PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Aging Cell. Author manuscript; available in PMC 2010 November 24.
Published in final edited form as:
PMCID: PMC2991086
NIHMSID: NIHMS249002

Compromised store-operated Ca2+ entry in aged skeletal muscle

Summary

In aged skeletal muscle, changes to the composition and function of the contractile machinery cannot fully explain the observed decrease in the specific force produced by the contractile machinery that characterizes muscle weakness during aging. Since modification in extracellular Ca2+ entry in aged nonexcitable and excitable cells has been recently identified, we evaluated the functional status of store-operated Ca2+ entry (SOCE) in aged mouse skeletal muscle. Using Mn2+ quenching of Fura-2 fluorescence and confocal-microscopic imaging of Ca2+ movement from the transverse tubules, we determined that SOCE was severely compromised in muscle fibers isolated from aged mice (26–27 months) as compared with those from young (2–5 months) mice. While reduced SOCE in aged skeletal muscle does not appear to result from altered expression levels of STIM1 or reduced expression of mRNA for Orai, this reduction in SOCE is mirrored in fibers isolated from young mice null for mitsugumin-29, a synaptophysin-related protein that displays decreased expression in aged skeletal muscle. Our data suggest that decreased mitsugumin-29 expression and reduced SOCE may contribute to the diminished intracellular Ca2+ homeostatic capacity generally associated with muscle aging.

Keywords: calcium signaling, mitsugumin-29, muscle aging, Orai, STIM1, store-operated calcium entry

Introduction

Aging effects on muscle function have been associated with reduced specific contractile force and sarcopenia (Faulkner et al., 1995; Gonzalez et al., 2000). The resulting muscle weakness is a significant factor contributing to falls that lead to serious injury. A decline in skeletal muscle function is also a major contributor to decreased mobility and independence in the elderly, which leads to deterioration of quality of life (Moreland et al., 2004). Although the underlying mechanisms are not fully established, compromised intracellular Ca2+ homeostasis may contribute to the progression of aging-related effects on muscle function (Delbono, 2002; Payne et al., 2004; Weisleder et al., 2006).

To initiate contraction in skeletal muscle fibers, Ca2+ is released from the sarcoplasmic reticulum (SR) into the cytosol through the ryanodine receptor (RyR). To terminate contraction, Ca2+ is sequestered into the SR through the action of SR/endoplasmic reticulum Ca2+-ATPase (SERCA). During each cycle of contraction, a fraction of Ca2+ exits the cell through the plasma membrane Ca2+ pump (Hemmings, 2001; Kurebayashi & Ogawa, 2001; Weigl et al., 2003). Thus, maintaining functional levels of Ca2+ within the SR and the cytosol-regulated Ca2+ entry across the plasma membrane is essential for muscle fibers to function at different developmental stages, and in response to various stress conditions. Store-operated Ca2+ entry (SOCE) mediates extracellular Ca2+ ([Ca2+]o) entry in response to reduction of intracellular Ca2+ ([Ca2+]i) stores (Parekh & Putney, 2005; Brotto et al., 2007).

Extensive studies link SOCE to cell development, proliferation and apoptosis in a wide variety of cells (Parekh & Putney, 2005). In skeletal muscle, SOCE has been reported to function in both physiological and pathophysiological processes (Kurebayashi & Ogawa, 2001; Pan et al., 2002; Brotto et al., 2007). Under conditions of increased Ca2+ demand, such as muscle differentiation, exercise and fatigue, SOCE acts as a gate for [Ca2+]o entry to match the increased requirements for Ca2+-dependent processes of the muscle fiber (Dangain & Neering, 1991; Louboutin et al., 1995; Brotto et al., 2004; Zhao et al., 2005). In muscular dystrophy, excessive Ca2+ leakage into the muscle fiber through SOCE and/or other Ca2+ entry pathways contributes to the progression of muscle deterioration (Fong et al., 1990; Vandebrouck et al., 2002).

Recent studies indicate reduced permeability of plasma membrane to divalent cations in aged skeletal muscle (Fraysse et al., 2006), and reduced SOCE was identified in aged neuronal cells (Vanterpool et al., 2005) and aged fibroblasts (Papazafiri & Kletsas, 2003). However, the functional status of SOCE, and any modifications of SOCE machinery, in aged skeletal muscle have not been evaluated. In this study, we used muscles isolated from aged mice as a model for sarcopenia. Mice can act as an appropriate model for sarcopenia since aged mice over 25 months display decreased skeletal muscle mass and reduced contractility in a fashion similar to aged human skeletal muscles (Barton-Davis et al., 1998; Pagala et al., 1998; Hamrick et al., 2006; Rader & Faulkner, 2006). Our experiments allow us to identify compromised SOCE as a phenotype of muscle aging. Decreased SOCE in aged skeletal muscle does not result from altered mRNA levels of stromal interaction molecule 1 (STIM1) (Zhang et al., 2005; Huang et al., 2006; Luik et al., 2006), a putative Ca2+ sensor on the SR/ER membrane, or Orai (Feske et al., 2006; Vig et al., 2006), the pore conducting unit of SOCE in several cell types (Prakriya et al., 2006). We show that SOCE is also reduced in young muscle fibers from mice lacking mitsugumin-29 (MG29) (Nishi et al., 1999), a protein that regulates Ca2+ signaling in skeletal muscle. Our data suggest that compromised SOCE in aged muscle may result from disruption of the signaling process downstream of the currently known components of the SOCE machinery pointing towards MG29 as a molecule involved with such phenomenon.

