanted with wt BM from CD45 congenic donors. Consistent with the results obtained in the transplant of chronically Wnt-inhibited HSCs, Dkk1 tg mice were fully reconstituted by wt donor cells, as measured by peripheral white blood cell counts and the percent of multilineage, donor-derived cells detected within the circulation of reconstituted animals (figure 4a and data not shown). These findings suggest that HSC function is not prevented in a setting that inhibits Wnt via Dkk1 overexpression within the HSC niche. In stark contrast with the competent function of donor cells in primary Dkk1 tg recipients, BM isolated from individual reconstituted hosts was unable to efficiently competitively repopulate lethally irradiated secondary wt recipients (figure 4b). Consistent with the loss of HSC function following only 14 weeks of exposure to the Dkk1 tg host environment, reconstituted BM cells that had been resident in Dkk1 tg hosts did not yield as many primitive myeloid colonies in a CFC assay (figure S3b). Therefore, the adverse effect of Dkk1 exposure was not limited to cells that developed within the transgenic environment, but could also be induced by transplantation of adult cells into an adult BM niche that overexpressed the Wnt inhibitor.
Figure 4
Figure 4
Transplant analysis of HSC function following residence in a Dkk1-tg environment
Wnt-inhibited HSC-containing populations are less quiescent
The long-term function of HSCs that permits them to support hematopoiesis even after several rounds of stress-induced expansion, as mimicked by a serial transplant, is thought to depend on maintaining a fraction of the population in a highly quiescent state (Cheng et al, 2000; Hock et al, 2004; Yilmaz et al, 2006). Multiparameter FACS analysis revealed that the HSC-containing, LK+S+ population isolated from Dkk1 tg mice is specifically depleted of cells in the quiescent, G0 stage of the cell cycle (figure 5a). Indeed, greater fractionation of this population by gating on CD34lo LK+S+ cells also revealed that Dkk1 tg mice did not retain quiescent cells (figure 5b). A similar trend was observed when wt cells were examined following transplantation and temporary exposure to the Wnt-inhibited environment (data not shown). Cell cycle analysis at a single time point may not fully reflect the tendency of a population to initiate divisions over time (Janzen et al, 2006). To examine the frequency of entry into cell cycle based on the initiation of DNA synthesis, wt and Dkk1 tg mice were exposed to BrdU for a period of 16-18 hours, followed by analysis of BrdU incorporation within primitive BM populations. When the LK+S+ population was fractionated into LT- and ST-HSC populations, the proportion of BrdU-containing cells was elevated in tg cells, significantly in the CD34+CD135- population (figure S4). These results suggest that Wnt-inhibited HSCs are unable to maintain a population of quiescent cells, and may provide an explanation for the reduced longevity of HSC function observed in serial transplants. An additional method that can assay for the presence of a population of quiescent BM progenitors is to track the recovery of peripheral blood following treatment with the S-phase specific nucleoside analogue, 5-fluorouracil (Randall and Weissman, 1997; Van Zant, 1984) Depletion of cycling cells following 5-FU treatment is followed by a spike in newly generated WBC emerging from a more quiescent, and therefore spared stem/progenitor pool. The time to recovery correlates with the relative preservation of function of the stem/progenitor pool (Yeager et al., 1983). In animals reconstituted with Dkk1 tg BM, there was a significant lag in the ability of BM to replace the depleted neutrophil pool (figure 5c). The impact on total WBC was also significant, if dampened (data not shown), due to the presence of long-lived circulating lymphocytes. These findings suggest that the stem/progenitor population in Dkk1 tg-exposed BM exhibits increased sensitivity to the toxic effects of 5-FU; a phenomenon expected with increased cell cycling. Indeed, only 40 hours after exposure to 5-FU, Dkk1 tg BM contains fewer phenotypically primitive cells (figure S4b), as measured by lineage and SLAM family markers CD150 and CD48 (Kiel et al, 2005). No differences in the frequency of cells measured by cKit expression were observed, likely due to modulation of this protein during 5-FU exposure (Randall and Weissman, 1997).
