PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jdrHomeAboutSubmit a Manuscript
 
J Dent Res. 2010 February; 89(2): 165–169.
PMCID: PMC2989847
NIHMSID: NIHMS199889

The Amelogenin C-Terminus Is Required for Enamel Development

Abstract

The abundant amelogenin proteins are responsible for generating proper enamel thickness and structure, and most amelogenins include a conserved hydrophilic C-terminus. To evaluate the importance of the C-terminus, we generated transgenic mice that express an amelogenin lacking the C-terminal 13 amino acids (CTRNC). MicroCT analysis of TgCTRNC29 teeth (low transgene number) indicated that molar enamel density was similar to that of wild-type mice, but TgCTRNC18 molar enamel (high transgene number) was deficient, indicating that extra transgene copies were associated with a more severe phenotype. When amelogenin-null (KO) and TgCTRNC transgenic mice were mated, density and volume of molar enamel from TgCTRNCKO offspring were not different from those of KO mice, indicating that neither TgCTRNC18 nor TgCTRNC29 rescued enamel’s physical characteristics. Because transgenic full-length amelogenin partially rescues both density and volume of KO molar enamel, it was concluded that the amelogenin C-terminus is essential for proper enamel density, volume, and organization.

Keywords: amelogenin, enamel, transgenic mice

Introduction

Mature dental enamel is composed of at least 95% mineral by weight and is considered to be the hardest tissue in the body (Robinson and Kirkham, 1985). During tooth development prior to eruption into the oral cavity, ameloblast cells secrete an organic matrix that guides mineral formation, and the highly conserved amelogenin proteins constitute 90% of this secreted matrix (Termine et al., 1980; Delgado et al., 2007). Proteases are also secreted by ameloblasts, and these enzymes process the amelogenin and other less abundant enamel proteins as mineral crystals grow in size (Smith, 1998; Lu et al., 2008). By the time the tooth erupts into the oral cavity, the enamel protein content is reduced to less than 3%, and the ameloblast cells covering the enamel are finally lost (Robinson et al., 1995; Shibata et al., 1995). This process is strikingly different from that seen in bone, since biological repair or remodeling of enamel does not occur. In addition, enamel, an epithelial product, lacks collagen as a structural component of its organic matrix.

Because numerous individuals have been reported with the enamel defect amelogenesis imperfecta (AI) due to amelogenin (AMELX) gene mutations (Wright, 2006), it is accepted that amelogenins are required for enamel to develop normally. Mouse models with defective enamel have been generated with amelogenin null (KO) or knock-in mutations (Gibson et al., 2001; Zhu et al., 2006), or by over-expression of an amelogenin protein with a point mutation seen in several human AI kindreds (Collier et al., 1997; Ravassipour et al., 2000; Gibson et al., 2007). In addition, when KO females are mated with transgenic males that express a single 180-amino-acid amelogenin, partial restoration of molar enamel volume, thickness, density, and organization of the AI phenotype was observed in transgene-positive/KO offspring, indicating the importance of the most abundant 180-amino-acid amelogenin (Li et al., 2008).

Five AMELX mutations have been reported where a premature stop truncates the protein, and alters the C-terminus of the 180-amino-acid amelogenin (Lench and Winter, 1995; Kindelan et al., 2000; Greene et al., 2002; Hart et al., 2002; Sekiguchi et al., personal communication). This charged domain is completely conserved in mammalian species (Delgado et al., 2007) with characteristics of a mineral binding region (Aoba et al., 1987; Moradian-Oldak et al., 2002).

For better understanding of the importance of the C-terminus, we generated transgenic mice that directed ameloblasts to express amelogenin lacking the terminal 13 amino acids. The phenotype of the mice was evaluated, and we attempted rescue experiments to better understand the role of the C-terminus, by evaluating amelogenesis in its absence.

Materials & Methods

Vector Construction

To generate the C-terminal deletion, we subcloned a region of the previously used M180 expression vector (Gibson et al., 2007). A 5′ primer was designed to begin at the HindIII site (underlined), and an in-frame termination codon was added (in bold), removing 13 codons. The 3′ primer, which included a XhoI site (underlined) for cloning, was designed so that the polyadenylation signal would be included in the PCR product.