Results

Compromised SOCE in aged skeletal muscle fibers

To test the functional status of SOCE in aged skeletal muscle, we employed Mn2+ quenching of Fura-2 fluorescence to quantify the unidirectional ion flux in intact flexor digitorum brevis (FDB) fibers enzymatically isolated from young (2–5 months) and aged (26–27 months) mice. In this broadly used technique to measure SOCE, Mn2+ is supplied in the extracellular solution to act as a surrogate for Ca2+. Entry of Mn2+ results in quenching of Fura-2 fluorescence measured at a wavelength of 360 nm, the isosbestic point of Fura-2 (Merritt et al., 1989). Caffeine plus ryanodine, both agonists of RyR, was perfused onto FDB fibers to activate RyR and trigger active depletion of the SR Ca2+ store, enabling activation of SOCE. As shown in Fig. 1, aged FDB muscle displays a substantially diminished Mn2+ entry rate compared to that of young muscle, indicating that SOCE induced by SR Ca2+ depletion with RyR agonists is compromised in aged skeletal muscle.

Fig. 1
The Mn2+-quenching technique reveals reduced store-operated Ca2+ entry (SOCE) in intact aged flexor digitorum brevis (FDB) skeletal muscle fibers. (A) Mn2+ quenching of Fura-2 fluorescence at an excitation wavelength 360 nm illustrates activation of SOCE ...

Reduced SOCE in aged muscle viewed by skinned muscle fiber methodology

To confirm our observation, we applied skinned muscle fiber methodology to directly visualize SOCE activation and monitor its development from the beginning of SR Ca2+ depletion. Mechanical skinning of the extensor digitorum longus (EDL) muscle fiber does not appear to disrupt the integrity of the transverse tubules (TT) system, as evidenced by the doublet pattern of the TT membrane (Fig. 2A) characteristic of mammalian muscle fibers (Brown et al., 2006). Upon exposure of the skinned-muscle fiber to an intracellular-like solution containing 500 nm free Ca2+, active transport of Ca2+ into the TT compartment leads to increased Rhod-5 N fluorescence (Fig. 2B, loading). Upon addition of 20 μm thapsigargin plus 30 mm caffeine (TG/C), depletion of the SR Ca2+ store is achieved through both the passive and active pathways. This is reflected by the concurrent reduction of Rhod-5 N fluorescence due to exit of Ca2+ from the TT compartment to the cytosol (Fig. 2B, depletion).

Fig. 2
Control experiments used for validation of confocal-based method to directly monitor the spatial and temporal distribution of store-operated Ca2+ entry (SOCE) in mechanically skinned muscle fibers. (A) Rhod-5 N fluorescence reveals the doublet pattern ...

Using this technique we were able to trap Rhod-5 N salt into the TTs of young and aged EDL muscle fibers (Fig. 3A). As shown in Fig. 3, SOCE responses were significantly different in young and aged muscles. In aged skeletal muscle, the decrease in Rhod-5 N fluorescence 4 min after application of TG/C is minimal, indicating severely compromised SOCE compared to that in young muscle fibers. Upon addition of NiCl2, a broad inhibitor of SOCE and other Ca2+ entry mechanisms, as shown in Fig. 3(B), the SOCE activity in young muscle fibers is largely inhibited, while there is only minor alteration to the inhibited SOCE in aged muscle fibers. This small effect suggests that there is some leakage of Ca2+ that occurs from the sealed TTs in skinned fibers. These effects of NiCl2 confirm that [Ca2+]o entry is altered in aged skeletal muscle, rather than [Ca2+]i release from the SR.

Fig. 3
Defective store-operated Ca2+ entry (SOCE) in aged muscle revealed by confocal microscopy. (A) Confocal images of skinned muscle fibers loaded with Rhod-5 N salt. Depletion of SR Ca2+ store with 20 μm thapsigargin plus 30 mm caffeine leads activation ...

Expression profile of SOCE machinery in C2C12 and adult skeletal muscles

Recent breakthroughs have identified Orai and STIM1 as components of the SOCE machinery (Zhang et al., 2005; Vig et al., 2006). Three Orai genes (Orai1, Orai2 and Orai3) are found in mammalian genomes (Feske et al., 2006). To test whether the reduced SOCE in aged skeletal muscle was associated with altered expression of STIM1 and Orai, we first conducted a series of quantitative real-time polymerase chain reaction (PCR) experiments in both C2C12 myogenic cell line and gastrocnemius muscles from young and aged mice. We found that STIM1 and Orai1 expression increased significantly during myotube differentiation in C2C12 myoblast cells, whereas the expression of Orai2 and Orai3 did not change (Fig. 4A). This muscle-differentiation mediated up-regulation of Orai1 and STIM1 has likely physiological relevance, as our functional assays have shown that SOCE is absent in undifferentiated C2C12 myoblasts (data not shown), while differentiation of C2C12 myotubes is associated with robust increase in SOCE (Shin et al., 2003).

