PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Dev Dyn. Author manuscript; available in PMC 2010 December 1.
Published in final edited form as:
PMCID: PMC2965029
NIHMSID: NIHMS236637

Robust Marking of Photoreceptor Cells and Pinealocytes with Several Reporters under Control of the Crx Gene

Abstract

Crx is a member of the Otx family of homeobox genes with expression restricted to vertebrate retinal photoreceptor and bipolar cells as well as the pinealocytes of the pineal organ. To facilitate the visualization of Crx-expressing cells, we generated transgenic mice expressing several reporters under the control of the Crx regulatory sequences present within a bacterial artificial chromosome (BAC). These mice expand the transgenic mouse collection, which uses photoreceptor regulatory elements for reporter gene expression by providing a broader repertoire of reporter genes. In addition, since Crx is expressed very soon after a cell fated to be a photoreceptor cell becomes postmitotic, they provide a means for early identification of immature photoreceptor cells.

Keywords: Crx, photoreceptors, retina, reporter, BAC transgenic

Introduction

Reporter lines that facilitate the histochemical and/or live detection of specific cell types are generally useful for studies of development and function. Photoreceptor cells are a critical cell type for vision and have been well studied by a variety of methods. Strains of mice that express reporter genes specifically in photoreceptors have been previously constructed. These include lines that employ the Rbp3 (IRBP) promoter to express β-galactosidase in rod and cone photoreceptors (Yokoyama et al., 1992), as well as the cGMP-phosphdiesterase beta (Ogueta et al., 2000), Rhodopsin Kinase (Young et al., 2003), and Qrx promoters (Wang et al., 2004). The promoters of the photopigment genes, namely Rhodopsin (Zack et al., 1991; Li et al., 2005) and Cone Opsins (Chiu and Nathans, 1994; Fei and Hughes, 2001) have been used to construct reporter strains for rod or cone photoreceptors, respectively. In addition, the Nrl promoter was recently used to drive GFP and thus mark rod photoreceptors, specifically (Akimoto et al., 2006). Many photoreceptor genes, including the photopigment genes, are not expressed in the early stages of differentiation of photoreceptors (Blackshaw et al., 2004), which is when Nrl-GFP (Akimoto et al., 2006) and Crx expression begins.

Crx is a member of the Otx family of homeobox genes (Chen et al., 1997; Furukawa et al., 1997; Plouhinec et al., 2003). Its expression is quite restricted, having been previously observed only in vertebrate retinal photoreceptor cells, retinal bipolar cells, and the pinealocytes of the pineal organ. Crx mutations in humans and mice have shown it to be necessary for the differentiation and function of rod and cone photoreceptors (Freund et al., 1997; Swain et al., 1997; Furukawa et al., 1999; Rivolta et al., 2001), as well as the regulation of melatonin synthetic enzymes of the pineal organ (Furukawa et al., 1999). We generated transgenic mice expressing several reporters under the control of the Crx regulatory sequences present within a bacterial artificial chromosome (BAC) encompassing the Crx locus. These mice allow for the identification of Crx-expressing cells using one of three reporter genes with unique properties for histochemical, immunochemical, or fluorescence detection studies.

Results

Reporter construct and transgenic mouse production

A 121 kilobase (Kb) BAC from Incyte Genetics was used to make two reporter constructs. Sequencing (see Materials and Methods) of the ends of the BAC showed that it contained 21 Kb 5’ of the start site of the Crx gene (Furukawa et al., 2002), and 86 Kb 3’ of the most often used retinal polyadenylation site (Furukawa et al., 2002; Hodges et al., 2002). One construct, CRXLacZAP, encodes nuclear β-galactosidase (nβGal), with its translation initiating at the Crx ATG, and includes human placental alkaline phosphatase (PLAP) under the control of an internal ribosomal entry site (IRES) from ECMV (encephalomyocarditis virus from rabbit). The other construct, CRXGFPAP, encodes green fluorescent protein (GFP), with its translation initiating at the Crx ATG, followed as well by IRES-PLAP (Figure 1). Both sets of bicistronic transgenes replaced exon 2 using homologous recombination (Muyrers et al., 1999; Lee et al., 2001). Purified BACs containing the targeting constructs were injected into the pronuclei of fertilized SJLBL/6 blastocysts and founders were obtained. One founder was obtained for CRXLacZAP and five for CRXGFPAP. Founders for both constructs were backcrossed to C57BL/6 animals for maintenance as lines.