5′ primer: 5′GCAAGCTTAAAAGATCAGAAAATGAGAAGAG

3′ primer: 5′CCTCGAGATGCAGATTAGATCCCTGGGTT

Following PCR with these primers, the product was digested with HindIII and XhoI and inserted into the expression vector, replacing the wild-type sequence.

Transgenic Mice

All procedures were performed after approval by the University of Pennsylvania IACUC. Mice were generated at the UPenn Transgenic Core Facility, and maintained in an AAALAC-accredited facility. Founders and transgene-positive offspring were identified by PCR of tail DNA as described previously (Chen et al., 2003; Li et al., 2008). Dot blot analysis of transgene copy number in some strains was done as described previously (Gibson et al., 2007). Because the murine Amelx gene is solely on the X-chromosome, female Amelx null (KO) mice were mated with transgenic (TgCTRNC) males for molecular analysis and evaluation of phenotypic rescue in transgenic-positive male offspring with a KO background, e.g., TgCTRNCKO.

Molecular Analysis of Mice

For evaluation of transgenic RNA in teeth, transgenic males were mated with KO females. First mandibular molar and incisor teeth were dissected from 4-day-old male offspring that were PCR-positive for the transgene, or from 4-day-old WT mice, followed by semi-quantitative RT-PCR, as described previously, with 24 cycles (Li et al., 2008). These transgenic/KO pups have an Amelx-null background.

For transgenic protein in teeth from matings similar to those described above, protein extracts and Western blots were prepared and probed with an anti-rat polyclonal antibody (Gibson et al., 2001). Image J software (Rasband, 2008) was used for analysis of band intensity with images of RT-PCR gels and Western blots.

Microscopic Analysis of Teeth

Mandibles were fixed overnight in 4% paraformaldehyde, and light microscopic images were recorded. For histologic examination of ameloblasts and developing dental tissues, the mandibles were decalcified, embedded in paraffin, sectioned with identical orientation, stained with hematoxylin/eosin, and images were recorded. For immunohistochemistry, paraffin sections were incubated with anti-amelogenin antibody (Kamiya Biomedical Co., Seattle, WA, USA); negative controls lacked primary antibody.

Scanning electron micrographic analysis of tooth surfaces and fractured internal enamel and dentin surfaces of incisors and molars was completed at 20 kV (JEOL JSM T330A, JEOL, Inc., Peabody, MA, USA).

MicroCT

Scans for volume and density of enamel and dentin of molars and incisors were performed as described (Li et al., 2008), with a Skyscan portable x-ray microtomograph (MicroPho-tonics, Allentown, PA, USA). The images were processed by three-dimensional reconstruction software and analyzed for determination of enamel, dentin, and whole-tooth density and volume. Hydroxyapatite standards were used for instrument calibration.

Statistical Analysis

We used unpaired t tests and ANOVA with the Bonferroni post hoc test to detect differences (p < 0.05 was considered significant) between groups of teeth analyzed for enamel and dentin density and volume, as measured by microCT (GraphPad Software, San Diego, CA, USA). Groups that lacked a normal distribution due to phenotypic heterogeneity are indicated in Figs. and Tables.

Results

Generation and Molecular Analysis of Transgenic Mice

The transgenic expression vector was identical to that used previously to express the 180-amino-acid amelogenin in ameloblasts (Gibson et al., 2007), but with a deletion of the C-terminal 13 amino acids. Five independent transgenic mouse lines were generated that harbored the CTRNC transgene. Copy number for several strains was determined by dot blot: TgCTRNC2 had 2 copies, TgCTRNC18 had 28 copies, and TgCTRNC29 had 2 copies (not shown).

To detect transgene expression in developing teeth, we mated KO females with transgenic males to eliminate the background of multiple WT amelogenin proteins and RNAs in the male offspring. This is necessary, since there are at least 15 alternative splice products in WT mice (Hu et al., 1997; Bartlett et al., 2006; Li et al., 2006). Western blots of TgCTRNCKO molars from male offspring indicated that all mouse lines expressed TgCTRNC amelogenin (Fig. 1A). ImageJ analysis of 7 Western blots indicated that the TgCTRNC18 transgene was approximately 75% as active as the WT Amelx gene in het (heterozygous) female mice when the major M180 amelogenin band was analyzed; TgCTRNC29 and TgCTRNC2 mice expressed approximately 25% of that expressed by WT mice, as could be predicted by the transgene copy number.