Fig. 4
Constant expression of Orai/CRACM and STIM-1 during muscle aging contrasts with decreased MG29 expression. (A) The relative Ct value of STIM1 and Orai1, Orai2 and Orai3 in C2C12 myoblasts (day 0) and myotubues (at days 6 and 12 of differentiation). Data ...

In adult mouse skeletal muscle, we found that Orai1 was the dominant isoform, suggesting that Orai1 could comprise the principal pore-forming unit for SOCE in skeletal muscle (Fig. 4B). The mRNA for Orai2 and Orai3 were detected at lower levels, and they did not change with muscle aging. Interestingly, no significant changes in mRNA for STIM1 or Orai1 were identified in aged mouse skeletal muscle (Fig. 4B). Thus, age-related decrease in SOCE activity is not likely due to changes in the relative abundance of STIM1 or Orai1 mRNA. However, STIM1 immunostaining on soleus muscle sections showed increased intracellular clustering of STIM1 protein (unpublished observations), suggesting that altered localization of STIM 1 may contribute to the reduced SOCE activity associated with muscle aging.

Reduced MG29 is linked to the compromised SOCE in aged muscle

Our previous study has shown that MG29 protein in FDB skeletal muscles decreases with age (Weisleder et al., 2006) and this phenomenon is also observed in gastrocnemius muscle (Fig. 4C). Our studies have also indicated that phenotypic changes observed in aged muscles from wild-type mice are mirrored in young mg29−/− mice. To determine the physiological function of MG29 in SOCE regulation in adult muscle fibers, we performed SOCE measurement in EDL muscle isolated from the mg29−/− and wild-type mice at young ages (2–5 months) using our skinned muscle fiber methodology. As shown in Fig. 5, skeletal muscle fibers from young mg29−/− mice display significantly compromised SOCE, mirroring the decline in SOCE activity observed in aged wild-type muscle fibers (Figs 1 and and2).2). Our findings suggest that MG29 may act as a modulator of SOCE in skeletal muscle and that the loss of MG29 in aged skeletal muscle could contribute to the disruption of Ca2+ homeostasis in aged skeletal muscle.

Fig. 5
Functional, but reduced store-operated Ca2+ entry (SOCE) response in skinned extensor digitorum longus muscle fibers from the mg29−/ − mice (gray trace) is observed after depletion of SR Ca2+ with 20 μm thapsigargin plus 30 mm ...

Discussion

In this study, we applied two complementary methodologies to reveal a significant reduction in SOCE activity in adult skeletal muscle fibers from aged mice. Further studies show that this reduced SOCE is not a result of change in the relative abundance of Orai transcripts or STIM1 protein. This reduction in SOCE activity during aging can be associated with a decrease in MG29 expression. Considering the similar results obtained in two separate model systems (i.e. intact FDB fibers and mechanically skinned muscle fibers) and recent findings of decreased SOCE in other cell types from aged animals (Papazafiri & Kletsas, 2003; Vanterpool et al., 2005; Fraysse et al., 2006), it is possible that defective SOCE is a common phenotype of age-related cellular dysfunction.

Interestingly, under our experimental conditions, both intact and skinned muscle fibers display relatively slow activation kinetics for SOCE, which is in good agreement with many previous reports in both skeletal muscle and other tissues (Vazquez et al. 1998; Kurebayashi & Ogawa, 2001; Papazafiri & Kletsas, 2003; Collet & Ma, 2004). In fact, slow SOCE activation kinetics is also in agreement with the recent identification of STIM1 and Orai as components of the SOCE machinery. STIM1 is an ER/SR Ca2+ sensor (Liou et al., 2005; Zhang et al., 2005) that translocates from the ER/SR membrane to regions close to the plasma membrane following depletion of the [Ca2+]i stores (Wu et al., 2006). This movement of STIM1 initiates activation of Orai, a pore-forming unit of SOCE at the plasma membrane (Prakriya et al., 2006; Vig et al., 2006), to gate [Ca2+]o entry (Mercer et al., 2006). It is conceivable that this activation mechanism underlies the slow activation kinetics of SOCE we observe both in skinned and intact muscle fibers. Because specific experimental conditions contribute to studies indicating rapid SOCE activation kinetics (Launikonis & Rios, 2007), to effectively evaluate SOCE function in intact and skinned fiber systems it is important to duplicate experimental conditions in the same species. The elegant studies of Launikonis and Rios were performed in rat muscle fibers. It is important to note that there are significant differences in the fiber composition and the E-C coupling properties of cardiac and skeletal muscles of mice and rats (Kolbeck & Nosek, 1994; Brooks & Conrad, 1999; Bruton et al., 2008). Thus, caution is required when comparing results from these two species as it is possible that SOCE properties may vary between these two species.

The graded activation of SOCE observed in skeletal muscle (Collet & Ma, 2004) likely has physiological relevance as entry of Ca2+ via SOCE must be tightly regulated to prevent muscle damage due to Ca2+ overload, since a rapid surge of Ca2+ into the muscle fiber could lead to muscle damage (Mikkelsen et al., 2004; Verburg et al., 2005; Yeung et al., 2005). In fact, Lamb et al. (1995) have previously demonstrated that high Ca2+ levels may cause uncoupling of the E-C coupling process. Therefore, Ca2+ entry must be a tightly regulated mechanism, suggesting that slow activation kinetics is a likely mechanism to regulate this Ca2+ entry process without the downside of Ca2+-induced damage. The characteristic mammalian doublet morphology of the T-tubular membrane observed under our experimental conditions (Fig. 2A) indicates the quality of our preparations and that Ca2+-induced damage did not occur under these conditions.

