PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jbtJBT IndexAssociation Homepage
 
J Biomol Tech. 2010 December; 21(4): 163–166.
PMCID: PMC2977966

Automated DNA Extraction, Quantification, Dilution, and PCR Preparation for Genotyping by High-Resolution Melting

Abstract

Genotyping by high-resolution amplicon melting uses only two PCR primers per locus and a generic, saturating DNA dye that detects heteroduplexes as well as homoduplexes. Heterozygous genotypes have a characteristic melting curve shape and a broader width than homozygous genotypes, which are usually differentiated by their melting temperature (Tm). The H63D mutation, associated with hemochromatosis, is a single nucleotide polymorphism, which is impossible to genotype based on Tm, as the homozygous WT and mutant amplicons melt at the same temperature. To distinguish such homozygous variants, WT DNA can be added to controls and unknown samples to create artificial heterozygotes with all genotypes distinguished by quantitative heteroduplex analysis. By automating DNA extraction, quantification, and PCR preparation, a hands-off integrated solution for genotyping is possible. A custom Biomek® NX robot with an onboard spectrophotometer and custom programming was used to extract DNA from whole blood, dilute the DNA to appropriate concentrations, and add the sample DNA to preprepared PCR plates. Agencourt® Genfind™ v.2 chemistry was used for DNA extraction. PCR was performed on a plate thermocycler, high-resolution melting data collected on a LightScanner-96, followed by analysis and automatic genotyping using custom software. In a blinded study of 42 H63D samples, 41 of the 42 sample genotypes were concordant with dual hybridization probe genotyping. The incorrectly assigned genotype was a heterozygote that appeared to be a homozygous mutant as a result of a low sample DNA concentration. Automated DNA extraction from whole blood with quantification, dilution, and PCR preparation was demonstrated using quantitative heteroduplex analysis. Accuracy is critically dependent on DNA quantification.

Keywords: whole blood, genotyping

INTRODUCTION

High-resolution amplicon melting analysis is a simple, rapid, and inexpensive method to genotype mutations, as only standard oligonucleotide primers and a dsDNA binding dye are used for detection. The use of genotyping by amplicon melting has been demonstrated previously in single, duplex, and multiplex PCRs.14

As long as the base pair change creates melting temperature (Tm) shifts in the homozygous amplicons that are great enough, correct genotypes will be assigned. Certain base pair changes (e.g., C>G and A>T) do not create wide enough shifts in Tm for reliable genotyping.5 Single-base variants have been divided into four classes, according to the homoduplexes and heteroduplexes produced after amplification.5 C/T and G/A variants are designated Class I variants and constitute 66% of human single-base variants. C/A and G/T variants are Class II and constitute 18% of human single-base variants. As a G:C base pair is exchanged with an A:T base pair, the Tm difference between alternative homozygotes is relatively large at approximately 1.0°C in small amplicons and is usually easily genotyped. Class III (G/C) and Class IV (A/T) variants occur less frequently, making up the remaining 16% of human single-base variants. In Class III and IV variants, one base pair is inverted in alternative homozygotes, and the GC content does not change. In ¾ of Class III and IV variants, nearest-neighbor changes result in a Tm difference between alternative homozygotes of about 0.25°C in small amplicons and can still be typed by high-resolution amplicon melting. However, in the remaining ¼, the nearest-neighbor base pairs are the same, and the predicted Tm of the homozygous mutant and WT amplicons are identical. Therefore, 4% of human single-base variants may have homozygotes that are difficult or impossible to distinguish by Tm. However, these difficult base pair changes can be genotyped by adding WT DNA at a 1:6 ratio with an unknown sample DNA to create artificial heterozygotes that differentiate all genotypes.5

The human hemochromatosis protein (HFE) p.H63D small amplicon genotyping assay by quantitative heteroduplex analysis requires DNA extraction from whole blood, quantification of the extracted DNA, dilution to a known concentration, addition to the PCR reaction that includes added WT DNA, followed by PCR, and high-resolution amplicon melting analysis. Each step in this process can be automated. As a step toward complete hands-off automation of a generic genotyping process, the whole blood extraction, DNA quantification, dilution, and addition to PCR were achieved on a robotic platform, the Biomek® NX, using the Agencourt® Genfind™ v2 DNA purification reagents.

MATERIALS AND METHODS

Biomek® NX Laboratory Automation Workstation

A Biomek® NX Span-8 with gripper (Beckman Coulter, Indianapolis, IN, USA) included a sample presentation unit for sample tube presentation and tracking, Peltier-driven thermal control units (TCUs; Watlow, St. Louis, MO, USA), and a DTX-800 multimode detector (Beckman Coulter) to assess DNA concentrations by absorbance at λ = 260 nm. The TCUs were heated or cooled as necessary with adapters designed to hold reagent tubes as well as microplates.

Study Samples

Whole blood samples were submitted to ARUP (Salt Lake City, UT, USA) for H63D genotyping. Samples were genotyped using a conventional HybProbe® assay.6 A total of 48 samples was selected to enrich rare genotypes and included 32 WT, eight heterozygous mutants, and eight homozygous mutant samples, which were de-identified according to a global ARUP protocol (Institutional Review Board #7275), blinded, and analyzed by the H63D quantitative heteroduplex assay.