Figure 1.
Western blot and RT-PCR of extracts of TgCTRNCKO and WT teeth. (A) Western blot showing transgene expression in molars from a TgCTRNC18KO male (lane 1), several bands in a het female (lane 3), and none in a KO male (lane 2), as expected. The Western blot ...

A higher transgene expression level was detected in TgCTRNCKO molars compared with incisors (Fig. 1B), as had previously been observed in all other strains examined thus far with this vector (Li et al., 2008). A light band of transgenic CTRNC protein could be detected in incisor extracts at long exposure times. Equal amounts of tooth RNA were converted to cDNA, amplified by PCR for 24 cycles, and analyzed by gel electrophoresis, which indicated an average molar/incisor ratio of 1.4/1 for WT and 1.9/1 for TgCTRNCKO for 4-day-old mice (Fig. 1C). The results were substantially unchanged when this experiment was repeated beginning with different mouse pups.

Therefore, by different methods involving protein and RNA analysis, more transgenic amelogenin was expressed in molars compared with incisors. This result allowed for the phenotypic examination of developing teeth with various amounts of transgenic amelogenin present, either in the presence (in transgenic mice with all WT amelogenins) or absence of the WT complement of proteins (in transgenic/KO mice).

Phenotype of Transgenic Teeth

The TgCTRNC18KO ameloblasts appear normal (Fig. 2A), and amelogenin protein is detected in the ameloblasts and the enamel layer of TgCTRNC18KO molars (Figs. 2B, ,2C),2C), indicating that the protein is secreted into the developing enamel matrix as expected.

Figure 2.
Histology and immunohistochemistry of 4-day-old TgCTRNC18KO teeth. (A) Histology of a section through a molar showing a phenotypically normal ameloblast layer. (B) Immunohistochemistry of TgCTRNC18KO molar with amelogenin localization in ameloblasts and ...

The mandibles of the TgCTRNC mice were analyzed grossly and by scanning electron microscopy, which revealed rough and pitted surfaces in TgCTRNC18 molars (Figs. 3E, ,3F)3F) compared with those of WT mice (Figs. 3B, ,3C),3C), while the transgenic incisors appeared similar to those of WT mice (Figs. 3A, ,3D).3D). TgCTRNC2 and 29 molars and incisors appeared similar to those of WT mice.

Figure 3.
Photographs, SEM, and microCT of TgCTRNC18 and WT teeth. Gross photographs of WT incisor (A), molars (B), and SEM of normal molar (C); photographs of TgCTRNC18 incisor (D), molars showing rough surfaces (E), and SEM showing rough surfaces (F). MicroCT ...

MicroCT analysis revealed that enamel density for molars was similar in WT mice for TgCTRNC29 and TgCTRNC2, both with 2 copies of the transgene (Fig. 3G). However, for TgCTRNC18 with many transgene copies, enamel density and volume of molars were reduced (Figs. 3G, ,3H).3H). Density and volume of molar and incisor dentin did not vary significantly (Appendix Table 1).

Amelogenin Lacking the C-Terminus is Unable to Rescue the KO Enamel Phenotype

Male offspring from mating KO females to transgenic males have KO genetic background and are either positive or negative for the transgene. These mice inherited the Y chromosome from the male parent, and thus have no normal X-chromosomal Amelx genes. Gross examination of molars and incisors indicated that TgCTRNC18KO molars and incisors (Appendix Figs. B, D) were worn and discolored, similar to those in KO mice (Appendix Figs. A, C). SEM analysis revealed that, compared with WT mice (Figs. 4A, ,4B),4B), molars (Fig. 4D) and incisors (Appendix Fig. F) of TgCTRNC18KO mice had disorganized aprismatic and hypoplastic enamel similar to that observed in KO mouse molars and incisors (Fig. 4C, Appendix Fig. E).

Figure 4.
SEM and microCT of teeth. SEM from fractured teeth: WT incisor (A), WT molar (B), KO molar (C), TgCTRNC18KO molar (D). Magnification bars = 10 µm; brackets on B, C, and D indicate the enamel thickness from the enamel surface to the dentin-enamel ...