FIGURE 1
Diagram of Crx reporter constructs. A BAC containing the Crx gene (Mm. 441911, chromosome 7, represented by the heavy black line, #7540000-7565000) was used for homologous recombination with the indicated reporter genes. Red boxes indicate homology arms ...

Expression of reporter transgenes in CRXLacZAP embryonic mice

To test for nβGal and PLAP activity in the CRXLacZAP line, embryos were harvested each day from E12.5-E16.5 and stained histochemically using a X-gal stain to detect nβGal activity and an AP stain to detect PLAP activity. All embryonic time points of the CRXLacZAP line exhibited X-gal and AP staining in the predicted pattern of cells fated to become photoreceptors. These cells are located at the scleral edge of the retina, the location of the future outer nuclear layer (ONL), where mature photoreceptor cell bodies will reside. Staining was robust, with visible precipitate appearing within one hour of staining. To compare endogenous Crx expression to that of the reporters, in situ hybridization for (RNA) Crx was performed on non-transgenic, wild-type (WT) animals and compared to X-gal and AP staining of transgenic animals. At the embryonic time points tested (E12.5, E13.5 and E15.5 only shown), nβGal and PLAP (2E, 2F, 2H & 2I) activity closely followed the expected in situ hybridization pattern of endogenous Crx RNA in the position of cells predicted to be newborn and maturing photoreceptor cells (2B & 2C). However, one unexpected aspect of the staining with the reporters was noted at E12.5 in that X-gal staining was observed surrounding the optic nerve head (ONH) (Figure 2D) and AP staining was present in the ONH (2G). Both of these staining patterns do not correspond to the predicted location of photoreceptor cells. Therefore, it was possible that this staining was a result of ectopic activity of the reporters, perhaps due to the use of a BAC transgenic. In situ hybridization for Crx was thus carried out on sections including the ONH (Figure 2A), and signal was indeed observed for Crx RNA in the area of the ONH, as shown by the reporters. The reporters thus faithfully recapitulated endogenous Crx expression and revealed a hitherto unrecognized expression in what is likely to be non-photoreceptor cells (see Discussion).

FIGURE 2
In situ hybridization for Crx mRNA and detection of nlacZ and PLAP activities in embryonic and early neonatal transgenic retinae. A-C: In situ hybridization for Crx performed on WT animals (A, B, C). Arrow in A indicates location of ONH. A is a sagittal ...

Expression of reporter transgenes in CRXLacZAP neonatal and adult mice

The expression of nβGal and PLAP in early postnatal animals was analyzed by both wholemount staining and section staining. At postnatal day 6 (P6), strong staining was present in the developing photoreceptor layer of the retina with visible precipitate appearing within an hour of staining (Figure 2J & 2K). Adult retinae and adult brain also were assayed for reporter expression. Expression of both nβGal and PLAP were robust in the retinae, with staining evident within an hour of addition of staining solution. X-gal staining of the adult transgenic retinae was strong in inner segments (IS), ONL, and the inner nuclear layer (INL), where the bipolar cell bodies are located (Figure 3A). Some weak X-gal staining was present in the ganglion cell layer, which could be ectopic staining of the transgene or reflect weak Crx expression in ganglion cells (see Discussion). AP histochemical staining followed the same pattern, with additional AP staining in the outer segments (OS) and in the inner plexiform layer (IPL) which is likely to be from bipolar processes (Figure 3B). However, out of the dozen retinae stained from the first two generations of this founder, two had a mosaic pattern: one adult, shown in Figure 3C-D, and one P6 pup (Figure 2L). The mosaic pattern was evident in both the photoreceptor layer and in the INL. More adult retinae, but not all, taken from later generations (generations six and eight) exhibited the mosaic pattern of X-gal and AP staining as described above. WT animals were negative for nβGal and PLAP activity when stained for these reporters (3E,F).