Our previous studies have shown that ablation of MG29 leads to dysfunctional SOCE in neonatal skeletal muscle (Pan et al., 2002). A separate study by Ogawa and coworkers with isolated EDL muscle bundles from adult mice suggested that SOCE is functional in the mg29−/− skeletal muscle (Kurebayashi et al., 2003). Here we confirm that SOCE is functional in mg29−/− muscle fibers (Fig. 5); however, we find the rate of SOCE in adult mg29−/− fibers was significantly reduced. It is likely that the apparent differences between our results and those obtained by Ogawa’s group are due to the specific experimental conditions used. The methodology used in the studies presented in Kurebayashi et al. (2003) could only resolve the summation of experimental manipulations on the SR Ca2+ store and, thus, could not resolve the kinetics of SOCE during the depletion process (Kurebayashi et al., 2003). Our experimental approach allows full control of the intracellular milieu, the Ca2+ uptake and release processes in individual muscle fibers, as well as providing the capability to resolve the spatial and temporal aspects of SOCE activation. In addition, our protocols favor the investigation of SOCE under steady-state conditions, which may also account for the kinetics profile observed here.

Our recent studies have revealed multiple pathways that are involved in SOCE activation in skeletal muscle, one that is dependent on conformational changes at RyR and the other that is independent of RyR (Zhao et al., 2006). To test whether both SOCE pathways are affected in aged muscle, we used a combination of thapsigargin and caffeine to activate both the RyR-dependent and RyR-independent SOCE pathways. Furthermore, muscle fibers were exposed to NiCl2 (Fig. 3B), which proved to be effective at reducing Ca2+ entry only in young muscle fibers. Together, these results suggest that both the RyR-dependent and RyR-independent components of SOCE are compromised in aged skeletal muscle.

Since both SOCE activation pathways are disrupted in aged skeletal muscle fibers, it is likely that the components upstream of the initial Ca2+ store depletion are affected in aged skeletal muscle. While we found Orai and STIM1 expression is not altered in aged skeletal muscle, it is possible that additional components of the SOCE machinery that remain to be resolved may be modified in aged muscle. One possibility is altered spatial localization of SOCE machinery in aged skeletal muscle. Our previous findings indicate a functional and physical segregation of the SR Ca2+ pool in aged muscle (Weisleder et al., 2006), suggesting that the physical interaction necessary for SOCE activation between STIM1 in the SR and Orai1 at the plasma membrane could be disrupted in aged skeletal muscle. In fact, we have recently observed that STIM1 immunostaining on soleus muscle display increased intracellular clustering of STIM1 protein (unpublished observations), suggesting that altered localization of STIM1 may play a role to the reduced SOCE activity associated with muscle aging.

In conclusion, our study provides the first evidence that SOCE is significantly compromised in aged skeletal muscle. We find that the expression of STIM1 and Orai1 mRNA, both known molecular components of SOCE, does not appear to be altered in aged skeletal muscle. However, we do find that reduced expression of MG29 may contribute to the decrease in SOCE in aged skeletal muscle. We propose that decreased SOCE would lead to chronic reduction in the SR Ca2+ stores and a decrease in the amount of releasable Ca2+ during contraction cycles in aged skeletal muscle. This dysfunction in Ca2+ homeostasis could ultimately contribute towards muscle weakness during aging, or act as an adaptive response to minimize contraction in aged muscles with limited capacity to resist mechanical force and recover from injury.

Experimental procedures

SOCE Measurement by Mn2+ entry

Preparation methods for FDB fibers has been described else-where (Wang et al., 2005). Briefly, individual FDB muscle fibers from C57Bl6/J wild-type male mice (Jackson Laboratories, Bar Harbor, ME, USA) were enzymatically disassociated by 2 mg mL−1 type I collagenase (Sigma, St. Louis, MO, USA) and plated onto ΔTC dish (Bioptechs Inc., Butler, PA, USA). Fibers were allowed to attach to the bottom of the dish and loaded with 10 μm Fura-2 AM (Molecular Probes, Eugene, OR, USA) at room temperature for 1 h. To prevent motion artifact in muscle fibers, 20 μm N-benzyl-p-toluene sulphonamide (Sigma), a specific myosin II inhibitor, was applied into the bathing solution 15 min prior to SR Ca2+ depletion. Muscle fibers were then examined on the inverted microscopy (×400 magnification, N.A. 1.3) of a PTI spectrofluorometer system (Photon Technology International, Monmouth Junction, NJ, USA). Fura-2 was excited at 360 nm, a wavelength insensitive to changes in [Ca2+]i, while emission at wavelength of 510 nm was recorded. To deplete SR Ca2+ store, FDB fibers were treated with 20 mm caffeine plus 5 μm ryanodine for 5 min to induce Ca2+ release. The perfusion solution was then switched to 0.5 mm Mn2+ for 5 min to observe the extent of Mn2+ entry and establish the rate of SOCE. For all measurements of SOCE by Mn2+ quenching the fluorescence signal was normalized using values determined by lysis of the cells with 1% Triton X-100 at the end of the experiment. All experiments were conducted at room temperature.