Figure 5
Figure 5
Examination of cell cycle status of primitive BM in wt and Dkk1-tg mice
Consistent with the observed effect of Dkk-1 on stem cell cycling, we detected a decrease in expression of the cyclin dependent kinase inhibitor, p21Cip1 within the Dkk1 tg LK+S+ population (figure 6). This cell cycle regulator has been previously noted by us to regulate stem cell cycling and in its absence, an acceleration in stem cell exhaustion (Cheng et al, 2000; Miyake et al, 2006). Though not all studies agree, this effect of p21Cip1 has also been documented in other stem cell systems (Kippin et al., 2005; van Os et al, 2007). A pathway demonstrated under some circumstances to be affected by Wnt is Notch (Duncan et al, 2005), and we also observed a decline in expression of the Notch pathway target, Hes-1 (figure 6). Changes in Hes-1 expression have been shown by others to directly affect HSC self-renewal (Kunisato et al, 2003), perhaps by regulating p21 (Yu et al, 2006). A similar reduction in Hes-1 expression was also observed in the LK+S+ fraction of control BM used to reconstitute Dkk1 tg hosts (figure S3b). In contrast, other transcription factors were unaffected by the presence of the osteoblastic-derived Wnt inhibition (figure 3c). These included Gfi-1, Bmi-1 and HoxB4, each of which have been shown previously to play a role in HSC self-renewal programs (Hock et al, 2004; Iwama et al, 2004; Kyba et al., 2002; Park et al, 2003; Zeng et al, 2004).
Figure 6
Figure 6
Gene expression by quantitative PCR of sorted primitive populations
Understanding the role of specific signals in the varied regulatory functions of HSC activities is crucial for designing and developing therapeutic interventions involving these cells. The impact of the Wnt family on the expansion and regulation of hematopoietic cells has been examined in a variety of studies. However, the physiologic effects of this pathway remain somewhat ill-defined with often contradicting results. Some have demonstrated that Wnt cascade activation promotes the proliferation of HSCs and their progeny while maintaining at least short-term functional activity (Baba et al, 2006; Murdoch et al, 2003; Reya et al, 2003; Trowbridge et al, 2006). Others, employing persistent genetic activation of the pathway, have also demonstrated an increase in proliferation of cells with an HSC immunophenotype, but with marked impairment of HSC differentiation resulting in animal death (Kirstetter et al, 2006; Scheller et al, 2006). However, induced deletion of β-catenin, the primary downstream mediator of the Wnt cascade resulted in no apparent impact on HSC activity, even in a reconstitution assay that required expansion of β-catenin null transplanted HSCs (Cobas et al, 2004). Furthermore, recent combined deletions of both β-catenin and its homologue, γ-catenin, also maintain HSC function under steady-state and primary reconstitution conditions (Jeannet et al, 2007; Koch et al, 2007).All of these studies have either assayed Wnt activity in broad over- or under-stimulation settings, and the manipulations have been performed on the HSCs themselves, or broadly applied to recipient animals. The context in which morphogens are present is highly relevant to their effect and not previously studied for Wnt effects on hematopoiesis (Trowbridge et al., 2006). Indeed, Wnt ligands can modulate signaling initiated by other Wnt family members, underscoring the concept that context, and different signaling intermediates may have a strong impact on functional outcome (Nemeth et al, 2007).
In the present study, we have established a system that permits the analysis of localized Wnt inhibition, offering the opportunity to assay the impact of chronic or temporary exposure to this inhibited environment. In particular, we have directed expression of the Wnt inhibitor, Dkk1, to a cell population that has been previously demonstrated to exert a regulatory function over HSC activity, and which normally express Dkk-1, albeit at lower levels (Grotewold et al,1999; MacDonald et al, 2004). It should be noted that while an increasing number of reports suggest that phenotypically-identified HSCs inhabit additional physical locations within the bone marrow environment (Hooper et al, 2007; Scadden, 2006), the promoter used in our study has proven to functionally impact the number and activity of HSCs when used to direct modifying signal expression to a population of osteoblastic cells. Given that expression of Dkk1 also results in alterations to bone morphology itself, there is likely to be a dual effect of Dkk1: one altering the niche architecture and the other affecting Wnt signaling in stem/progenitor cells. Our studies demonstrated an effect of Dkk1 overexpression by non-HSCs on Wnt signaling in hematopoietic stem/progenitors, suggesting that this is at least a contributing factor to the phenotype observed. This observation that TCF/LEF reporter activity is reduced, as is expression of endogenous Dkk1, itself a Wnt signaling target (Niida et al, 2004) in BM cells of the transgenic mice indicates altered canonical Wnt signaling. It does not rule out that Dkk1 may exert additional Wnt-independent functions. The results presented here also indicate that the reduced longevity of HSCs does not require constant exposure to exogenous Dkk1, given that we were unable to detect Dkk1 tg expression within populations of primitive hematopoietic cells, and therefore the functional impact on transplanted cells is observed in a Dkk tg-free environment. It is important to note that transplantation of whole BM populations is generally not effective at engrafting non-hematopoietic cells (Koc et al, 1999).