FIGURE 3
Detection of nlacZ and PLAP activities in CRXLacZAP transgenic adult retina. A: Section of retina stained for nlacZ. B: Section of retina stained for PLAP. C: Section of retina stained for PLAP with mosaic pattern. D: Magnification of PLAP stained retina ...

In adult transgenic brains of early generations, nβGal and PLAP expression was observed in the pineal gland, where Crx is known to be present (Furukawa et al., 1997), while staining was absent from non-transgenic animals (data not shown). However, brains taken from later generations of this line no longer stained for X-gal or AP in the pineal gland.

Expression of reporter transgenes in CRXGFPAP transgenic mice

Expression of GFP and PLAP were assayed in the CRXGFPAP transgenic line at embryonic and adult stages. GFP fluorescence could be observed in wholemount E13.5 embryos, both in the eye and in the developing tectum (Figure 4A & 4B). Confocal imaging of eye sections revealed that the majority of GFP-positive cells could be observed along the scleral edge of the retina where photoreceptors positive for Crx RNA are found (Figure 4C). Like Crx, expression of GFP in isolated cells was observed outside of this layer in the retina. Expression could also be observed in cells adjacent to the ONH, again recapitulating Crx expression. Expression of GFP in the retinal pigmented epithelium (RPE) was also observed, especially near the ONH where pigmentation was somewhat incomplete. Crx mRNA expression has not been observed in this tissue before, so whether this is ectopic expression of the transgene, visualization of weak Crx expression with the sensitive GFP, or some other phenomena, we cannot conclude at this time. A novel site of Crx expression was also observed in the tectum. Sections through the tectum revealed CrxGFPAP expression in a subset of cells in this tissue that closely resembled the endogenous expression of Crx RNA (Figure 4E & 4F). At this embryonic timepoint, the eye and tectum expression was easily visualized using GFP fluorescence. Immunofluoresence detection of GFP allowed for additional identification of a small number of sites of expression of the transgene that could not be seen with simple GFP fluorescence (data not shown). In the adult eye, strong expression of GFP could be observed in both wholemount preparations of the retina and in the ONL, IS and part of the INL on retinal sections (Figure 4G-I). For PLAP, expression overlapped with GFP with additional PLAP expression present in the OS (Figure 4J). In adult brain, PLAP was strongly expressed in the pineal gland and persisted in later generations (5A-B). No AP stain was detected in WT animals (5C-D).

FIGURE 4
Detection of GFP and PLAP. A: Whole-mount E13.5 CrxGFPAP transgenic embryo. White arrowhead marks GFP expression in the eye and white arrow marks GFP expression in the tectum. B: Higher magnification of the eye of the embryo in A. C,D,E: Confocal images ...

Discussion

Expression of Crx RNA can be observed at E12.5 in mouse cells that appear to be fated to be rod and cone photoreceptors. Its expression peaks at approximately P6 and is maintained at a lower level in adult photoreceptors. It is also expressed at relatively low level in bipolar cells (Liu et al., 2001). In other tissues, expression has been noted only in the pineal gland, which contains cells similar to photoreceptor cells (Li et al., 1998). The transgenic reporter strains reported here recapitulated all of these aspects of Crx expression. In early generations of the transgenic lines, expression was robust in all stages of photoreceptor development and in the pineal gland. However, in later generations, the pineal expression appears to have been lost in the CRXLacZAP line but persisted in the CRXGFPAP line. In bipolar cells, the expression in all generations is quite weak, but detectable, as is expression of endogenous Crx RNA. Two previously unappreciated domains of Crx expression were noted in these lines. Near and in the optic nerve there was heavier expression of the reporters than was previously detected by in situ hybridization for Crx. When in situ hybridizations were performed to scrutinize expression in this area, expression of endogenous Crx RNA could be seen. The more robust expression revealed by the reporters likely is due to the greater sensitivity of the reporter gene activity. Recently we have performed comprehensive RNA profiling of single cells from the developing retina (Trimarchi et al., 2008). One of these cells was a newborn ganglion cell, and it too expressed Crx, at a low level. It is thus possible that the cell type that expresses low levels of Crx near the ONH or the ganglion cell layer staining detected in Figure 3A are ganglion cells. Another strong possibility based on morphology and location is that the ONH cells are optic disc astrocyte precursor cells that have been described both morphologically and molecularly (Nornes et al., 1990; Petros et al., 2006). A novel expression pattern for Crx was also detected in the developing tectum from both the transgenic reporter and for endogenous Crx RNA.

