PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jmolsigUbiquity Press HomepageVisit journalVisit journalAboutContentSubmit an article
 
J Mol Signal. 2010; 5: 17.
Published online 2010 September 27. doi:  10.1186/1750-2187-5-17
PMCID: PMC2954984

The adaptor protein SH2B1β reduces hydrogen peroxide-induced cell death in PC12 cells and hippocampal neurons

Abstract

Background

SH2B1β is a signaling adaptor protein that has been shown to promote neuronal differentiation in PC12 cells and is necessary for the survival of sympathetic neurons. However, the mechanism by which SH2B1β may influence cell survival is not known.

Results

In this study, we investigated the role of SH2B1β in oxidative stress-induced cell death. Our results suggest that overexpressing SH2B1β reduced H2O2-induced, caspase 3-dependent apoptosis in PC12 cells and hippocampal neurons. In response to H2O2, overexpressing SH2B1β enhanced PI3K (phosphatidylinositol 3-kinas)-AKT (protein kinase B) and MEK (MAPK/ERK kinase)-extracellular-signal regulated kinases 1 and 2 (ERK1/2) signaling pathways. We further demonstrated that SH2B1β was able to reduce H2O2-induced nuclear localization of FoxO1 and 3a transcription factors, which lie downstream of PI3K-AKT and MEK-ERK1/2 pathways. Moreover, overexpressing SH2B1β reduced the expression of Fas ligand (FasL), one of the target genes of FoxOs.

Conclusions

Overexpressing the adaptor protein SH2B1β enhanced H2O2-induced PI3K-AKT and MEK-ERK1/2 signaling, reduced nucleus-localized FoxOs and the expression of a pro-apoptotic gene, FasL.

Introduction

Oxidative stress resulting from overload of toxic reactive oxygen species (ROS) is common in the etiology of human diseases. It has been implicated in various neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, and Huntington's disease [1-4]. It also contributes to acute damage resulting from hypoxic-reperfusion conditions after trauma or stroke [5,6]. The accumulation of ROS, such as hydrogen peroxide (H2O2), leads to various forms of reversible and irreversible oxidative modification of proteins, lipids and DNA, accounting for cellular damage [7]. Depending on the extent of oxidative stress, it can induce proliferation, growth arrest, senescence, apoptosis (programmed cell death) or necrosis [8-11].

A number of signaling pathways are evolved to protect cells from ROS-induced damages, including phosphatidylinositol 3-kinase (PI3K)-AKT pathway, mitogen-activated protein kinases (MAPKs) pathways, and phospholipase Cγ (PLCγ) signaling [12-20]. PI3K-AKT pathway predominantly acts to promote cell survival. The three family members of MAPKs are identified as being sensitive to oxidative stress. They are extracellular-signal regulated kinase 1/2 (ERK1/2), c-Jun N-terminal kinase (JNK), and p38MAPK. Controversial reports implicating the influence of oxidative stress-induced MAPK activation on both cell survival and death are more complicated than one has anticipated [21-30]. In most cases, MEK-ERK1/2, similar to PI3K-AKT pathway, promotes cell survival in response to oxidative stress.

SH2B1 is a signaling adaptor protein that belongs to SH2B family, including SH2B1, SH2B2 (APS) and SH2B3 (Lnk) [31,32]. SH2B1 has been implicated in signaling pathways initiated by several receptor tyrosine kinases, including growth hormone, nerve growth factor (NGF), insulin, insulin-like growth factor 1, brain-derived neurotrophic factor, glial-derived neurotrophic factor, platelet-derived growth factor, and fibroblast growth factor 1 [31,33-41]. Four isoforms have been identified for SH2B1 --- α, β, γ and δ [33]. Previous studies demonstrate that SH2B1 plays an essential role in neuronal differentiation of PC12 cells, a well-established neuronal model [37,39,41,42]. SH2B1β also supports axonal growth of sympathetic neurons and is required for the survival of neonatal sympathetic neurons [37]. Moreover, SH2B1β acts as a positive mediator of NGF-mediated activation of AKT/Forkhead pathway by affecting the subcellular distribution of FoxO1 and 3a [43]. Forkhead transcription factors comprise more than 100 structurally related members that share a conserved forkhead domain (FKH) and a 100-residue DNA-binding domain. They have been named Fox (forkhead box) transcription factors [44]. Mammalian FoxO proteins (FoxO1, 3, 4 and 6) belong to O (other) class of the Fox superfamily. The nucleus-localized FoxOs are known to induce the expression of pro-apoptotic genes, such as FasL (Fas ligand) [45]. Therefore, inactivating FoxOs prevents their entry to the nucleus and triggering apoptosis. AKT is known to phosphorylate FoxOs and thus reduces their nuclear localization [46-49]. MAPKs have also been reported to phosphorylate FoxOs [50-52]. The fact that overexpressing SH2B1β shifts the steady-state distribution of FoxO1 in PC12 cells [43] raises a possibility that SH2B1β may affect cell survival through FoxO family members. To understand how SH2B1β may regulate cell survival/death, cells were challenged with oxidative stress and the effect of SH2B1β was examined. In this study, we investigated the role of SH2B1β in oxidative stress-induced cell death, signaling, FoxOs distribution and their target gene expression.