Wnt mediates HSC quiescence and maintains reconstitution function in vivo
The results presented here establish a role for Wnt, in the maintenance of a quiescent fraction of functional HSCs in BM. This was associated with evidence of increased stem cells on limit dilution transplant analysis. However the ability of the same cells to function after serial rounds of transplantation was drastically reduced. The ability of stem cells to persist under the stress conditions of transplantation requires self-renewal capability that is compromised after Dkk1 exposure
The studies of inducible deletion of β- and γ-catenin noted that they were dispensable for HSC function, however did not include sequential transplants out to the extent where we observed our most dramatic phenotype (Cobas et al, 2004; Jeannet et al, 2007; Koch et al, 2007) Alternatively, it is possible that Dkk1 interferes with HSC function through a process that does not depend on β- or γ-catenin signaling (Jeannet et al, 2007; Niehrs, 2006).
Our results emphasize the importance of studying pathways within the context of other signals present in the natural microenvironment, and underscore the potential for unanticipated functional roles. It is clear that different combinations of signals may have a range of effects depending on the context in which they are received. Indeed, we observed an impact of Wnt-inhibition on the activation of the Notch target, Hes-1, raising the possibility that Notch and Wnt coordinate in vivo to maintain quiescence of HSCs, rather than participating in expansive and/or self-renewal functions (Duncan et al, 2005). Notably, elevated Hes-1 and p21 expression have recently been shown to correlate with the maintenance of quiescence and repopulating function of primitive HSCs (Yu et al, 2006). We noted a highly specific impact of the Dkk1 tg on the stem cell enriched LK+S+ fraction in Wnt-dependent pathway activation and inhibition and the Notch target, Hes-1, or the cell cycle regulator, p21 expression.
The effects of Dkk1 on cell cycling were unanticipated given previous reports of constitutively active β-catenin inducing increased stem/progenitor cell proliferation (Kirstetter et al, 2006; Scheller et al, 2006). However, others found that with deletion of the chromatin binding protein, Hmgb3, Wnt signaling was increased, yet stem cells more readily returned to quiescence after 5-FU challenge than controls. (Nemeth et al, 2006) Both increased and decreased activation of the pathway may therefore alter HSC cycling kinetics. This may again be due to the context differences observed with a microenvironmentally-provided signal in the current study contrasted with cell autonomous activation of the pathway in the prior reports. Alternatively, it may be an example of the complex effects of morphogens, which have dose-dependent actions (Delaney et al, 2005; Kielman et al, 2002; MacDonald et al, 2004). It may be that there is a bi-phasic response of cell cycling to the Wnt pathway and that proper control of stem cell quiescence requires a fine-tuned modulation of intermediate Wnt signaling intensity. This has implications for the potential use of Wnts as mediators of stem cell expansion ex vivo and for interruption of this pathway as an anti-leukemic intervention.
In sum, niche related expression of Dkk1 reveals a role for Wnt signaling in the physiologic regulation of the hematopoietic compartment, altering stem cell cycling and longevity following repeated expansion, or self-renewal. The phenotype observed was sufficiently distinct from what cell-autonomous modifications of the pathway would have predicted to argue for niche specific modeling of exogenous factors’ effects on stem cells. This may be particularly true for members of the locally acting morphogen group of cell modifiers.
Mice
C57Bl/6 wt, CD45.1 congenic, (Jackson) and Col1α-Dkk1 transgenic mice were bred in-house in a pathogen-free environment. Unless otherwise stated, male Dkk1-tg mice and wt littermates were studied between 8-12 weeks of age. Transplant recipients were female mice of at least 12 weeks old. The Subcommittee on Research Animal Care of the Massachusetts General Hospital (MGH) approved all animal work according to federal and institutional policies and regulations.
