PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

Logo of amjtrLink to Publisher's site
 

Table 2

Oligonucleotide primers and probes used for quantitative real-time PCR Analysis

GeneSense primerAnti-sense primer
GAPDHGACATGCCGCCTGGAGAACTCGGCCGCCTGCTT
ANXA2GACATTGCCTTCGCCTACCAACCAGACAAGGCCGACTTCA
TUBB5TCCGTTCGCTCAGGTCCTTCTGCCCCAGACTGACCAAAA
NDNGGACAGAGTCGCGCTGAACTCACATAGATGAGACTCAGGATCATGA
KIF2cGGAAGGTATTTGATCTGCTCAACAACAACCTGCACCTGCTGCTT
KIF22CCCAGAAATTAAGCCTCTTACAGAACCCAGCAAACGTTCCATACTC
CCNA2ACAGTATGCGGGCCATCCTAGCCAAATGCAGGGTCTCAT
INHBAGGCAGGAGGGCCGAAATCCTGACTCGGCAAAGGTGAT
E2F8ACTTTCCCCAAACCACAGGATCGACGCCACTGGGATCA