Results

Overexpressing SH2B1β reduces hydrogen peroxide-induced cell death in PC12 cells

To determine whether SH2B1β affects oxidative stress-induced cell death, PC12 cells stably expressing GFP (PC12-GFP cell line) or GFP-SH2B1β (PC12-SH2B1β cell line) were treated without (Figure 1A, B) or with (Figure 1C, D, E, F) H2O2. With increasing concentration of H2O2, both cell lines showed increased cell death. Notably, PC12-SH2B1β cells showed less cell death compared to PC12-GFP cells. To verify that H2O2 treatment effectively increased cellular oxidative stress, an oxidation indicator dye, dihydroethidine (DHE), was used to monitor cellular oxidation. As shown in Figure Figure1G,1G, oxidative stress was increased within 30 min of 100 μM H2O2 treatment. The elevated ROS was reduced afterwards, likely through cellular reduction, and remained higher than basal level for at least 3 h. This dosage of H2O2 also resulted in death of primary culture of hippocampal neurons (Additional file 1). The protective effect of overexpressing SH2B1β in H2O2-treated differentiated PC12 cells was also examined. H2O2 treatment induced retraction of neurites as well as death of differentiated PC12 cells. Similarly, differentiated PC12-SH2B1β cells showed less cell death compared to differentiated PC12-GFP cells. These results suggest that overexpressing SH2B1β reduces H2O2-induced cell death in both undifferentiated and differentiated PC12 cells (Figure (Figure2).2). To quantify cell viability, MTT assays were used to assess H2O2-induced cell death in PC12 cells. In all H2O2 concentrations tested, cell survival was higher in PC12-SH2B1β cells compared to PC12-GFP cells (Figure (Figure3).3). For instance, as most of PC12-GFP cells underwent dramatic cell death when treated with 100 μM H2O2 for 24 h, PC12-SH2B1β remained nearly 50% survival rate (Figure (Figure33).

Figure 1
Cell survival of H2O2-treated PC12-GFP and PC12-SH2B1β cells. PC12-GFP cells (A, C, E) and PC12-SH2B1β cells (B, D, F) were treated with 0 (A, B), 50 (C, D), or 100 (E, F) μM H2O2 for 24 h. Representative images of live cells were ...
Figure 2
H2O2 -induced cell death and neurite retraction in differentiated PC12-GFP and PC12-SH2B1β cells. PC12-GFP cells (A, C, E) and PC12-SH2B1β cells (B, D, F) were differentiated using 50 ng/ml NGF for 7 days. After overnight incubation in ...
Figure 3
Cell viability of PC12-GFP and PC12-SH2B1β cells treated with H2O2. PC12-GFP or PC12-SH2B1β cells were treated with the indicated concentrations of H2O2 for 24 h. Cell viability was measured by MTT assays as described in "Materials and ...

H2O2 induces caspase 3-dependent cell death in PC12 cells

Low level of oxidative stress has been suggested to lead to apoptosis while high level of oxidative stress leads to apoptosis and necrosis [8,9,53]. In the present study, relatively low concentrations of H2O2 were used to more closely reflect the physiological stress [8]. During early apoptosis, phospholipids phosphatidylserine (PS) from the inner leaflet is translocated to the outer leaflet of the plasma membrane allowing for Annexin V binding. Thus, detecting the relative amount of Annexin V binding was measured to determine whether H2O2 induces apoptosis in PC12 cells. The relative Annexin V binding was increased in response to H2O2 treatment suggesting that concentrations of H2O2 used in this study induced apoptosis (Additional file 2). The processes of apoptosis could be caspase-dependent or caspase-independent (e.g. necroptosis) [54-61]. To further determine whether H2O2 induces caspase 3-dependent apoptosis and whether overexpressing SH2B1β affects caspase 3 activity, PC12-GFP and PC12-SH2B1β cells were treated with H2O2 and the level of full length caspase 3 was determined via western blotting. In response to H2O2, full length caspase 3 was reduced, resulting from activation and cleavage of caspase 3 (Figure (Figure4A,4A, upper panel). The relative amount of full length caspase 3 was higher in PC12-SH2B1β cells compared to PC12-GFP cells. The population of active caspase 3-positive cells was also lower in PC12-SH2B1β cells than in PC12-GFP cells (Fig. (Fig.4A,4A, lower panel). Along this line, the relative amount of poly (ADP-ribose) polymerase (PARP), a substrate of caspase 3, was determined in PC12-GFP and PC12-SH2B1β cells to reflect the relative activity of caspase 3. The relative level of full length PARP was higher in PC12-SH2B1β cells compared to PC12-GFP cells and the reduction of full length PARP was more dramatic after 22 h of H2O2 challenge in PC12-GFP cells (Figure (Figure4B).4B). These data suggest that H2O2 induces caspase 3-dependent apoptosis in PC12 cells and overexpressing SH2B1β reduces the activity of caspase 3 and thus PARP cleavage. Similarly, the active caspase 3 was more prominent in hippocampal neurons overexpressing GFP than those overexpressing GFP-SH2B1β. In contrast, hippocampal neurons overexpressing the dominant negative mutant of SH2B1β, GFP-SH2B1β(R555E), were more susceptible to H2O2, leading to more caspase 3 cleavage compared to control cells (Additional file 3). Another phenotype of cells undergoing apoptosis is nuclear condensation. Hippocampal neurons subjected to H2O2 treatment showed obvious neurite retraction, beaded dendrites and condensation of the nucleus. As majority of neurons overexpressing GFP-SH2B1β showed intact nucleus, neurons that expressing GFP or GFP-SH2B1β(R555E) showed fragmented nucleus (Figure (Figure4C).4C). Together, these data demonstrate that SH2B1β reduces H2O2-induced caspase 3-dependent apoptosis in both PC12 cells and hippocampal neurons.