Cells and cell culture
Bone marrow was harvested as previously described (Walkley et al, 2007) and cultured in CFU-C assays according to the manufacturers’ protocols (Stem Cell Technologies).
Flow cytometric analysis and sorting of subpopulations
Lineage staining utilized a cocktail of biotinylated anti-mouse antibodies to Mac-1 (CD11b), Gr-1(Ly-6G & 6C), Ter119 (Ly-76), CD3ε, CD4, CD8a (Ly-2), and B220 (CD45R) (BD Biosciences). For detection and sorting we used streptavidin conjugated either with PE/Cy7, APC/Cy7 or PerCP (BD Biosciences). Directly conjugated antibodies used were: c-Kit-APC (CD117), Flk2-PE (CD135), (BD Biosciences); Sca1-PE/Cy5.5 (Ly 6A/E, Caltag); CD34-FITC, CD117-APC/Cy7, CD16/32-Alexa700, IL-7Rα-Pacific Blue (eBioscience). Primitive subpopulations were gated as shown in supplementary figure 2a-c. For congenic strain discrimination anti-CD45.1-PE and anti-CD45.2 FITC antibodies (BD Biosciences) were used in combination with CD11b-APC and B220-Pe/Cy5. For BrdU incorporation we used the APC-BrdU Flow Kit (BD Biosciences) according to the manufacturer’s instructions. BM was assayed 16-18 hours after a single intraperitoneal injection of BrdU (100 ul of a 10mg/ml solution) with subsequent access to 1 mg/ml BrdU in drinking water. Surface staining for lineage markers was performed as above, with Lin-btn/saPerCP, Sca1-PE/Cy5.5, c-Kit-APC/Cy7, CD135-PE and CD34-FITC. Staining for the primitive BM populations following 5-FU exposure utilized CD150-PE and CD48- FITC conjugates in combination with biotinylated Lineage cocktail and saAPC.
Transplantation Assays
For serial transplantation, 1×106 whole bone marrow cells from 8 to12 week old WT and Dkk1 tg (CD45.1) littermates were injected into lethally irradiated (9.5 Gy) female C57Bl/6 (CD45.2) recipients. Reconstitution was monitored by FACS analysis of peripheral blood at 4, 8 and 14 weeks post transplantation. Fourteen weeks post transplantation recipients were used as donors for the subsequent transplantation cycle. Analysis of surviving fractions was calculated using a Kaplan-Meier plot with Prism graphing software. For limiting dilution / CRU transplants, doses of 1.5×105, 5×104 or 1.67×104 test cells (CD45.1) were mixed with 3.0×105 competing wt BM cells and transplanted i.v. into groups of at least 9 lethally irradiated wt recipients, as previously described (Janzen et al, 2006). Reconstitution was assessed at weeks 12 and 24 post transplantation, and analyzed with L-Calc software (Stem Cell Technologies). For competitive transplants, 5×105 bone marrow cells from individual Dkk1tg or littermate mice (CD45.1) were transplanted with the same number of wt BM into each of 8-10 lethally irradiated wt recipients. Repopulation was assessed by flow cytometry at 8, 16 and 24 weeks by FACS analysis of peripheral blood. For transplantation to assess acute Dkk1 exposure, 1×106 wt BM cells were transplanted into 5 individual Dkk1 tg or control (CD45.1) lethally irradiated recipients. Reconstitution was assessed by FACS analysis of peripheral blood at 4, 8 and 14 weeks. After 14 weeks, groups of 5 secondary wt CD45.1 recipients received 9×105 donor cells (CD45.2) from an individual primary recipients mixed with 3×105 fresh CD45.1 BM. Reconstitution was assessed at 4, 12 and 24 weeks.
Hoechst/Py cell cycle analysis
Unmanipulated wt and Dkk1 tg BM was incubated with 10 ug/ml Hoechst 33342 for 30 minutes at 37oC. Cells were washed and stained with antibodies against CD34, cKit, Sca1 and Lin. The cells were fixed in 5% PFA, and incubated with an RNA-dye, Pyronin Y (PY, 1 μg/ml) prior to flow cytometry. The proportion of cells in G0 (PYlow,Hoechstlow) was measured in the LK+S+ and LK+S+CD34low gated populations.