The use of three different genes for reporter activity should make these strains useful for several applications. GFP is obviously useful for applications in which live visualization is desired, and it is also useful for double staining using other fluorescent reagents (e.g. to detect a protein epitope that might be expressed in photoreceptor cells). PLAP offers great sensitivity. In the course of creating many different types of reporters for use in viral vectors, we have found that PLAP is the most sensitive reporter (Fields-Berry et al., 1992). This may be due to the fact that the enzyme must be quite stable, withstanding heating to 65°C, which is done to reduce endogenous AP activity. This stability is likely why it continues to cleave substrates for more than one day in the histochemical reaction conditions. PLAP is a gpi-linked protein (Kam et al., 1985), which allows for labeling of the plasma membrane, revealing details such as the axonal endings of bipolar cells. It is also valuable if one wishes to examine, for example, the morphological transformations that photoreceptor cells undergo as they differentiate. The nβGal reporter is of use when one wishes to quantify cells, as nuclear stains facilitate counting, and for localization of photoreceptor cell bodies. It is also useful for co-localization studies, e.g. when one wishes to double stain the nucleus.

These lines also allow for the conclusion that the majority, or perhaps all, of the regulatory information for proper expression of Crx is localized to the BAC that was used here. The BAC contains 21Kb 5’ and 86 Kb 3’ of the Crx gene. Previously, it was shown that as little as 2 Kb 5’ of Crx , along with the first intron, could confer photoreceptor specificity (Furukawa et al., 2002). However, even up to 12 Kb 5’ of the Crx gene did not direct high level synthesis of βGal as was found with the BAC used here. The high level of expression afforded by the BAC enables detection of GFP, and thus prospective isolation of newborn or mature photoreceptors. This BAC also provides an opportunity to dissect the regulatory elements required for high level and specific expression in developing and mature photoreceptor cells.

These mice have been deposited at Jackson Labs and are available to all.

Experimental Procedures

Characterization of the BAC encoding Crx

A 121 Kb BAC from Incyte Genetics was characterized by sequencing of the ends, with the 5’ and 3’ ends designated as such relative to the 5’ and 3’ ends of the Crx gene.

5’ end on chr7:7,521,580-7,522,226:

  • AAGCTTACAAAACACCAAATAGATTGAACCAGGGAAGAAAACCTTCCTGCCA
  • CATAATAATCAAAGCATTAAATGTACCT
  • AAGAAGGAAAGAGTGTTGAAAGCTGCAATGGAGAAAAGCCAAGTAACATAT
  • AAATGCAGACCTATCAGAATTACACACAA
  • CTTTTCAACAGAGACTCTAAAAGCCAGAAGGGCCTGAGCAGTTATCTTGCA
  • GACACTAAGAGACCACAGATGTAAGCCCA
  • GACATCTATACCCAACAAAACTTGTAGCCAATATAGAGTGAAAACCAGGATA
  • TACCATTTAAAAAAATCAAATAAATTTA
  • AACCATATCTGTCCAAAAACCCAGTCCTATGGAAAATATGAGAATAAAAACTT
  • TAACTCAAGTAGGATAAGACACACAAG
  • AAAACACAGGAAATATATAAGTCAACACCAAGAAAACCAAGCAAAGGGAAAA
  • TGCAAACACACACACACTTAATATCATC
  • AAACTAACAGGAATTGATAATCATTGGTTATTAATATCGTTCAACATCAATGA
  • ACCTGATTCCCCAATGAAAAGACACAA
  • ACTAGCAGAATGGATACAAAAACAGGATCCACCATTCTGCTGCAATCNAGAA
  • AAATACCTAAACAGCAAAATACATTATT
  • ATCTCA