Figure 4
H2O2 induces caspase 3-dependent apoptosis in PC12-GFP and PC12-SH2B1β cells. PC12-GFP and PC12-SH2B1β cells were treated with 0, 100, 200, 300 μM H2O2 for 18 h. Equal amounts of proteins from the lysates were resolved with SDS-PAGE ...

Overexpressing SH2B1β enhances H2O2-induced phosphorylation of AKT and ERK1/2

To investigate the mechanisms by which SH2B1β protects cells from oxidative stress, the effect of overexpressing SH2B1β on H2O2-induced cellular signaling was examined. Figure Figure5A5A showed that GFP-SH2B1β was overexpressed in PC12-SH2B1β cells but not in PC12-GFP cells. In PC12-GFP cells, phosphorylation of AKT (pAKT) was induced in response to 50 μM H2O2. On the other hand, overexpressing SH2B1β significantly enhanced the levels of pAKT in response to 50 and 100 μM H2O2 and, as H2O2 concentration increased, pAKT decreased (Figure 5B, C). Overall, the levels of pAKT were higher in PC12-SH2B1β than in PC12-GFP cells. Different from pAKT signal, phosphorylation of ERK1/2 (pERK1/2) was induced by H2O2 concentration higher than 200 μM in PC12-GFP cells and 100 μM in PC12-SH2B1β cells. H2O2-induced pERK1/2 was much more enhanced in PC12-SH2B1β cells compared to PC12-GFP cells (Figure (Figure5D).5D). The quantified results are shown in Figure Figure5E.5E. Together, these results suggest that SH2B1β enhances H2O2-induced PI3K-AKT and MEK-ERK1/2 signaling.

Figure 5
SH2B1β enhances the phosphorylation levels of AKT, ERK1/2 and FoxOs. PC12-GFP and PC12-SH2B1β cells were incubated in serum-free medium overnight followed by H2O2 stimulation with the indicated concentrations for 10 min. Equal amounts ...

SH2B1β enhances phosphorylation of FoxOs, reduces their nuclear localization and target gene expression

FoxO transcription factors are known downstream effectors of AKT [46,51,62,63]. They have also been reported to be substrates of pERK1/2, p38MAPK and pJNK [23,50,64]. Since their subcellular distribution is controlled by phosphorylation, the downstream gene expression is likely affected by their phosphorylation status. As SH2B1β enhanced both pAKT and pERK1/2 levels, the phosphorylations of FoxO1 and 3a were examined. As in Figure Figure5F,5F, phosphorylated FoxO1 and 3a were slightly increased in response to 50 μM H2O2 and then decreased when treated with 100 μM H2O2 and above. The extents of FoxO1 and 3a phosphorylation were more prominent in PC12-SH2B1β cells than those in PC12-GFP cells.

To examine the effect of SH2B1β on the distribution of FoxOs, PC12-GFP and PC12-SH2B1β cells were treated with H2O2 and the localization of FoxO1 and 3a were determined via immunofluorescence staining. The percentage of cells with FoxO1 fluorescence intensity in the nucleus higher than that in the cytoplasm was quantified and compared between the two stable cell lines. As expected, H2O2 increased nuclear localization of FoxO1 in both cell lines. Overexpressing SH2B1β reduced nuclear localization of FoxO1 by 15% and 8% in response to 100 and 200 μM H2O2 respectively (Figure (Figure6A).6A). In contrast, SH2B1β reduced nuclear localization of FoxO3a by 6% and 16% in response to 100 and 200 μM H2O2 (Figure (Figure6B).6B). Because pAKT and pERK1/2 were induced by different concentration of H2O2, the contribution of these signaling pathways to FoxO distribution was determined through inhibitor assays. In PC12-GFP cells, H2O2-induced nuclear distribution of FoxO1 was increased in the presence of PI3K and MEK inhibitors (LY294002 and U0126 respectively), suggesting the involvement of pAKT and pERK1/2 in cellular distribution of FoxO1 (Figure 6C, E). In PC12-SH2B1β cells, inhibiting PI3K increased nuclear localization of FoxO1 when treated with 100 and 200 μM H2O2, while inhibiting MEK increased the nuclear localization of FoxO1 at 200 μM H2O2 (Figure 6D, F). The effect of PI3K inhibitor on FoxO1 localization in PC12-SH2B1β cells was much more significant than that in PC12-GFP cells suggesting that SH2B1β promotes the cytoplasmic distribution of FoxO1 largely through PI3K-AKT pathway.