5-Fluorouracil assay for quiescence
To test for retention of a quiescent pool of hematopoietic progenitors, groups of 5 wt recipients were lethally irradiated and transplanted with 1 million BM cells from individual wt or Dkk1 tg donors (CD45.1), and left to engraft for 16 weeks. A single 150 mg/kg dose of 5-FU (Pharmacia) was administered i.p. on days 0 and 42. Peripheral blood cell composition was monitored by tail vein sampling using a Hemavet 850 (Drew Scientific) at day 0, and every 7 days thereafter. Prior to each 5-FU injection, mice were assayed to confirm complete peripheral blood reconstitution by the original donor CD45.1 population (not shown). For BM analysis, mice were sacrificed 40-42 hours after 5-FU injection. BM cells were isolated and stained for FACS analysis of primitive BM populations.
PCR and gene expression analyses
Gene expression was determined as described previously (Janzen et al, 2006). Briefly, RNA was isolated from sorted BM subpopulations using the PicoPure Kit (Arcturus Bioscience). Pre-designed assays for Hprt1, Bmi1, Gfi1, Hes1, and p21 were purchased from Applied Biosystems (assay Ids Mm00446968, Mm00776122, Mm00515853, Mm00468601, Mm00432448, respectively). For analysis of Topgal reporter expression, LK+S+ and LK+S− populations were sorted from three mice, transgenic either for Topgal alone, or Topgal and Dkk1 tg. Topgal reporter activity was assayed using Applied Biosystems Sybr-Green kit with the primers FW:TAATGTTGATGAAAGCTGGCT, RV:ATGCGCTCAGGTCAAATTCAG. Data is presented as the delta-CT between the gene of interest and Hprt1 in a given population of Dkk1 tg cells, relative to the same comparison performed for wt cells. For endogenous and transgenic Dkk1 expression, in addition to sorted LK+S+ populations, total RNA was extracted from tibiae (including marrow cells) using Trizol reagents (Invitrogen, Carlsbad, CA,) according to the manufacturer’s protocol. cDNA was prepared using the SuperScript First-Strand Systhesis System for RT-PCR (Invitrogen) and analyzed in triplicate with the SYBR Green Master Mix system (Qiagen). Primers specific for Dkk1 tg: FW:AACCTTACTTCTGTGGTGTGACAT, RV: AACCTTACTTCTGTGGTGTGACAT. Primers detecting both endogenous and tg Dkk1: FW: CTTGCGCTGAAGATGAGGAGT, RV:GAGGGCATGCATATTCCATTT.
Statistical analysis
Where not otherwise stated, the student’s T test was used to determine the significance, set at p< 0.05.
Supplementary Material
01
Acknowledgements
The authors would like to thank D Dombkowski for cell sorting and assistance with mulitparameter flow cytometry, R Klein for mouse colony maintenance, and L Purton for critical reading of the manuscript.
Footnotes
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
  • Adams GB, Martin RP, Alley IR, Chabner KT, Cohen KS, Calvi LM, Kronenberg HM, Scadden DT. Therapeutic targeting of a stem cell niche. Nat. Biotechnol. 2007;2:238–243. [PubMed]
  • Akala OO, Clarke MF. Hematopoietic stem cell self-renewal. Curr. Opin. Genet. Dev. 2006;5:496–501. [PubMed]
  • Baba Y, Yokota T, Spits H, Garrett KP, Hayashi S, Kincade PW. Constitutively active beta-catenin promotes expansion of multipotent hematopoietic progenitors in culture. J. Immunol. 2006;4:2294–2303. [PubMed]
  • Calvi LM, Adams GB, Weibrecht KW, Weber JM, Olson DP, Knight MC, Martin RP, Schipani E, Divieti P, Bringhurst FR, et al. Osteoblastic cells regulate the haematopoietic stem cell niche. Nature. 2003;6960:841–846. [PubMed]