By microCT analysis, significant rescue was not observed in enamel density or volume for either TgCTRNC2KO or TgCTRNC29KO (Figs. 4E, ,4F).4F). Incisors from TgCTRNC18KO mice presented with heterogeneity, since 2 mice had incisors with no measurable enamel, while 7 mice had incisors with a small amount. Both the KO and transgenic mice had mixed genetic backgrounds, which may have contributed to phenotypic heterogeneity. Densities for molar and incisor dentin for KO and transgenic mice were slightly increased compared with those in WT mice (Appendix Table 2).

The TgCTRNC18/het female mice with one active Amelx gene had no enamel, while the 2 TgCTRNC29/het females had enamel volume measurements by microCT intermediate between KO and TgCTRNC-positive mice with a WT background (not shown).

Discussion

In a study of 52 mammalian amelogenin genes, the C-terminal 10 amino acids encoded by exons 6 and 7 were identical (Delgado et al., 2007). The C-terminal deletion presented a dominant-negative phenotype in TgCT-RNC18 transgenic mice where all WT amelogenins were expressed, and the enamel defect was severe when high levels of transgenic protein were present. It is unlikely that the phenotype was due primarily to protein over-expression, since transgenic mice that express TRAP (tyrosine-rich amelogenin peptide), LRAP (leucine-rich amelogenin peptide), or M180 had minimal disruption in their enamel structure (Chen et al., 2003; Paine et al., 2004; Gibson et al., 2007).

TgCTRNC18 molars had decreased enamel thickness and abnormal enamel near the surface, but organization below the surface was similar to that in WT mice. Both density and volume were substantially affected when the amount of transgenic protein present was elevated, as in TgCTRNC18 molars.

MMP20, the enamelysin protease that processes enamel proteins during the secretory stage, begins processing by cleaving the C-terminus from the 180-amino-acid amelogenin (Simmer and Hu, 2002). Mice that lack MMP20 have enamel defects, and it is assumed that the amelogenin C-terminus is retained longer than appropriate in these mice (Caterina et al., 2002). Three human MMP20 mutations lead to the hypomaturation type of AI, where the enamel has retained excess organic material (Wright, 2006). We assumed therefore that the amelogenin C-terminus is required both to be present upon secretion and to be appropriately cleaved during the secretory stage of amelogenesis for enamel to develop normally.

By adsorption affinity and inhibition of crystal growth assays, full-length native and recombinant amelogenins bind mineral in vitro, and binding is dependent on the C-terminus (Aoba et al., 1987; Moradian-Oldak et al., 2002). The 180-amino-acid amelogenin also has regions that direct assembly in vitro into structures that have been termed “nanospheres”, which are approximately 20-nm spherical structures when analyzed by dynamic light-scattering, or atomic force or transmission electron microscopy (Fincham et al., 1995). The amelogenin C-terminus is required for normal nanosphere organization in vitro, since nanospheres that assembled from amelogenins lacking the C-terminus were larger than expected (Moradian-Oldak et al., 2002). In addition, nanospheres can form supramolecular structures in vitro, referred to as nanochains, and these assemblies are blocked when the C-terminus is not present (Moradian-Oldak and Goldberg, 2005). Although the protein complement of nanospheres in vivo is not clear, mineral formation is promoted in the in vitro-assembled nanospheres in a concentration-dependent manner (Wen et al., 2000).

KO mice, which express none of the amelogenin proteins, lack prismatic enamel structure and have only a thin enamel layer (Gibson et al., 2001). When TgM180 mice that express the most abundant 180-amino-acid amelogenin were mated with KO mice, enamel volume, thickness, and density, measured by microCT, improved significantly in transgene-positive male offspring, revealing partial phenotypic rescue (Li et al., 2008). However, when the TgCTRNC mice were mated with KO for a similar rescue experiment, no obvious rescue was observed. Because neither high- nor low-copy-number transgenic mice were able to rescue the KO phenotype of either molars or incisors, we find that the lack of the C-terminus is inconsistent with the development of a normal enamel layer, regardless of the amount of protein produced.