Figure 6
SH2B1β reduces H2O2-induced nuclear distributions of FoxO1 and 3a. PC12-GFP and PC12-SH2B1β cells were incubated in serum-free medium overnight before 0, 100, or 200 μM H2O2 treatment for 10 min, without (A-B) or with 20 μM ...

For FoxO3a distribution, inhibiting PI3K increased its nuclear localization for both cell lines whereas inhibiting MEK increased its nuclear localization when treated with 200 μM H2O2 (Figure 6G, H, I, J). The effect of MEK inhibitor on the nuclear localization of FoxO3a was more prominent in PC12-SH2B1β cells than that in PC12-GFP cells suggesting that SH2B1β may increase pERK1/2 to regulate the distribution of FoxO3a in response to 200 μM H2O2. To determine whether SH2B1β regulates the transcriptional activity of FoxOs, the expressions of FasL were assessed via semi-quantitative real time polymerase chain reaction (Q-PCR). As in Figure Figure7A,7A, the expression of FasL was induced in response to H2O2 treatment and the induction was reduced when SH2B1β was overexpressed. Inhibiting PI3K using LY294002 significantly increased the expression of FasL for both cell lines in response to 100 μM H2O2 treatment (Figure 7B, C). The extent of increase was more pronounced in PC12-SH2B1β cells than in PC12-GFP cells. Inhibiting MEK using U0126 significantly increased the expression of FasL for both cell lines in response to 100 as well as 200 μM H2O2 stimulation (Figure 7D, E). Similarly, the increase of FasL expression was more in PC12-SH2B1β cells than that in PC12-GFP cells. These results suggest that overexpressing SH2B1β enhances H2O2-induced PI3K-AKT and MEK-ERK1/2 signaling, leading to reduced nuclear localization of FoxO3a, and thus the reduction of FasL expression. To examine the contribution of PI3K-AKT and MEK-ERK1/2 signaling to SH2B1β-mediated cell survival, MTT assays were performed. As in Figure Figure8,8, inhibiting PI3K or MEK reduced cell viability by 5-10% in PC12-GFP cells and by 10-15% in PC12-SH2B1β cells for each inhibitor. These results suggest that both PI3K-AKT and MEK-ERK1/2 signaling contributes to SH2B1β-mediated cell survival.

Figure 7
SH2B1β reduces H2O2-induced expression of FasL through PI3K-AKT and MEK-ERK1/2. PC12-GFP and PC12-SH2B1β cells were incubated in serum-free medium overnight, before H2O2 (0, 100, or 200 μM) treatment for 4 h without (A) or with ...
Figure 8
Activation of PI3K-AKT and MEK-ERK1/2 signaling pathways contributes to cell survival in response to H2O2. PC12-GFP or PC12-SH2B1β cells were pre-treated with PI3K inhibitor (LY294002), MEK inhibitor (U0126) or mock-treated 1 h before the addition ...

Taken together, results from this study suggest that the adaptor protein SH2B1β reduces H2O2-induced apoptosis in PC12 cells and hippocampal neurons. SH2B1β protects cells in part through enhancing H2O2-induced phosphorylation of AKT and ERK1/2, reducing the nuclear localization of FoxOs and thus reducing the expression of a pro-apoptotic gene, FasL. This is the first demonstration that the adaptor protein SH2B1β reduces H2O2-induced and caspase 3-dependent apoptosis.

Discussion

SH2B1 has been implicated in neuronal differentiation, cell growth, metabolism, obesity and diabetes [39,41,65-68]. Its ability to modulate cellular signaling confers its ability to regulate diverse functions. The only evidence so far that directly demonstrates its importance in cell survival is a study by Qian et al [67]. Injecting anti-SH2B1 antibody to sympathetic neurons leads to cell death suggesting that SH2B1 is required for neuronal survival [67]. However, it is not known how SH2B1 may influence live and death decision of cells. In the present study, we demonstrated that overexpressing SH2B1β reduced H2O2-induced cell death in PC12 cells and hippocampal neurons. In addition, overexpressing SH2B1β enhanced PI3K-AKT and MEK-ERK1/2 survival pathways in response to H2O2. Consistent with what Davila D et al have shown, phosphorylation of AKT was reduced as the concentration of H2O2 increased [22]. This reduction of pAKT may result from oxidation of plasma membrane and inactivation of surface receptors [69]. As oxidative stress increases, intracellular phosphatase, such as PP2A, is inhibited leading to the increase of pERK1/2 [21].