DNA Extraction

Whole blood extraction was performed using the Agencourt® Genfind™ v2 DNA purification system, which uses a solid-phase reversible immobilization paramagnetic bead-based technology. The extraction was performed by the manufacturer's specified protocol using the Biomek® NX robot. DNA concentrations were estimated by absorbance at 260 nm, assuming that an absorbance of 1.0 = 50 ng/μl using the onboard spectrophotometer. Samples meeting the concentration requirements were diluted to 10 ng/μl prior to adding to the PCR master mix. Samples with initial concentrations below 10 ng/μl were excluded and not diluted. Extracted DNA concentrations were also measured on a ND-8000 nanodrop spectrophotometer (Thermo Scientific, Waltham, MA, USA).

PCR

PCR was performed in 20 μl reaction volumes consisting of 20 ng genomic DNA, 3 mM MgCl2, 1× LightScanner master mix (Idaho Technology, Salt Lake City, UT, USA), 0.01 U/μl heat-labile uracil-DNA glycosylase (UNG; Roche Applied Science, Switzerland), and 0.1 μM forward (CCAGCTGTTCGTGTTCTATGAT) and reverse (CACACGGCGACTCTCAT) primers and generated a 40-base pair amplicon. In unknown and control samples, 2.9 ng WT genomic DNA was added to the reaction mix. Prior to extraction, the master mix was loaded into 96-well Hard-Shell® PCR plates (Bio-Rad, Hercules, CA, USA) and placed on a 4°C cold peltier in the Biomek® NX. After addition of the diluted sample DNA to the reaction mix, 40 μl mineral oil was overlaid, and an optically clear LightCycler 480 sealing foil (Roche Applied Science) was placed on the plate. All PCRs were performed on a DNA Engine PTC-200 (Bio-Rad). The cycling program started with a 10-min hold at 50°C for UNG clean-up, followed by a 2-min hold at 95°C for initial denaturation of the DNA. Thermal cycling was performed between 85°C and 63°C with 10-s holds at each temperature and a programmed heating rate of 3°C/s for 40 cycles. After denaturation at 95°C for 30 s, the reaction was cooled to 4°C on the cycler.

High-Resolution Melting Analysis

High-resolution melting curves were obtained with a LightScanner-96 instrument (Idaho Technology) by melting the samples at a transition rate of 0.1°C/s from 65°C to 85°C. Data were analyzed using custom melting analysis software.7 The melting curves were normalized using temperature ranges of 71–72°C and 82–83°C, followed by background fluorescence removal and curve overlay, which was performed by superimposing the high-temperature regions of the sample melting curves where only the most stable homoduplexes remain. Genotypes were assigned based on shape differences between curves. The samples with the greatest vertical distance from WT melting curves were heterozygotes, and melting curves between the heterozygous and WT samples were homozygotes.

RESULTS

Forty-eight whole blood samples were processed for automated DNA extraction, quantification, and PCR setup with genotyping by quantitative heteroduplex melting analysis. However, only 42 extracted samples had DNA concentrations above 10 ng/μl, varying from 15.2 to 98.1 ng/μl using the onboard spectrophotometer and 13.3 to 86 ng/μl on the ND-8000 spectrophotometer. Six samples had DNA concentrations below 10 ng/μl and could not be diluted by the BioMek® NX to a 10 ng/μl concentration. These samples had concentrations ranging from 1 to 4.3 ng/μl using the onboard spectrophotometer (1–7.3 ng/μl using the ND-8000) and were excluded from the blinded study after repeat failed extraction.

H63D genotyping results are shown in Fig. 1A as melting curves after normalization, exponential background subtraction, and curve overlay. The melting transitions for genotyping are spread over an 8°C temperature range. The H63D heterozygotes are most separated from the WT samples, and the homozygotes are found in between the WT and heterozygous genotypes.

FIGURE 1
Automated quantitative heteroduplex analysis for H63D genotyping. Melting curves of the three different H63D genotypes are shown, including WT (black), homozygous mutant (gray), and heterozygous (dotted). (A) All blinded study samples are shown. (B) The ...

Forty-one of the 42 blinded study samples were genotyped correctly. However, one H63D heterozygote was genotyped incorrectly as homozygous (Table 1). The melting profile of the incorrectly genotyped sample was identical to other observed homozygous genotypes (Fig. 1B). As the concentration of the diluted DNA is not checked routinely by the Biomek® NX, we determined the DNA concentrations of all samples after dilution on the ND-8000. With a programmed target of 10 ng/μl, the concentration varied from 9.1 to 11.1 ng/μl, except for one outlier at 5.9 ng/μl. This outlier was the sample that was genotyped incorrectly.

TABLE 1
H63D blinded study samples

DISCUSSION

Quantitative heteroduplex analysis can genotype any single-base variant with only two standard PCR primers, a generic dsDNA dye, and high-resolution melting analysis.8 Even when the base change results in no Tm difference between alternative homozygotes, addition of a known genotype before PCR segregates the final melting curves by genotype.5,9 However, the process requires several individual steps, including DNA extraction, quantification, dilution, PCR setup, amplification, melting, and analysis. Nevertheless, each step is potentially automatable.