3' end on chr7:7,642,839-7,642,922:

  • GTAGATCAGGCTGGCCTTGAAGTAAGAAATCCACCTGCCTGTGCCTCCCAA
  • GTGCTGGGATTAAAGGCGTGCGCCANTAT
  • GCCCGGCGGTCTTTTCTTTTTGATATCATGTNTTGTGTATTTCATGATGCACT
  • TGAACAGAGGATAATCTTGACCTTNTG
  • GTCTTCTTGTCTCTACCTCCCTAGCTCTGAGCTTACAGATGTGCAATGGCAT
  • GCTGACTTTTATCCTGAGTTGGGGGCTA
  • GAACCTCAGGCTTCAAGCAGGCTAGGCAAGCACTCTACAAACCCAGCTATT
  • CCTCAACCTTACCCACACTGTTTCACGGA
  • GGAAANTGAGCCTCAGGAAGGCATCAGTAGCTTGCACGGGTTCATCGAGCT
  • GGAAAGCACTCCAG

Construction of the CRXLacZAP and CRXGFPAP targeting Vectors

For both the CRXLacZAP and CRXGFPAP targeting vectors, IRES-PLAP was excised from pLIA (Bao and Cepko, 1997) with NotI and SalI and cloned into NotI and SalI sites of pBluescriptIISK to create pBS-PLAP. The EcoRV site was reintroduced into pBS-PLAP with linkers into the SnaBI site of pBS-PLAP to facilitate cloning of the nlacZ PCR product. This construct was designated pBSPLAPΔ~ 5’ homology arms and cloning sites (sequences below) were added by PCR to both nuclear lacZ (nlacZ) and GFP genes and cloned upstream of IRES-PLAP in pBS-PLAP and pBS-PLAPΔ. For CRXLacZAP, the nlacZ PCR product was digested with NotI and EcoRV and inserted into the NotI and EcoRV sites of pBSPLAPΔ~ This construct was designated pBS-CRX(Z). For CRXGFPAP, the GFP PCR product was digested with NotI and SnaBI and inserted into the NotI and SnaBI site of pBS-PLAP to create pBS-CRX(G). For antibiotic selection, a FRT flanked kanamycin/neomycin cassette containing both 3’ homology arms and restriction sites for cloning were generated by PCR and cloned into the XhoI sites of both pBS-CRX(Z) and pBS-CRX(G). These final constructs, both containing NotI sites for excision of the targeting construct, were used for recombination and named pCRXLacZAP and pCRXGFPAP.

Recombination of CRXLacZAP and CRXGFPAP Targeting Constructs and Generation of CRXLacZAP and CRXGFPAP Transgenic Mice

pBS-CRXLacZAP and pBS-CRXGFPAP targeting cassettes were liberated with NotI from BluescriptIISK. DNA was gel purified and relevant fragments excised and extracted in preparation for recombination into the CRX BAC clone. Each targeting cassette was recombined into the BAC clone using an E-T homologous BAC recombination method (Muyrers et al., 1999), with the modification of Lee et al. (Lee et al., 2001). Several homologous recombined clones for each targeting construct were obtained and one was chosen for injection. Prior to injection, BAC clones for CRXLacZAP and CRXGFPAP were digested with NotI to liberate the BAC DNA from the backbone. Digested BAC DNA was run on a 0.6% gel for purification and then extracted by electrophoresis. DNA was then collected in a small volume of running buffer, precipitated and resuspended in a small volume for injection. CRXLacZAP and CRXGFPAP BAC DNA were then injected into the pronuclei of SJLBL/6 blastocysts and founders were obtained.

One founder was obtained for CRXLacZAP and was positive for the transgene by PCR and Southern blot. Thirty-six founders were born for CRXGFPAP and five were positive for the transgene by PCR and Southern blot. Out of the five founders, three produced offspring. Of the three, one was used for the analysis presented in this study.