Overexpressing SH2B1β enhanced the phosphorylation of AKT and ERK1/2 which reduced the nuclear localization of FoxOs and FasL expression. Along this line, various reports also suggest the involvement of PI3K-AKT in promoting cell survival in hippocampal neurons [70-73] and our data suggest that SH2B1β-overexpressing neurons were not able to protect cells in the presence of PI3K inhibitor (data not shown). These results strongly implicate that SH2B1β protects neurons in part through PI3K-AKT pathway. In contrast, H2O2 slightly induced the expression of another FoxO-responsive gene --- MnSOD (Manganese Superoxide Dismutase) in PC12-GFP cells but the induction was much higher in PC12-SH2B1β cells (Additional file 4A). Furthermore, the expression of MnSOD was not significantly affected by either PI3K or MEK inhibitor (data not shown). Thus, SH2B1β may utilize PI3K-AKT- and MEK-ERK1/2-independent mechanisms to regulate the expression of MnSOD.

A report suggests that protein kinase D (PKD) triggers the activation of NFκB to increase MnSOD expression in response to oxidative stress [74]. However, we have not been able to detect H2O2-induced activation of NFκB. Accumulating evidence have demonstrated that the Janus tyrosine kinase (JAK)-Signal transduction and activators of transcription (STAT) signaling pathway plays an important role in the expression of stress-responsive genes as well as in cytoprotection in response to H2O2 [75,76]. A study also points to the involvement of STAT3 in MnSOD expression in response to hypoxia/reperfusion-induced injury and during liver regeneration [77,78]. Along the line, Stephanou et al. have shown that the JAK-STAT pathway participates in the modulation of expression of pro-survival Bcl2 proteins [79]. Interestingly, mRNA level of Bcl2 was found higher in PC12-SH2B1β cells compared to control cells (Additional file 4B). These findings suggest that SH2B1β may enhance the expression of survival genes through STAT3. The results from this study raise an intriguing possibility that the adaptor protein SH2B1β may utilize more than one mechanism to protect cells against stress and could act as a survival factor in general.

Materials and methods

Antibodies and reagents

MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) was purchased from USB Corporation (Cleveland, OH). Hydrogen peroxide (H2O2), U0126 and LY294002 were from Calbiochem (San Diego, CA). Polyclonal antibody to rat SH2B1β was raised against a glutathione S-transferase fusion protein containing amino acids 527-670 of SH2B1β as described previously [32]. Whole antiserum against ERK1/2 was purchased form Sigma (St. Louis, MO). Mouse monoclonal antibodies to phospho-ERK1/2, phospho-S473 of AKT, rabbit polyclonal antibodies against AKT, phospho-FoxO1 (Ser256), FoxO1, FoxO3a and PARP were from Cell Signaling (Danvers, MA). Rabbit polyclonal antibody against phospho-FoxO3a/FKHRL1 (Thr32) was from Upstate (Temecula, CA). Anti-βIII tubulin (TUJ1) antibody was from Covance (Princeton, NJ). NGF, rat-tail collagen I, and growth factor-reduced Matrigel were purchased from BD Bioscience (Bradford, MA). Protein Assay Kit was purchased form Strong Biotech Corporation, Taiwan.

Cell culture and microscopy

The stock of PC12 cells was purchased from American Type Culture Collection. PC12 cells were maintained on the collagen-coated plates (0.1 mg/ml) in complete media (DMEM supplemented with 10% heat-inactivated horse serum, 5% fetal bovine serum, 1 mM L-glutamine and 1 mM antibiotic-antimycotic). PC12 cells stably overexpressing GFP (PC12-GFP cells) or GFP-SH2B1β (PC12-SH2B1β cells) were made and cultured as described in Chen et al [65]. Pooled population was used to avoid clonal variation. The serum-free medium used was DMEM supplemented with 1% BSA, 1 mM L-glutamine and 1 mM antibiotic-antimycotic. For immunofluorescence staining, PC12-GFP and PC12-SH2B1β cells were treated with H2O2 for 10 min, then fixed, permeabilized and incubated with the indicated antibodies. Fluorescent images were taken using inverted Zeiss Axiover 135 fluorescence microscope (400× magnification). For anti-active caspase 3 staining, digital images were captured using upright Fluorescent Microscope Zeiss/Axioskop 2 mot plus. The fluorescent pixel spatial orientation and pixel intensity were measured by AxioVision 4.8 software. Signal of active caspase-3 fluorescence was localized mostly to cell nucleus and its fluorescent intensity in the nucleus was quantified using AxioVision 4.8.

MTT and inhibitor assays

Cells were plated at a density of 3 × 104 cells/well in the Matrigel-coated 96-well plates. After overnight incubation, cells were treated with freshly prepared H2O2. Cell viability was assayed by the reduction of MTT following the manufacture's instruction. Results are presented as percentage of the control using the absorbance of the control cells is 100%. For inhibitor assay, cells were pretreated with inhibitors (20 μM U0126 or 20 μM LY294002) for 1 h (for MTT assays) or 30 min prior to H2O2 treatment.

H2O2 treatment and immunoblotting

Cells were incubated in serum-free medium overnight before H2O2 treatment. Cells were lysed using lysis buffer (RIPA) containing freshly added 1 mM Na3VO4, 1 mM phenylmethanesulphonylfluoride (PMSF), 10 ng/ml aprotinin and 10 ng/ml leupeptin. Protein concentration of each sample was determined by protein assay kit. Samples with equal amount of proteins were resolved using 8% SDS-PAGE followed by Western blotting with specific primary antibodies. The immunoblots were detected using either IRDye 700- or IRDye 800CW-conjugated IgG and an Odyssey Infrared Imaging System (LI-COR Biosciences, Lincoln, NE) or horseradish peroxidase-conjugated IgG and the ECL (enhanced chemiluminescence) system. Western blots results were quantified using NIH Image J software.