  • Calvi LM, Sims NA, Hunzelman JL, Knight MC, Giovannetti A, Saxton JM, Kronenberg HM, Baron R, Schipani E. Activated parathyroid hormone/parathyroid hormone-related protein receptor in osteoblastic cells differentially affects cortical and trabecular bone. J. Clin. Invest. 2001;3:277–286. [PMC free article] [PubMed]
  • Cheng T, Rodrigues N, Shen H, Yang Y, Dombkowski D, Sykes M, Scadden DT. Hematopoietic stem cell quiescence maintained by p21cip1/waf1. Science. 2000;5459:1804–1808. [PubMed]
  • Cobas M, Wilson A, Ernst B, Mancini SC, MacDonald HR, Kemler R, Radtke F. {beta}-Catenin Is Dispensable for Hematopoiesis and Lymphopoiesis. J. Exp. Med. 2004;2:221–229. [PMC free article] [PubMed]
  • Daniels DL, Weis WI. Beta-catenin directly displaces Groucho/TLE repressors from Tcf/Lef in Wnt-mediated transcription activation. Nat. Struct. Mol. Biol. 2005;4:364–371. [PubMed]
  • DasGupta R, Fuchs E. Multiple roles for activated LEF/TCF transcription complexes during hair follicle development and differentiation. Development. 1999;20:4557–4568. [PubMed]
  • Delaney C, Varnum-Finney B, Aoyama K, Brashem-Stein C, Bernstein ID. Dose-dependent effects of the Notch ligand Delta1 on ex vivo differentiation and in vivo marrow repopulating ability of cord blood cells. Blood. 2005;8:2693–2699. [PubMed]
  • Duncan AW, Rattis F,M, DiMascio LN, Congdon KL, Pazianos G, Zhao C, Yoon K, Cook JM, Willert K, Gaiano N, Reya T. Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat. Immunol. 2005:314–322. [PubMed]
  • Grotewold L, Theil T, Ruther U. Expression pattern of Dkk-1 during mouse limb development. Mech. Dev. 1999;1-2:151–153. [PubMed]
  • Hock H, Hamblen MJ, Rooke HM, Schindler JW, Saleque S, Fujiwara Y, Orkin SH. Gfi-1 restricts proliferation and preserves functional integrity of haematopoietic stem cells. Nature. 2004;7011:1002–1007. [PubMed]
  • Hooper AT, Butler J, Petit I, Rafii S. Does N-Cadherin Regulate Interaction of Hematopoietic Stem Cells with Their Niches? Cell Stem Cell. 2007;2:127–128. [PMC free article] [PubMed]
  • Iwama A, Oguro H, Negishi M, Kato Y, Morita Y, Tsukui H, Ema H, Kamijo T, Katoh-Fukui Y, Koseki H. Enhanced Self-Renewal of Hematopoietic Stem Cells Mediated by the Polycomb Gene Product Bmi-1. Immunity. 2004;6:843–851. [PubMed]
  • Janzen V, Forkert R, Fleming HE, Saito Y, Waring MT, Dombkowski DM, Cheng T, DePinho RA, Sharpless NE, Scadden DT. Stem-cell ageing modified by the cyclin-dependent kinase inhibitor p16INK4a. Nature. 2006;7110:421–426. [PubMed]
  • Jeannet G, Scheller M, Scarpellino L, Duboux S, Gardiol N, Back J, Kuttler F, Malanchi I, Birchmeier W, Leutz A, Huelsken J, Held W. Long-term, multilineage hematopoiesis occurs in the combined absence of {beta}-catenin and {gamma}-catenin. Blood. 2007 [PubMed]
  • Jung Y, Wang J, Song J, Shiozawa Y, Wang J, Havens A, Wang Z, Sun Y, Emerson S, Krebsbach P, Taichman R. Annexin II expressed by osteoblasts and endothelial cells regulates stem cell adhesion, homing, and engraftment following transplantation. Blood. 2007;1:82–90. [PubMed]
  • Kawano Y, Kypta R. Secreted antagonists of the Wnt signalling pathway. J Cell Sci. 2003;13:2627–2634. [PubMed]
  • Kiel MJ, Yilmaz ÖH, Iwashita T, Yilmaz OH, Terhorst C, Morrison SJ. SLAM Family Receptors Distinguish Hematopoietic Stem and Progenitor Cells and Reveal Endothelial Niches for Stem Cells. Cell. 2005;7:1109–1121. [PubMed]