Sequences of Oligos used for Genotyping and the CRX Homology Arms

5’ CRXLacZAP and CRXGFPAP homology arm targeted to the second exon:

  • CTGTTGGACACCCTGTTCTGCTTGTAGGTGCCCTCATCTGGGCCACAGTCT
  • CTGAAGATC (position 7548488-7548546 in Chromosome 7)

3’ CRX homology arm targeted to the second exon:

  • CTCAGAAGGTCTTAAAAAACAGACTGGAGGTGGAAAGGAGAACATACTTAC
  • TTGAGTATG (position 7548337-7548396 in Chromosome 7)

5’ Primer for Genotyping CRXLacZAP mice:

  • GGATCCCAAAGAAAACCTGA

3’ Primer for Genotyping CRXLacZAP mice:

  • CGGGCCTCTTCGCTATTACG

5’ Primer for Genotyping CRXGFPAP mice:

  • GGATCCCAAAGAAAACCTGAA

3’ Primer for Genotyping CRXGFPAP mice:

  • CTCGCCGGACACGCTGAACTTG

PCR for CRXLacZAP Conditions:

  • Step 1: 94 °C 2 minutes
  • Step 2: 94 °C 30 seconds
  • Step 3: 55 °C 30 seconds
  • Step 4: 72 °C 1 minute
  • Step 5: Step 2 34 more times
  • Step 6: 72 °C 5 minutes
  • Band size ~400bp

PCR for CRXGFPAP Conditions:

  • Step 1: 94 °C 2 minutes
  • Step 2: 94 °C 30 seconds
  • Step 3: 56.2 °C 30 seconds
  • Step 4: 72 °C 1 minute
  • Step 5: Step 2 34 more times
  • Step 6: 72 °C 5 minutes
  • Band size ~250bp

Processing and Staining of Tissue for nβGal and PLAP

Embryos were fixed for one hour in 4% paraformaldehyde (PFA), sectioned at 20 microns and processed for X-gal staining. For adult retinal tissue, most retinae were fixed in 4% PFA. For increased sensitivity of the X-gal and AP stain, some retinae were fixed in 0.5% glutaraldehyde (Panels A and B in Figure 3) ( http://genetics.med.harvard.edu/~cepko and (Ausubel et al., 1997)). Blue X-gal precipitate was noticeable after 15 minutes for retinal sections. For AP staining, embryos were treated and sectioned as above http://genetics.med.harvard.edu/~cepko and (Ausubel et al., 1997)).

Brains were removed from adult animals (older than P35) and flash frozen in cooled isopentane (-70 °C). Cryosections were collected at 20 microns and dried overnight before storage at –20 °C or staining. Staining for nβGal and PLAP was done as above and stained overnight. Tissues were then counterstained with Eosin.

Confocal Microscopy

Twenty micron transverse sections were generated by cryosectioning. Dapi was used to visualize nuclei and imaging was performed on a Leica SP2 inverted confocal microscope. 5.7 micron stacks were collected and average projections were generated with ImageJ (version 1.40g).

RNA in situ Hybridizations

Crx probes were generated using clone BE955622 and hybridizations were performed using methods previously detailed (Trimarchi et al., 1997).

FIGURE 5
Detection of PLAP in adult mouse brain. A: PLAP staining of a coronal section taken through the mouse brain at the level of the pineal gland (boxed area). B: Magnified view of pineal gland indicated in box of panel A. C: WT brain stained for PLAP. D: ...

Acknowledgements

We thank Sheldon Rowan for providing panels C and D in Figure 3, J.P. Antoine Grande for performing the in situ hybridizations in panels B and C in Figure 2, Andrew Abney for pronuclear injections and Amy Shaw for animal husbandry.