Measurement of intracellular ROS levels

Dihydroethidium (DHE) was purchased from Invitrogen (Carlsband, CA), and used to measure the production of intracellular ROS. DHE shows a blue fluorescence in cell cytoplasm until oxidization to form red fluorescent-ethidium which is trapped in the nucleus by intercalating into DNA. ROS levels were analyzed in FACSCalibur flow cytometer (Becton Dickinson, CA). Fluorescence was detected by filter FL-3 (670 nm). Histograms of 10,000 events were analyzed and DHE fluorescence was evaluated by using the CellQuest software (Becton Dickinson).

Preparation of rat hippocampal neurons and transient transfection

Primary hippocampal neuron cultures were prepared from Sprague-Dawley rats as described previously [80,81]. Briefly, cells were dissociated from hippocampus dissected from embryonic day 18 (E18) rat embryos by treatment with papain (10 U/ml). Dissociated cells were washed and suspended in MEM supplemented with 5% horse serum and 5% fetal calf serum. Neurons were then plated onto coverslips coated with poly-L-lysine, and cultured in neurobasal medium with B27 (containing additional 0.025 mM glutamate) on DIV (day in vitro) 1. On DIV 3, the cells were treated with 5 μM cytosine 1-β-D-arabinofuranoside (ARC) for 1 day to inhibit the growth of glial cells. Medium was replaced by half of the fresh neurobasal/B27 medium on DIV4 and twice a week thereafter. GFP, GFP-SH2B1β or GFP-SH2B1β(R555E) was transfected to neurons on DIV3 using the CaCl2 transfection kits from Promega (Madison, WI). Two days after transfection, neurons were treated with H2O2 as indicated.

RNA preparation and semi-quantitative real-time PCR

TRIzol reagent was use to isolate total RNA form PC12 cells with or without treatment at the indicated time. Concentrations and A260/280 ratios of RNAs were measured using spectrophotometer (NanoDrop 1000, Themo). Total RNA of each sample was reverse transcribed into cDNA and the relative gene expressions of FasL and glyceraldehydes-3-phosphate dehydrogenase (GAPDH) were determined via semi-quantitative PCR (Q-PCR) assay using SYBR green master mix and the ABI7500 system. Primer sequences for each gene were designed using PrimerExpress software. Amplicons generated from each primer pair were between 50 to 100 bp. Loading of each sample was normalized with ROX dye. All readings were normalized to the expression of GAPDH. The forward primer for FasL is 5' CTGGTGGCTCTGGTTGGAAT3' and the reverse primer is 5' CTCACGGAGTTCTGCCAGTTC 3'. The forward primer for GAPDH is 5' ATGACTCTACCCACGGCAAGTT3' and the reverse primer is 5' TCCCATTCTCAGCCTTGACTGT 3'.

Statistical analysis

Data were expressed as mean ± S.E., and significant differences were analyzed by Student's t-test. The results are considered significant when P < 0.05.

Abbreviations

ERK: extracellular signal-regulated kinase; MAPK: mitogen-activated protein kinases; MnSOD: Manganese superoxide dismutase; MEK: MAPK/ERK kinase; PI3K: phosphatidylinositol 3-kinas; AKT: protein kinase B. FoxO: forkhead box O, forkhead members of the O class; PARP: poly (ADP-ribose) polymerase; FasL: Fas ligand.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

WCL performed signaling experiments, caspase 3 and PARP western blot analysis, immunofluorescence staining and quantification of FoxOs, and gene expression. CJC performed hippocampal neuron isolation, transient transfection, active caspase 3 staining and quantification, ROS detection, and Annexin V staining. HCH contributed to signaling experiments and MTT assays. HLH performed MTT assays. LC is the corresponding author that designed, coordinated all experiments, wrote the manuscript and formatted figures. All authors read and approved the final manuscript.

Supplementary Material

Additional file 1:

Hydrogen peroxide induces death of hippocampal neurons. Hippocampal neurons from E18 embryos were isolated as described in the Materials and Methods. Neurons were treated with the indicated concentrations of H2O2 for 18 h, then fixed for immunofluorescence staining using anti-βIII tubulin (neuronal tubulin) antibody (shown in green) and DAPI (shown in blue).

Additional file 2:

Overexpressing SH2B1β reduces H2O2-induced levels of Annexin V. PC12-GFP and PC12-SH2B1β cells were treated with 0, 100 or 200 μM H2O2 for 18 h. The levels of Annexin V were quantified through flow cytometry.