SOCE measurement in skinned mammalian muscle fibers

We have recently reported this methodology in mammalian skeletal muscle in detail (Zhao et al., 2005). These techniques were adapted from the methods of Launikonis et al. (2003), originally developed in frog skeletal muscles. Briefly, single intact muscle fibers are dissected from EDL muscle of young and aged wild-type C57Bl6/J mice or mg29−/− mice and cultured in Dulbecco’s modified Eagle’s medium supplied with 2% horse serum for 72 h. Muscle fibers were then mechanically skinned in the presence of 0.5 mm Rhod-5 N tripotassium salt (Molecular Probes) to trap the dye conjugated with 0.5 mm Ca2+ into transverse tubules (TT). Under these conditions, Rhod-5 N exerts the role of Ca2+ buffer (Kd ~ 90 μm) allowing the fiber to remain relaxed during the skinning (Launikonis et al., 2003; Zhao et al., 2005, 2006). Confocal microscopy using the inverted microscope (×600 magnification, N.A. 1.4) of a Bio-Radiance 2100 (Bio-Rad, Philadelphia, PA, USA) revealed the spatial and temporal distribution of Rhod-5 N inside the TTs. First, fibers are exposed to a solution that mimics intracellular conditions [90.6 mm K Glutamate, 18 mm Na Glutamate, 2 mm EGTA-KOH, 6.7 mm MgCl2, 5.4 mm ATP, 15 creatine phosphatase/CP, 0.5 CaCl2, 20 2-bromoethanesulfonate/BES-KOH, 2.5 μg/mL creatine kinase, 5 μm carbonylcya-p-(trifluoromethoxy) phenylhydrazone/FCCP, pCa 7.0, pH 7.1] that promote physiological loading of Ca2+ into the TT and the SR. Then fibers are exposed to a solution that triggers Ca2+ release from the SR, which subsequently activates SOCE [100 mm K Glutamate, 40 mm Na Glutamate, 10 mm EGTA-KOH, 10 mm 1,2-bis(o-aminophenoxy) ethane-N,N,N′,N′-tetraacetic acid/BAPTA, 0.35 mm MgCl2, 0.5 mm ATP, 1 mm CP, 20 mm BES-KOH, 5 μm FCCP, 20 μm TG and 30 mm caffeine, pH 7.1]. The composition of all solutions was calculated using a customized computer software program (Turbo-Pascal 87, version 3.0; Borland International, Scotts Valley, CA, USA) described elsewhere (Brotto et al., 2006). In the Ca2+ depletion solution, magnesium is lowered to 350 μm to facilitate Ca2+ release from the SR (Lamb & Stephenson, 1991; Launikonis & Stephenson, 2000). ATP concentration was reduced to 0.5 mm to limit the active uptake process of Ca2+ by the SERCA pump, thus favoring the Ca2+ release process, to ensure maximal depletion of the SR. Experiments were repeated multiple times and mean values of 10 regions of interest per fiber were analyzed. Rhod-5 N intensity was normalized to the maximal loading intensity, prior to the onset of SR Ca2+ depletion.

Real-time PCR analysis

The mRNA expression level of Orai1, Orai2, Orai3 and STIM1 was determined by real-time PCR in the C2C12 myogenic cell line and gastrocnemius muscle from C57Bl6/J mice. First, mRNA was extracted from C2C12 myotubes at 0, 6, 12 days of differentiation and gastrocnemeuis muscles of 3- or 26-month-old wild-type mice using a RNeasy mini kit (Qiagen, Valencia, CA, USA) and transcribed into cDNA by M-MLV Reverse Transcriptase (Promega, Madison, WI, USA). Real-time PCR was performed using the following primer set: (i) Orai1 (product size = 191): forward ‘ctgctgggtcaagttctta’, reverse ‘agtgaacagcaaagacgata’; (ii) Orai2 (product size = 159): forward ‘ctgaggtggtcctgctct’, reverse ‘ggtagaagtggatggtgaag’; (iii) Orai3 (product size = 320): forward ‘catccacaatctcaactctg’, reverse ‘atagaagcagaggatggtgt’; and (iv) STIM1 (product size = 199): forward ‘aagagtctaccgaagcagag’, reverse ‘gtgctatgtttcactgttgg’. The glyseraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as the internal control. GAPDH primer set is the following (product size = 189): forward ‘tatgtcgtggagtctactgg’, reverse ‘cattgctgacaatcttgagt’. Real-time PCR was performed using SYBR Green PCR supermix (Invitrogen, Carlsbad, CA, USA) on a Bio-Rad MyIQ 96-well PCR detection system. The quality of the PCRs was confirmed by detection of uniform melting curve peaks for each primer set. One hundred nanograms of cDNA was added per reaction and the final primer concentration was 200 nm. Experiments were run for multiple times and duplicate wells were included in each repetition. Relative Ct values were calculated as 2CtGAPDH−CtTarget and the value of Orai1 was set as 1.