Grant Sponors and Grant Numbers National Institutes of Health - F32 EY018287-01 Howard Hughes Medical Institute

References

  • Akimoto M, Cheng H, Zhu D, Brzezinski JA, Khanna R, Filippova E, Oh EC, Jing Y, Linares JL, Brooks M, Zareparsi S, Mears AJ, Hero A, Glaser T, Swaroop A. Targeting of GFP to newborn rods by Nrl promoter and temporal expression profiling of flow-sorted photoreceptors. Proc Natl Acad Sci U S A. 2006;103:3890–3895. [PubMed]
  • Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. Current Protocols in Molecular Biology. Greene Publishing Associates; New York: 1997.
  • Bao ZZ, Cepko CL. The expression and function of Notch pathway genes in the developing rat eye. J Neurosci. 1997;17:1425–1434. [PubMed]
  • Blackshaw S, Harpavat S, Trimarchi J, Cai L, Huang H, Kuo WP, Weber G, Lee K, Fraioli RE, Cho SH, Yung R, Asch E, Ohno-Machado L, Wong WH, Cepko CL. Genomic analysis of mouse retinal development. PLoS Biol. 2004;2:E247. [PMC free article] [PubMed]
  • Chen S, Wang QL, Nie Z, Sun H, Lennon G, Copeland NG, Gilbert DJ, Jenkins NA, Zack DJ. Crx, a novel Otx-like paired-homeodomain protein, binds to and transactivates photoreceptor cell-specific genes. Neuron. 1997;19:1017–1030. [PubMed]
  • Chiu MI, Nathans J. A sequence upstream of the mouse blue visual pigment gene directs blue cone-specific transgene expression in mouse retinas. Vis Neurosci. 1994;11:773–780. [PubMed]
  • Fei Y, Hughes TE. Transgenic expression of the jellyfish green fluorescent protein in the cone photoreceptors of the mouse. Vis Neurosci. 2001;18:615–623. [PubMed]
  • Fields-Berry SC, Halliday AL, Cepko CL. A recombinant retrovirus encoding alkaline phosphatase confirms clonal boundary assignment in lineage analysis of murine retina. Proc Natl Acad Sci U S A. 1992;89:693–697. [PubMed]
  • Freund CL, Gregory-Evans CY, Furukawa T, Papaioannou M, Looser J, Ploder L, Bellingham J, Ng D, Herbrick JA, Duncan A, Scherer SW, Tsui LC, Loutradis-Anagnostou A, Jacobson SG, Cepko CL, Bhattacharya SS, McInnes RR. Cone-rod dystrophy due to mutations in a novel photoreceptor-specific homeobox gene (CRX) essential for maintenance of the photoreceptor. Cell. 1997;91:543–553. [PubMed]
  • Furukawa A, Koike C, Lippincott P, Cepko CL, Furukawa T. The mouse Crx 5'-upstream transgene sequence directs cell-specific and developmentally regulated expression in retinal photoreceptor cells. J Neurosci. 2002;22:1640–1647. [PubMed]
  • Furukawa T, Morrow EM, Cepko CL. Crx, a novel otx-like homeobox gene, shows photoreceptor-specific expression and regulates photoreceptor differentiation. Cell. 1997;91:531–541. [PubMed]
  • Furukawa T, Morrow EM, Li T, Davis FC, Cepko CL. Retinopathy and attenuated circadian entrainment in Crx-deficient mice. Nat Genet. 1999;23:466–470. [PubMed]
  • Hodges MD, Vieira H, Gregory-Evans K, Gregory-Evans CY. Characterization of the genomic and transcriptional structure of the CRX gene: substantial differences between human and mouse. Genomics. 2002;80:531–542. [PubMed]
  • Kam W, Clauser E, Kim YS, Kan YW, Rutter WJ. Cloning, sequencing, and chromosomal localization of human term placental alkaline phosphatase cDNA. Proc Natl Acad Sci U S A. 1985;82:8715–8719. [PubMed]
  • Lee EC, Yu D, Martinez de Velasco J, Tessarollo L, Swing DA, Court DL, Jenkins NA, Copeland NG. A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics. 2001;73:56–65. [PubMed]
  • Li S, Chen D, Sauve Y, McCandless J, Chen YJ, Chen CK. Rhodopsin-iCre transgenic mouse line for Cre-mediated rod-specific gene targeting. Genesis. 2005;41:73–80. [PubMed]