In conclusion, we describe a mouse model in which a single amelogenin, which is able to rescue the KO phenotype, loses that function with deletion of 13 amino acids at the C-terminus. Using this in vivo approach, we examined enamel development in the presence of the mutated transgene, both with and without the normal complement of amelogenin proteins, which revealed a dominant-negative effect. It will be interesting in future studies to evaluate nanosphere size in the transgenic and rescue mouse models, and the associated effect on crystal sizes and enamel rod development.

Supplementary Material

Supplemental Data:

Acknowledgments

We acknowledge the University of Pennsylvania Transgenic Core Facility for generation of the transgenic mice; the School of Dental Medicine vivarium personnel for excellent mouse husbandry; and P. Billings and J. Rosenbloom for the rat anti-amelogenin antibody. B6;SJL-Tg(AMELX*CT)29Gibs mice have been deposited with the MMRRC (MMRRC:016828).

Footnotes

This work was supported by grant DE011089 from the National Institute of Dental and Craniofacial Research, NIH, Bethesda, MD, USA.

A supplemental appendix to this article is published electronically only at http://jdr.sagepub.com/supplemental.

References

  • Aoba T, Fukae M, Tanabe T, Shimizu M, Moreno EC. (1987). Selective adsorption of porcine-amelogenins onto hydroxyapatite and their inhibitory activity on hydroxyapatite growth in supersaturated solutions. Calcif Tissue Int 41:281-289 [PubMed]
  • Bartlett JD, Ball RL, Kawai T, Tye CE, Tsuchiya M, Simmer JP. (2006). Origin, splicing, and expression of rodent amelogenin exon 8. J Dent Res 85:894-899 [PMC free article] [PubMed]
  • Caterina JJ, Skobe Z, Shi J, Ding Y, Simmer JP, Birkedal-Hansen H, et al. (2002). Enamelysin (matrix metalloproteinase 20)-deficient mice display an amelogenesis imperfecta phenotype. J Biol Chem 277:49598-49604 [PubMed]
  • Chen E, Yuan ZA, Wright JT, Hong SP, Li Y, Collier PM, et al. (2003). The small bovine amelogenin LRAP fails to rescue the amelogenin null phenotype. Calcif Tissue Int 73:487-495 [PubMed]
  • Collier PM, Sauk JJ, Rosenbloom J, Yuan ZA, Gibson CW. (1997). An amelogenin gene defect associated with human X-linked amelogenesis imperfecta. Arch Oral Biol 42:235-242 [PubMed]
  • Delgado S, Ishiyama M, Sire JY. (2007). Validation of amelogenesis imperfecta inferred from amelogenin evolution. J Dent Res 86:326-330 [PubMed]
  • Fincham AG, Moradian-Oldak J, Diekwisch TG, Lyaruu DM, Wright JT, Bringas P, Jr, et al. (1995). Evidence for amelogenin “nanospheres” as functional components of secretory-stage enamel matrix. J Struct Biol 115:50-59 [PubMed]
  • Gibson CW, Yuan ZA, Hall B, Longenecker G, Chen E, Thyagarajan T, et al. (2001). Amelogenin deficient mice display an amelogenesis imperfecta phenotype. J Biol Chem 276:31871-31875 [PubMed]
  • Gibson CW, Yuan ZA, Li Y, Daly B, Suggs C, Aragon MA, et al. (2007). Transgenic mice that express normal and mutated amelogenins. J Dent Res 86:331-335 [PubMed]
  • Greene SR, Yuan ZA, Wright JT, Amjad H, Abrams WR, Buchanan JA, et al. (2002). A new frameshift mutation encoding a truncated amelogenin leads to X-linked amelogenesis imperfecta. Arch Oral Biol 47:211-217 [PubMed]
  • Hart PS, Hart TC, Simmer JP, Wright JT. (2002). A nomenclature for X-linked amelogenesis imperfecta. Arch Oral Biol 47:255-260 [PubMed]
  • Hu CC, Ryu OH, Qian Q, Zhang CH, Simmer JP. (1997). Cloning, characterization and heterologous expression of exon-4-containing amelogenin mRNAs. J Dent Res 76:641-647 [PubMed]