Western blot analysis

Gastrocnemius muscle from C57Bl6/J mice at 3 months and 26 months of age were dissected and whole muscle extracts were generated by a hand-held motorized rotary homogonizer (Kontes, Vineland, NJ, USA) using a lysis buffer containing 150 mm NaCl, 1% Trition-X, 0.1% sodium dodecyl sulfate (SDS), 50 mm Tris-HCl (pH 8.0). Protein concentrations were determined by DC protein assay (Bio-Rad) and 10 μg per sample was separated by SDS–polyacrylamide gel electrophoresis at room temperature on 4–12% Tris-glycine gradient gels for 2 h at 60 mAmps on a Mini PROTEAN II gel system (Bio-Rad). Gels were loaded in parallel and one set was stained with Novex Colloidal Blue stain (Invitrogen), per manufacturer’s instructions. Other gels were used for Western blotting using standard techniques with a concentrated mouse monoclonal antibody against MG29, 2.8 μg mL−1 (customer purified by Harlan Bioproducts for Sciences, Indianapolis, IN, USA). Equivalent loading was confirmed using monoclonal β-actin antibody (Sigma), 0.2 μg mL−1. Results were visualized with an ECL + kit (GE Healthcare, Piscataway, NJ, USA) following the manufacturer’s directions.

Statistics

Values are mean ± SEM. Significance was determined by either Student’s t-test or analysis of variance followed by a Tukey’s post ad hoc test. A value of p < 0.05 was used as criterion for statistical significance.

Acknowledgments

This work was supported by National Institutes of Health grants to J.M., an American Heart Association (AHA) Scientist Development Grant to M.B. and an AHA postdoctoral fellowship to X.Z.

