PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of aemPermissionsJournals.ASM.orgJournalAEM ArticleJournal InfoAuthorsReviewers
 
Appl Environ Microbiol. 2010 November; 76(22): 7671.
PMCID: PMC2976175

Characterization of Protistan Assemblages in the Ross Sea, Antarctica, by Denaturing Gradient Gel Electrophoresis

Volume 70, no. 4, p. 2028-2037, 2004. Page 2030, Table 1: The sequence for primer 960FbGC (GC clamped) should be 5′ GCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCCGGCTTAATTTGACTCAAC 3′.


Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)