  • Kindelan SA, Brook AH, Gangemi L, Lench N, Wong FS, Fearne J, et al. (2000). Detection of a novel mutation in X-linked amelogenesis imperfecta. J Dent Res 79:1978-1982 [PubMed]
  • Lench NJ, Winter GB. (1995). Characterization of molecular defects in X-linked amelogenesis imperfecta (AIH1). Hum Mutat 5:251-259 [PubMed]
  • Li Y, Yuan ZA, Aragon MA, Kulkarni AB, Gibson CW. (2006). Comparison of body weight and gene expression in amelogenin null and wild-type mice. Eur J Oral Sci 114(Suppl 1):190-193 [PubMed]
  • Li Y, Suggs C, Wright JT, Yuan ZA, Aragon M, Fong H, et al. (2008). Partial rescue of the amelogenin null dental enamel phenotype. J Biol Chem 283:15056-15062 [PubMed]
  • Lu Y, Papagerakis P, Yamakoshi Y, Hu JC, Bartlett JD, Simmer JP. (2008). Functions of KLK4 and MMP-20 in dental enamel formation. Biol Chem 389:695-700 [PMC free article] [PubMed]
  • Moradian-Oldak J, Goldberg M. (2005). Amelogenin supra-molecular assembly in vitro compared with the architecture of the forming enamel matrix. Cells Tissues Organs 181:202-218 [PubMed]
  • Moradian-Oldak J, Bouropoulos N, Wang L, Gharakhanian N. (2002). Analysis of self-assembly and apatite binding properties of amelogenin proteins lacking the hydroxyapatite C-terminal. Matrix Biol 21:197-205 [PubMed]
  • Paine ML, Zhu DH, Luo W, Snead ML. (2004). Overexpression of TRAP in the enamel matrix does not alter the enamel structural hierarchy. Cells Tissues Organs 176:7-16 [PubMed]
  • Rasband WS. (1997-2008). Image J., Bethesda, MD: US National Institutes of Health, http://rsb.info.nih.gov/ij/
  • Ravassipour DB, Hart PS, Hart TC, Ritter AV, Yamauchi M, Gibson C, et al. (2000). Unique enamel phenotype associated with amelogenin gene (AMELX) codon 41 point mutation. J Dent Res 79:1476-1481 [PubMed]
  • Robinson C, Kirkham J. (1985). The dynamics of amelogenesis as revealed by protein compositional studies. In: The chemistry and biology of mineralized tissues. Butler WT, editor. , editor. Birmingham, AL: Ebsco Media Inc, pp. 248-263
  • Robinson C, Kirkham J, Brookes SJ, Shore RC, editors. editors (1995). Chemistry of mature enamel: dental enamel formation to destruction. Boca Raton, FL: CRC Press, Inc., pp 167-191
  • Shibata S, Suzuki S, Tengan T, Yamashita Y. (1995). A histochemical study of apoptosis in the reduced ameloblasts of erupting mouse molars. Arch Oral Biol 40:677-680 [PubMed]
  • Simmer JP, Hu JCC. (2002). Expression, structure and function of enamel proteinases. Connect Tissue Res 43:441-449 [PubMed]
  • Smith CE. (1998). Cellular and chemical events during enamel maturation. Crit Rev Oral Biol Med 9:128-161 [PubMed]
  • Termine JD, Belcourt AB, Christner PJ, Conn KM, Nylen MU. (1980). Properties of dissociatively extracted fetal tooth matrix proteins. I. Principal molecular species in developing bovine enamel. J Biol Chem 255:9760-9768 [PubMed]
  • Wen HB, Moradian-Oldak J, Fincham AG. (2000). Dose-dependent modulation of octacalcium phosphate crystal habit by amelogenins. J Dent Res 79:1902-1906 [PubMed]
  • Wright JT. (2006). The molecular etiologies and associated phenotypes of amelogenesis imperfecta. Am J Med Genet A 140:2547-2555 [PMC free article] [PubMed]
  • Zhu D, Paine ML, Luo W, Bringas P, Jr, Snead ML. (2006). Altering biomineralization by protein design. J Biol Chem 281:21173-21182 [PubMed]

Articles from Journal of Dental Research are provided here courtesy of International and American Associations for Dental Research