References

  • Barton-Davis ER, Shoturma DI, Musaro A, Rosenthal N, Sweeney HL. Viral mediated expression of insulin-like growth factor I blocks the aging-related loss of skeletal muscle function. Proc Natl Acad Sci USA. 1998;95:15603–15607. [PubMed]
  • Brooks WW, Conrad CH. Differences between mouse and rat myocardial contractile responsiveness to calcium. Comp Biochem Physiol A Mol Integr Physiol. 1999;124:139–147. [PubMed]
  • Brotto MAP, Nagaraj RY, Brotto LS, Takeshima H, Ma J, Nosek TM. Defective maintenance of intracellular Ca2+ homeostasis is linked to increased muscle fatigability in the MG29 null mice. Cell Res. 2004;14:373–378. [PubMed]
  • Brotto MA, Biesiadecki BJ, Brotto LS, Nosek TM, Jin J-P. Coupled expression of troponin T and troponin I isoforms in single skeletal muscle fibers correlates with contractility. Am J Physiol Cell Physiol. 2006;290:C567–C576. [PMC free article] [PubMed]
  • Brotto M, Weisleder N, Ma J. Store-operated Ca2+ entry in muscle physiology. Curr Chem Biol. 2007;1:87–95.
  • Brown L, Rodney G, Hernández-Ochoa E, Ward C, Schneider MF. Ca2+ sparks and T-tubule reorganization in dedifferentiating adult mouse skeletal muscle fibers. Am J Physiol Cell Physiol. 2006;292:C1156–C1166. [PMC free article] [PubMed]
  • Bruton JD, Place N, Yamada T, Silva JP, Andrade FH, Dahlstedt AJ, Zhang S-J, Katz A, Larsson N-G, Westerblad H. Reactive oxygen species and fatigue-induced prolonged low-frequency force depression in skeletal muscle fibres of rats, mice and SOD2 overexpressing mice. J Physiol. 2008;586:175–184. [PubMed]
  • Collet C, Ma J. Calcium-dependent facilitation and graded deactivation of store-operated calcium entry in fetal skeletal muscle. Biophys J. 2004;87:268–275. [PubMed]
  • Dangain J, Neering IR. Effect of low extracellular calcium and ryanodine on muscle contraction of the mouse during postnatal development. Can J Physiol Pharmacol. 1991;69:1294–1300. [PubMed]
  • Delbono O. Molecular mechanisms and therapeutics of the deficit in specific force in ageing skeletal muscle. Biogerontology. 2002;3:265–270. [PubMed]
  • Faulkner JA, Brooks SV, Zerba E. Muscle atrophy and weakness with aging: contraction-induced injury as an underlying mechanism. J Gerontol A Biol Sci Med Sci . 1995;50(Special No):124–129. [PubMed]
  • Feske S, Gwack Y, Prakriya M, Srikanth S, Puppel S-H, Tanasa B, Hogan PG, Lewis RS, Daly M, Rao A. A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function. Nature. 2006;441:179–185. [PubMed]
  • Fong PY, Turner PR, Denetclaw WF, Steinhardt RA. Increased activity of calcium leak channels in myotubes of Duchenne human and mdx mouse origin. Science. 1990;250:673–676. [PubMed]
  • Fraysse B, Desaphy JF, Rolland J-F, Pierno S, Liantonio A, Giannuzzi V, Camerino C, Didonna MP, Cocchi D, De Luca A, Camerino DC. Fiber type-related changes in rat skeletal muscle calcium homeostasis during aging and restoration by growth hormone. Neurobiol Dis. 2006;21:372–380. [PubMed]
  • Gonzalez E, Messi ML, Delbono O. The specific force of single intact extensor digitorum longus and soleus mouse muscle fibers declines with aging. J Membr Biol. 2000;178:175–183. [PubMed]
  • Hamrick MW, Ding KH, Pennington C, Chao Y, Wu Y, Howard B, Immel D, Borlongan C, McNeil P, Bollag W. Age-related loss of muscle mass and bone strength in mice is associated with a decline in physical activity and serum leptin. Bone. 2006;39:845–853. [PubMed]
  • Hemmings SJ. New methods for the isolation of skeletal muscle sarcolemma and sarcoplasmic reticulum allowing a comparison between the mammalian and amphibian β2-adrenergic receptors and calcium pumps. Cell Biochem Funct. 2001;19:133–141. [PubMed]
  • Huang GN, Zeng W, Kim JY, Yuan JP, Han L, Muallem S, Worley PF. STIM1 carboxyl-terminus activates native SOC, I(crac) and TRPC1 channels. Nat Cell Biol. 2006;8:1003–1010. [PubMed]
  • Kolbeck RC, Nosek TM. Fatigue of rapid and slow onset in isolated perfused rat and mouse diaphragms. J Appl Physiol. 1994;77:1991–1998. [PubMed]
  • Kurebayashi N, Ogawa Y. Depletion of Ca2+ in the sarcoplasmic reticulum stimulates Ca2+ entry into mouse skeletal muscle fibres. J Physiol. 2001;533:185–199. [PubMed]
  • Kurebayashi N, Takeshima H, Nishi M, Murayama T, Suzuki E, Ogawa Y. Changes in Ca2+ handling in adult MG29-deficient skeletal muscle. Biochem Biophys Res Commun. 2003;310:1266–1272. [PubMed]
  • Lamb GD, Stephenson DG. Effect of Mg2+ on the control of Ca2+ release in skeletal muscle fibres of the toad. J Physiol. 1991;434:507–528. [PubMed]
  • Lamb GD, Junankar PR, Stephenson DG. Raised intracellular [Ca2+] abolishes excitation-contraction coupling in skeletal muscle fibres of rat and toad. J Physiol. 1995;489:349–362. [PubMed]
  • Launikonis BS, Ríos E. Store-operated Ca2+ entry during intracellular Ca2+ release in mammalian skeletal muscle. J Physiol. 2007;583:81–97. [PubMed]
  • Launikonis BS, Stephenson DG. Effects of Mg2+ on Ca2+ release from sarcoplasmic reticulum of skeletal muscle fibres from yabby (crustacean) and rat. J Physiol. 2000;526(Part 2):299–12. [PubMed]
  • Launikonis BS, Barnes M, Stephenson DG. Identification of the coupling between skeletal muscle store-operated Ca2+ entry and the inositol trisphosphate receptor. Proc Natl Acad Sci USA. 2003;100:2941–2944. [PubMed]
  • Liou J, Kim ML, Heo WD, Jones JT, Myers JW, Ferrell JE, Jr, Meyer T. STIM is a Ca2+ sensor essential for Ca2+-store-depletion-triggered Ca2+ influx. Curr Biol. 2005;15:1235–1241. [PMC free article] [PubMed]
  • Louboutin JP, Fichter-Gagnepain V, Noireaud J. Comparison of contractile properties between developing and regenerating soleus muscle: influence of external calcium concentration upon the contractility. Muscle Nerve. 1995;18:1292–1299. [PubMed]