  • Kielman MF, Rindapaa M, Gaspar C, van Poppel N, Breukel C, van Leeuwen S, Taketo MM, Roberts S, Smits R, Fodde R. Apc modulates embryonic stem-cell differentiation by controlling the dosage of beta-catenin signaling. Nat. Genet. 2002;4:594–605. [PubMed]
  • Kippin TE, Martens DJ, van der Kooy D. p21 loss compromises the relative quiescence of forebrain stem cell proliferation leading to exhaustion of their proliferation capacity. Genes Dev. 2005;6:756–767. [PubMed]
  • Kirstetter P, Anderson K, Porse BT, Jacobsen SE, Nerlov C. Activation of the canonical Wnt pathway leads to loss of hematopoietic stem cell repopulation and multilineage differentiation block. Nat. Immunol. 2006;10:1048–1056. [PubMed]
  • Koc ON, Peters C, Aubourg P, Raghavan S, Dyhouse S, DeGasperi R, Kolodny EH, Yoseph YB, Gerson SL, Lazarus HM, et al. Bone marrow-derived mesenchymal stem cells remain host-derived despite successful hematopoietic engraftment after allogeneic transplantation in patients with lysosomal and peroxisomal storage diseases. Exp. Hematol. 1999;11:1675–1681. [PubMed]
  • Koch U, Wilson A, Cobas M, Kemler R, Macdonald HR, Radtke F. Simultaneous loss of {beta}- and {gamma}-catenin does not perturb hematopoiesis or lymphopoiesis. Blood. 2007 [PubMed]
  • Kunisato A, Chiba S, Nakagami-Yamaguchi E, Kumano K, Saito T, Masuda S, Yamaguchi T, Osawa M, Kageyama R, Nakauchi H, Nishikawa M, Hirai H. HES-1 preserves purified hematopoietic stem cells ex vivo and accumulates side population cells in vivo. Blood. 2003;5:1777–1783. [PubMed]
  • Kyba M, Perlingeiro RC, Daley GQ. HoxB4 confers definitive lymphoid-myeloid engraftment potential on embryonic stem cell and yolk sac hematopoietic progenitors. Cell. 2002;1:29–37. [PubMed]
  • Li J, Sarosi I, Cattley RC, Pretorius J, Asuncion F, Grisanti M, Morony S, Adamu S, Geng Z, Qiu W, et al. Dkk1-mediated inhibition of Wnt signaling in bone results in osteopenia. Bone. 2006;4:754–766. [PubMed]
  • MacDonald BT, Adamska M, Meisler MH. Hypomorphic expression of Dkk1 in the doubleridge mouse: dose dependence and compensatory interactions with Lrp6. Development. 2004;11:2543–2552. [PubMed]
  • Mao B, Wu W, Davidson G, Marhold J, Li M, Mechler BM, Delius H, Hoppe D, Stannek P, Walter C, Glinka A, Niehrs C. Kremen proteins are Dickkopf receptors that regulate Wnt/beta-catenin signalling. Nature. 2002;6889:664–667. [PubMed]
  • Mao B, Wu W, Li Y, Hoppe D, Stannek P, Glinka A, Niehrs C. LDL-receptor-related protein 6 is a receptor for Dickkopf proteins. Nature. 2001;6835:321–325. [PubMed]
  • Miyake N, Brun AC, Magnusson M, Miyake K, Scadden DT, Karlsson S. HOXB4-induced self-renewal of hematopoietic stem cells is significantly enhanced by p21 deficiency. Stem Cells. 2006;3:653–661. [PubMed]
  • Murdoch B, Chadwick K, Martin M, Shojaei F, Shah KV, Gallacher L, Moon RT, Bhatia M. Wnt-5A augments repopulating capacity and primitive hematopoietic development of human blood stem cells in vivo. Proceedings of the National Academy of Sciences. 2003;6:3422–3427. [PubMed]
  • Nemeth MJ, Kirby MR, Bodine DM. Hmgb3 regulates the balance between hematopoietic stem cell self-renewal and differentiation. Proceedings of the National Academy of Sciences. 2006;37:13783. [PubMed]
  • Nemeth MJ, Bodine DM. Regulation of hematopoiesis and the hematopoietic stem cell niche by Wnt signaling pathways. Cell Res. 2007;9:746–758. [PubMed]
  • Nemeth MJ, Topol L, Anderson SM, Yang Y, Bodine DM. Wnt5a inhibits canonical Wnt signaling in hematopoietic stem cells and enhances repopulation. Proc. Natl. Acad. Sci. U. S. A. 2007;39:15436–15441. [PubMed]