A modified Biomek® NX robot with an onboard spectrophotometer was used for the DNA extraction, quantification, dilution, and mixing steps. The analytical target was the HFE H63D mutation involved in hereditary hemachromatosis. The H63D mutation is a Class III variant (C>G) with an inverted base pair difference that is nearest-neighbor symmetric, predicting no difference between WT and homozygous mutant Tm.5,9 However, WT and homozygous mutant genotypes can be differentiated by adding WT DNA at a 1:6 ratio to unknown samples before PCR. After PCR, different proportions of homoduplexes and heteroduplexes are produced, resulting in different melting curve shapes for each genotype.5,9 The automated extraction of whole blood to DNA with quantification and dilution to a set concentration and subsequent addition to the PCR master mix simplify this overall process.

The melting profiles for the H63D genotypes were accurately assigned except for one heterozygous genotype that was called a homozygous mutant. This sample had a low DNA concentration after dilution, most likely resulting from an error in the absorbance measurement or in the automated dilution. This error in sample DNA concentration changed the heteroduplex percentage after mixing with WT DNA and resulted in a melting curve shift interpreted as homozygous rather than heterozygous (Fig. 1B). Quantitative heteroduplex analysis depends on accurate DNA quantification of the reference DNA added to all samples and of each sample DNA.

Other than the dilution error on one sample, the Biomek® NX performed well within the scope of this project. The number of samples for the blinded study was 48, requiring three extraction runs of 16 samples each. The batch size was limited to 16 with the Agencourt® DNA extraction method, as the Biomek® NX reagent wells are 20 ml capacity, and each sample requires 1 ml wash buffer. To increase the batch size, the Biomek® NX could be programmed and retro-fitted to use different extraction methods that require lower reagent volumes.

The Biomek® NX with an intelligent onboard spectrophotometer automatically calls what samples meet the concentration requirements for PCR and melting analysis. The 96-well plates were preloaded with PCR master mix and kept at 4°C during the 2-h processing time. The reagents used included an antibody hot-start and a dye with good heterozygote differentiation.10 Automated DNA extraction, quantification, dilution, and PCR preparation simplify many of the steps required for quantitative heteroduplex analysis. By performing these steps on a robot, hands-on time is decreased, and sample tracking errors are reduced, enabling the stream-lined performance of a simple, generic genotyping method.

Footnotes

Financial disclosures: Aspects of high-resolution melting and rapid-cycle PCR are licensed by the University of Utah to Idaho Technology and from Idaho Technology to Roche Applied Science. One of the authors, Carl T. Wittwer, holds equity interest in Idaho Technology.

REFERENCES

1. Seipp MT, Durtschi JD, Voelkerding KV, Wittwer CT. Multiplex amplicon genotyping by high-resolution melting. J Biomol Tech 2009;20:160–164 [PMC free article] [PubMed]
2. Seipp MT, Pattison D, Durtschi JD, Jama M, Voelkerding KV, Wittwer CT. Quadruplex genotyping of F5, F2, and MTHFR variants in a single closed tube by high-resolution amplicon melting. Clin Chem 2008;54:108–115 [PubMed]
3. Seipp MT, Durtschi JD, Liew MA, et al. Unlabeled oligonucleotides as internal temperature controls for genotyping by amplicon melting. J Mol Diagn 2007;9:284–289 [PubMed]
4. Liew M, Seipp M, Durtschi J, et al. Closed-tube SNP genotyping without labeled probes/a comparison between unlabeled probe and amplicon melting. Am J Clin Pathol 2007;127:341–348 [PubMed]
5. Liew M, Pryor R, Palais R, et al. Genotyping of single-nucleotide polymorphisms by high-resolution melting of small amplicons. Clin Chem 2004;50:1156–1164 [PubMed]
6. Bernard PS, Ajioka RS, Kushner JP, Wittwer CT. Homogeneous multiplex genotyping of hemochromatosis mutations with fluorescent hybridization probes. Am J Pathol 1998;153:1055–1061 [PubMed]
7. Erali M, Palais R, Wittwer C. SNP genotyping by unlabeled probe melting analysis. Methods Mol Biol 2008;429:199–206 [PubMed]
8. Graham R, Liew M, Meadows C, Lyon E, Wittwer CT. Distinguishing different DNA heterozygotes by high-resolution melting. Clin Chem 2005;51:1295–1298 [PubMed]
9. Palais RA, Liew MA, Wittwer CT. Quantitative heteroduplex analysis for single nucleotide polymorphism genotyping. Anal Biochem 2005;346:167–175 [PubMed]
10. Farrar J, Reed G, Wittwer C. High resolution melting curve analysis for molecular diagnostics. In Patrinos G, Ansorge W, editors. (eds): Molecular Diagnostics, 2nd ed.London, UK: Elsevier, 2010:229–245

Articles from Journal of Biomolecular Techniques : JBT are provided here courtesy of The Association of Biomolecular Resource Facilities