Additional file 3:

SH2B1β reduces and SH2B1β(R555E) increases H2O2-induced levels of active caspase 3 in hippocampal neurons. Hippocampal neurons from E18 embryos were transiently transfected with GFP, GFP-SH2B1β or GFP-SH2B1β(R555E) on DIV 3 and then treated with H2O2 on DIV 5 for 18 h. Cells were fixed and subjected to immunofluorescence staining using anti-active caspase 3 antibody (shown in red) and DAPI (shown in blue). Fluorescence intensity was quantified using AxioVision 4.8 (Zeiss) and shown in the bottom panel.

Additional file 4:

Overexpressing SH2B1β increases the gene expressions of MnSOD and Bcl2. PC12-GFP and PC12-SH2B1β cells were treated with 0, 100 or 200 μM H2O2 for 4 h. Total RNAs were extracted and subjected to Q-PCR analysis. (A) Primers for MnSOD: forward 5' ATTAACGCGCAGATCATGCAG 3'; reverse 5' TTTCAGATAGTCAGGTCTGACGTT 3'. (B) Primers for Bcl2: forward 5' TGGGATGCCTTTGTGGAACT 3'; reverse 5' CAGCCAGGAGAAATCAAACAGA 3'. Data were normalized to GAPDH and untreated PC12-GFP samples.

Acknowledgements

This study was supported by grants from the National Health Research Institute (NHRI-EX98-9719NC and NHRI-EX99-9719NC), the National Science Council (NSC97-2311-B-007-007-MY3), and the National Tsing Hua University (97N2504E1).