  • Luik RM, Wu MM, Buchanan J, Lewis RS. The elementary unit of store-operated Ca2+ entry: local activation of CRAC channels by STIM1 at ER-plasma membrane junctions. J Cell Biol. 2006;174:815–825. [PMC free article] [PubMed]
  • Mercer JC, Dehaven WI, Smyth JT, Wedel B, Boyles RR, Bird GS, Putney JW., Jr Large store-operated calcium selective currents due to co-expression of Orai1 or Orai2 with the intracellular calcium sensor, Stim1. J Biol Chem. 2006;281:24979–24990. [PMC free article] [PubMed]
  • Merritt JE, Jacob R, Hallam TJ. Use of manganese to discriminate between calcium influx and mobilization from internal stores in stimulated human neutrophils. J Biol Chem. 1989;264:1522–1527. [PubMed]
  • Mikkelsen UR, Fredsted A, Gissel H, Clausen T. Excitation-induced Ca2+ influx and muscle damage in the rat: loss of membrane integrity and impaired force recovery. J Physiol. 2004;559:271–285. [PubMed]
  • Moreland JD, Richardson JA, Goldsmith CH, Clase CM. Muscle weakness and falls in older adults: a systematic review and meta-analysis. J Am Geriatr Soc. 2004;52:1121–1129. [PubMed]
  • Nishi M, Komazaki S, Kurebayashi N, Ogawa Y, Noda T, Iino M, Takeshima H. Abnormal features in skeletal muscle from mice lacking mitsugumin29. J Cell Biol. 1999;147:1473–1480. [PMC free article] [PubMed]
  • Pagala MK, Ravindran K, Namba T, Grob D. Skeletal muscle fatigue and physical endurance of young and old mice. Muscle Nerve. 1998;21:1729–1739. [PubMed]
  • Pan Z, Yang D, Nagaraj RY, Nosek TA, Nishi M, Taesshima H, Cheng H, Ma J. Dysfunction of store-operated calcium channel in muscle cells lacking mg29. Nat Cell Biol. 2002;4:379–383. [PubMed]
  • Papazafiri P, Kletsas D. Developmental and age-related alterations of calcium homeostasis in human fibroblasts. Exp Gerontol. 2003;38:307–311. [PubMed]
  • Parekh AB, Putney JW., Jr Store-operated calcium channels. Physiol Rev. 2005;85:757–810. [PubMed]
  • Payne AM, Zheng Z, González E, Wang ZM, Messi ML, Delbono O. External Ca2+-dependent excitation – contraction coupling in a population of ageing mouse skeletal muscle fibres. J Physiol. 2004;560:137–155. [PubMed]
  • Prakriya M, Feske S, Gwack Y, Srikanth S, Rao A, Hogan PG. Orai1 is an essential pore subunit of the CRAC channel. Nature. 2006;443:230–233. [PubMed]
  • Rader EP, Faulkner JA. Recovery from contraction-induced injury is impaired in weight-bearing muscles of old male mice. J Appl Physiol. 2006;100(2):656–661. [PubMed]
  • Shin DW, Pan Z, Kim EK, Lee JM, Bhat MB, Parness J, Kim DH, Ma J. A retrograde signal from calsequestrin for the regulation of store-operated Ca2+ entry in skeletal muscle. J Biol Chem. 2003;278:3286–3292. [PubMed]
  • Vandebrouck C, Martin D, Colson-Van Schoor M, Debaix H, Gailly P. Involvement of TRPC in the abnormal calcium influx observed in dystrophic (mdx) mouse skeletal muscle fibers. J Cell Biol. 2002;158:1089–1096. [PMC free article] [PubMed]
  • Vanterpool CK, Pearce WJ, Buchholz JN. Advancing age alters rapid and spontaneous refilling of caffeine-sensitive calcium stores in sympathetic superior cervical ganglion cells. J Appl Physiol. 2005;99:963–971. [PMC free article] [PubMed]
  • Vazquez G, de Boland AR, Boland RL. 1α,25-Dihydroxy-vitamin-D3-induced store-operated Ca2+ influx in skeletal muscle cells. Modulation by phospholipase c, protein kinase c, and tyrosine kinases. J Biol Chem. 1998;273:33954–33960. [PubMed]
  • Verburg E, Murphy RM, Stephenson DG, Lamb GD. Disruption of excitation-contraction coupling and titin by endogenous Ca2+-activated proteases in toad muscle fibres. J Physiol. 2005;564:775–790. [PubMed]
  • Vig M, Beck A, Billingsley JM, Lis A, Parvez S, Peinelt C, Koomoa DL, Soboloff J, Gill DL, Fleig A, Kinet JP, Penner R. CRACM1 multimers form the ion-selective pore of the CRAC channel. Curr Biol. 2006;16:2073–2079. [PubMed]
  • Vig M, Peinelt C, Beck A, Koomoa DL, Rabah D, Koblan-Huberson M, Kraft S, Turner H, Fleig A, Penner R, Kinet JP. CRACM1 is a plasma membrane protein essential for store-operated Ca2+ entry. Science. 2006;312:1220–1223. [PubMed]
  • Wang X, Weisleder N, Collet C, Zhou J, Chu Y, Hirata Y, Zhao X, Pan Z, Brotto M, Cheng H, Ma J. Uncontrolled calcium sparks act as a dystrophic signal for mammalian skeletal muscle. Nat Cell Biol. 2005;7:525–530. [PubMed]
  • Weigl L, Zidar A, Gscheidlinger R, Karel A, Hohenegger M. Store operated Ca2+ influx by selective depletion of ryanodine sensitive Ca2+ pools in primary human skeletal muscle cells. Naunyn Schmiedebergs Arch Pharmacol. 2003;367:353–363. [PubMed]
  • Weisleder N, Brotto M, Brotto M, Komazaki S, Pan Z, Zhao X, Nosek T, Parness J, Takeshima H, Ma J. Muscle aging is associated with compromised Ca2+ spark signaling and segregated intracellular Ca2+ release. J Cell Biol. 2006;174:639–645. [PMC free article] [PubMed]
  • Wu MM, Buchanan J, Luik RM, Lewis RS. Ca2+ store depletion causes STIM1 to accumulate in ER regions closely associated with the plasma membrane. J Cell Biol. 2006;174:803–813. [PMC free article] [PubMed]
  • Yeung EW, Whitehead NP, Suchyna TM, Gottlieb PA, Sachs F, Allen DG. Effects of stretch-activated channel blockers on [Ca2+]i and muscle damage in the mdx mouse. J Physiol. 2005;562:367–380. [PubMed]
  • Zhang SL, Yu Y, Roos J, Kozak JA, Deerinck TJ, Ellisman MH, Stauderman KA, Cahalan MD. STIM1 is a Ca2+ sensor that activates CRAC channels and migrates from the Ca2+ store to the plasma membrane. Nature. 2005;437:902–905. [PMC free article] [PubMed]
  • Zhao X, Yoshida M, Brotto L, Takeshima H, Weisleder N, Hirata Y, Nosek TM, Ma J, Brotto M. Enhanced resistance to fatigue and altered calcium handling properties of sarcalumenin knockout mice. Physiol Genomics. 2005;23:72–78. [PubMed]
  • Zhao X, Weisleder N, Han X, Pan Z, Parness J, Brotto M, Ma J. Azumolene inhibits a component of store-operated calcium entry coupled to the skeletal muscle ryanodine receptor. J Biol Chem. 2006;281:33477–33486. [PubMed]