  • Li X, Chen S, Wang Q, Zack DJ, Snyder SH, Borjigin J. A pineal regulatory element (PIRE) mediates transactivation by the pineal/retina-specific transcription factor CRX. Proc Natl Acad Sci U S A. 1998;95:1876–1881. [PubMed]
  • Liu Y, Shen Y, Rest JS, Raymond PA, Zack DJ. Isolation and characterization of a zebrafish homologue of the cone rod homeobox gene. Invest Ophthalmol Vis Sci. 2001;42:481–487. [PubMed]
  • Muyrers JP, Zhang Y, Testa G, Stewart AF. Rapid modification of bacterial artificial chromosomes by ET- recombination. Nucleic Acids Res. 1999;27:1555–1557. [PMC free article] [PubMed]
  • Nornes HW, Dressler GR, Knapik EW, Deutsch U, Gruss P. Spatially and temporally restricted expression of Pax2 during murine neurogenesis. Development. 1990;109:797–809. [PubMed]
  • Ogueta SB, Di Polo A, Flannery JG, Yamashita CK, Farber DB. The human cGMP-PDE beta-subunit promoter region directs expression of the gene to mouse photoreceptors. Invest Ophthalmol Vis Sci. 2000;41:4059–4063. [PubMed]
  • Petros TJ, Williams SE, Mason CA. Temporal regulation of EphA4 in astroglia during murine retinal and optic nerve development. Molecular and Cellular Neuroscience. 2006;32:49–66. [PubMed]
  • Plouhinec JL, Sauka-Spengler T, Germot A, Le Mentec C, Cabana T, Harrison G, Pieau C, Sire JY, Veron G, Mazan S. The mammalian Crx genes are highly divergent representatives of the Otx5 gene family, a gnathostome orthology class of orthodenticle-related homeogenes involved in the differentiation of retinal photoreceptors and circadian entrainment. Mol Biol Evol. 2003;20:513–521. [PubMed]
  • Rivolta C, Berson EL, Dryja TP. Dominant Leber congenital amaurosis, cone-rod degeneration, and retinitis pigmentosa caused by mutant versions of the transcription factor CRX. Hum Mutat. 2001;18:488–498. [PubMed]
  • Swain PK, Chen S, Wang QL, Affatigato LM, Coats CL, Brady KD, Fishman GA, Jacobson SG, Swaroop A, Stone E, Sieving PA, Zack DJ. Mutations in the cone-rod homeobox gene are associated with the cone-rod dystrophy photoreceptor degeneration. Neuron. 1997;19:1329–1336. [PubMed]
  • Trimarchi JM, Stadler MB, Cepko CL. Individual retinal progenitor cells display extensive heterogeneity of gene expression. PLoS ONE. 2008;3:e1588. [PMC free article] [PubMed]
  • Trimarchi JM, Stadler MB, Roska B, Billings N, Sun B, Bartch B, Cepko CL. Molecular Heterogeneity of Developing Retinal Ganglion and Amacrine Cells Revealed through Single Cell Gene Expression Profiling. The Journal of Comparative Neurology. 1997;502:1047–1065. [PubMed]
  • Wang QL, Chen S, Esumi N, Swain PK, Haines HS, Peng G, Melia BM, McIntosh I, Heckenlively JR, Jacobson SG, Stone EM, Swaroop A, Zack DJ. QRX, a novel homeobox gene, modulates photoreceptor gene expression. Hum Mol Genet. 2004;13:1025–1040. [PubMed]
  • Yokoyama T, Liou GI, Caldwell RB, Overbeek PA. Photoreceptor-specific activity of the human interphotoreceptor retinoid-binding protein (IRBP) promoter in transgenic mice. Exp Eye Res. 1992;55:225–233. [PubMed]
  • Young JE, Vogt T, Gross KW, Khani SC. A short, highly active photoreceptor-specific enhancer/promoter region upstream of the human rhodopsin kinase gene. Invest Ophthalmol Vis Sci. 2003;44:4076–4085. [PubMed]
  • Zack DJ, Bennett J, Wang Y, Davenport C, Klaunberg B, Gearhart J, Nathans J. Unusual topography of bovine rhodopsin promoter-lacZ fusion gene expression in transgenic mouse retinas. Neuron. 1991;6:187–199. [PubMed]