  • Niehrs C. Function and biological roles of the Dickkopf family of Wnt modulators. Oncogene. 2006;57:7469–7481. [PubMed]
  • Niida A, Hiroko T, Kasai M, Furukawa Y, Nakamura Y, Suzuki Y, Sugano S, Akiyama T. DKK1, a negative regulator of Wnt signaling, is a target of the beta-catenin/TCF pathway. Oncogene. 2004;52:8520–8526. [PubMed]
  • Park IK, Qian D, Kiel M, Becker MW, Pihalja M, Weissman IL, Morrison SJ, Clarke MF. Bmi-1 is required for maintenance of adult self-renewing haematopoietic stem cells. Nature. 2003;6937:302–305. [PubMed]
  • Purton LE, Scadden DT. Limiting factors in murine hematopoietic stem cell assays. Cell Stem Cell. 2007;3:263–270. [PubMed]
  • Randall TD, Weissman IL. Phenotypic and functional changes induced at the clonal level in hematopoietic stem cells after 5-fluorouracil treatment. Blood. 1997;10:3596–3606. [PubMed]
  • Reya T, Duncan AW, Ailles L, Domen J, Scherer DC, Willert K, Hintz L, Nusse R, Weissman IL. A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature. 2003:409–414. [PubMed]
  • Scadden DT. The stem-cell niche as an entity of action. Nature. 2006;7097:1075–1079. [PubMed]
  • Scheller M, Huelsken J, Rosenbauer F, Taketo MM, Birchmeier W, Tenen DG, Leutz A. Hematopoietic stem cell and multilineage defects generated by constitutive beta-catenin activation. Nat. Immunol. 2006;10:1037–1047. [PubMed]
  • Trowbridge JJ, Scott MP, Bhatia M. Hedgehog modulates cell cycle regulators in stem cells to control hematopoietic regeneration. Proceedings of the National Academy of Sciences. 2006;38:14134. [PubMed]
  • Trowbridge JJ, Xenocostas A, Moon RT, Bhatia M. Glycogen synthase kinase-3 is an in vivo regulator of hematopoietic stem cell repopulation. Nat. Med. 2006;1:89–98. [PubMed]
  • van Os R, Kamminga LM, Ausema A, Bystrykh LV, Draijer DP, van Pelt K, Dontje B, de Haan G. A Limited role for p21Cip1/Waf1 in maintaining normal hematopoietic stem cell functioning. Stem Cells. 2007;4:836–843. [PubMed]
  • Van Zant G. Studies of hematopoietic stem cells spared by 5-fluorouracil. J. Exp. Med. 1984;3:679–690. [PMC free article] [PubMed]
  • Walkley CR, Olsen GH, Dworkin S, Fabb SA, Swann J, McArthur GA, Westmoreland SV, Chambon P, Scadden DT, Purton LE. A Microenvironment-Induced Myeloproliferative Syndrome Caused by Retinoic Acid Receptor γ De ficiency. Cell. 2007;6:1097–1110. [PMC free article] [PubMed]
  • Yeager AM, Levin J, Levin FC. The effects of 5-fluorouracil on hematopoiesis: studies of murine megakaryocyte-CFC, granulocyte-macrophage-CFC, and peripheral blood cell levels. Exp. Hematol. 1983;10:944–952. [PubMed]
  • Yilmaz OH, Valdez R, Theisen BK, Guo W, Ferguson DO, Wu H, Morrison SJ. Pten dependence distinguishes haematopoietic stem cells from leukaemia-initiating cells. Nature. 2006;7092:475–482. [PubMed]
  • Yu X, Alder JK, Chun JH, Friedman AD, Heimfeld S, Cheng L, Civin CI. HES1 inhibits cycling of hematopoietic progenitor cells via DNA binding. Stem Cells. 2006;4:876–888. [PubMed]
  • Zeng H, Yucel R, Kosan C, Klein-Hitpass L, Moroy T. Transcription factor Gfi1 regulates self-renewal and engraftment of hematopoietic stem cells. EMBO J. 2004;20:4116–4125. [PubMed]
  • Zhang J, Niu C, Ye L, Huang H, He X, Tong WG, Ross J, Haug J, Johnson T, Feng JQ, et al. Identification of the haematopoietic stem cell niche and control of the niche size. Nature. 2003;6960:836–841. [PubMed]