References

  • Barnham KJ, Masters CL, Bush AI. Neurodegenerative diseases and oxidative stress. Nat Rev Drug Discov. 2004;3(3):205–214. doi: 10.1038/nrd1330. [PubMed] [Cross Ref]
  • Everse J, Coates PW. Neurodegeneration and peroxidases. Neurobiol Aging. 2009;30(7):1011–1025. doi: 10.1016/j.neurobiolaging.2007.10.007. [PubMed] [Cross Ref]
  • Simonian NA, Coyle JT. Oxidative stress in neurodegenerative diseases. Annu Rev Pharmacol Toxicol. 1996;36:83–106. doi: 10.1146/annurev.pa.36.040196.000503. [PubMed] [Cross Ref]
  • Jenner P. Oxidative stress in Parkinson's disease. Ann Neurol. 2003;53(Suppl 3):S26–36. doi: 10.1002/ana.10483. discussion S36-28. [PubMed] [Cross Ref]
  • Chan PH. Reactive oxygen radicals in signaling and damage in the ischemic brain. J Cereb Blood Flow Metab. 2001;21(1):2–14. doi: 10.1097/00004647-200101000-00002. [PubMed] [Cross Ref]
  • Allen CL, Bayraktutan U. Oxidative stress and its role in the pathogenesis of ischaemic stroke. Int J Stroke. 2009;4(6):461–470. doi: 10.1111/j.1747-4949.2009.00387.x. [PubMed] [Cross Ref]
  • Giorgio M, Trinei M, Migliaccio E, Pelicci PG. Hydrogen peroxide: a metabolic by-product or a common mediator of ageing signals? Nat Rev Mol Cell Biol. 2007;8(9):722–728. doi: 10.1038/nrm2240. [PubMed] [Cross Ref]
  • Burdon RH, Alliangana D, Gill V. Hydrogen peroxide and the proliferation of BHK-21 cells. Free Radic Res. 1995;23(5):471–486. doi: 10.3109/10715769509065268. [PubMed] [Cross Ref]
  • Burdon RH, Gill V, Alliangana D. Hydrogen peroxide in relation to proliferation and apoptosis in BHK-21 hamster fibroblasts. Free Radic Res. 1996;24(2):81–93. doi: 10.3109/10715769609088004. [PubMed] [Cross Ref]
  • Davies KJ. The broad spectrum of responses to oxidants in proliferating cells: a new paradigm for oxidative stress. IUBMB Life. 1999;48(1):41–47. [PubMed]
  • Kim DK, Cho ES, Seong JK, Um HD. Adaptive concentrations of hydrogen peroxide suppress cell death by blocking the activation of SAPK/JNK pathway. J Cell Sci. 2001;114(Pt 23):4329–4334. [PubMed]
  • Madamanchi NR, Li S, Patterson C, Runge MS. Reactive oxygen species regulate heat-shock protein 70 via the JAK/STAT pathway. Arterioscler Thromb Vasc Biol. 2001;21(3):321–326. [PubMed]
  • Wang XT, McCullough KD, Wang XJ, Carpenter G, Holbrook NJ. Oxidative stress-induced phospholipase C-gamma 1 activation enhances cell survival. J Biol Chem. 2001;276(30):28364–28371. doi: 10.1074/jbc.M102693200. [PubMed] [Cross Ref]
  • Wang X, Martindale JL, Liu Y, Holbrook NJ. The cellular response to oxidative stress: influences of mitogen-activated protein kinase signalling pathways on cell survival. Biochem J. 1998;333(Pt 2):291–300. [PubMed]
  • Ryter SW, Kim HP, Hoetzel A, Park JW, Nakahira K, Wang X, Choi AM. Mechanisms of cell death in oxidative stress. Antioxid Redox Signal. 2007;9(1):49–89. doi: 10.1089/ars.2007.9.49. [PubMed] [Cross Ref]
  • Goldshmit Y, Erlich S, Pinkas-Kramarski R. Neuregulin rescues PC12-ErbB4 cells from cell death induced by H(2)O(2). Regulation of reactive oxygen species levels by phosphatidylinositol 3-kinase. J Biol Chem. 2001;276(49):46379–46385. doi: 10.1074/jbc.M105637200. [PubMed] [Cross Ref]
  • Yoshizumi M, Kogame T, Suzaki Y, Fujita Y, Kyaw M, Kirima K, Ishizawa K, Tsuchiya K, Kagami S, Tamaki T. Ebselen attenuates oxidative stress-induced apoptosis via the inhibition of the c-Jun N-terminal kinase and activator protein-1 signalling pathway in PC12 cells. Br J Pharmacol. 2002;136(7):1023–1032. doi: 10.1038/sj.bjp.0704808. [PMC free article] [PubMed] [Cross Ref]
  • Nair VD, Yuen T, Olanow CW, Sealfon SC. Early single cell bifurcation of pro- and antiapoptotic states during oxidative stress. J Biol Chem. 2004;279(26):27494–27501. doi: 10.1074/jbc.M312135200. [PubMed] [Cross Ref]
  • Sen P, Chakraborty PK, Raha S. Activation of p38MAPK by repetitive low-grade oxidative stress leads to pro-survival effects. Biochim Biophys Acta. 2007;1773(3):367–374. doi: 10.1016/j.bbamcr.2006.11.012. [PubMed] [Cross Ref]
  • Blanc A, Pandey NR, Srivastava AK. Synchronous activation of ERK 1/2, p38mapk and PKB/Akt signaling by H2O2 in vascular smooth muscle cells: potential involvement in vascular disease (review) Int J Mol Med. 2003;11(2):229–234. [PubMed]
  • Chen L, Liu L, Yin J, Luo Y, Huang S. Hydrogen peroxide-induced neuronal apoptosis is associated with inhibition of protein phosphatase 2A and 5, leading to activation of MAPK pathway. Int J Biochem Cell Biol. 2009;41(6):1284–1295. doi: 10.1016/j.biocel.2008.10.029. [PubMed] [Cross Ref]
  • Davila D, Torres-Aleman I. Neuronal death by oxidative stress involves activation of FOXO3 through a two-arm pathway that activates stress kinases and attenuates insulin-like growth factor I signaling. Mol Biol Cell. 2008;19(5):2014–2025. doi: 10.1091/mbc.E07-08-0811. [PMC free article] [PubMed] [Cross Ref]
  • Essers MA, Weijzen S, de Vries-Smits AM, Saarloos I, de Ruiter ND, Bos JL, Burgering BM. FOXO transcription factor activation by oxidative stress mediated by the small GTPase Ral and JNK. EMBO J. 2004;23(24):4802–4812. doi: 10.1038/sj.emboj.7600476. [PubMed] [Cross Ref]
  • Mehdi MZ, Azar ZM, Srivastava AK. Role of receptor and nonreceptor protein tyrosine kinases in H2O2-induced PKB and ERK1/2 signaling. Cell Biochem Biophys. 2007;47(1):1–10. [PubMed]
  • Ruffels J, Griffin M, Dickenson JM. Activation of ERK1/2, JNK and PKB by hydrogen peroxide in human SH-SY5Y neuroblastoma cells: role of ERK1/2 in H2O2-induced cell death. Eur J Pharmacol. 2004;483(2-3):163–173. doi: 10.1016/j.ejphar.2003.10.032. [PubMed] [Cross Ref]
  • Jiang H, Zhang L, Koubi D, Kuo J, Groc L, Rodriguez AI, Hunter TJ, Tang S, Lazarovici P, Gautam SC. et al. Roles of Ras-Erk in apoptosis of PC12 cells induced by trophic factor withdrawal or oxidative stress. J Mol Neurosci. 2005;25(2):133–140. doi: 10.1385/JMN:25:2:133. [PubMed] [Cross Ref]
  • Tuo QH, Wang C, Yan FX, Liao DF. MAPK pathway mediates the protective effects of onychin on oxidative stress-induced apoptosis in ECV304 endothelial cells. Life Sci. 2004;76(5):487–497. doi: 10.1016/j.lfs.2004.03.042. [PubMed] [Cross Ref]
  • Vauzour D, Vafeiadou K, Rice-Evans C, Williams RJ, Spencer JP. Activation of pro-survival Akt and ERK1/2 signalling pathways underlie the anti-apoptotic effects of flavanones in cortical neurons. J Neurochem. 2007;103(4):1355–1367. doi: 10.1111/j.1471-4159.2007.04841.x. [PubMed] [Cross Ref]
  • Cuda G, Paterno R, Ceravolo R, Candigliota M, Perrotti N, Perticone F, Faniello MC, Schepis F, Ruocco A, Mele E. et al. Protection of human endothelial cells from oxidative stress: role of Ras-ERK1/2 signaling. Circulation. 2002;105(8):968–974. doi: 10.1161/hc0802.104324. [PubMed] [Cross Ref]
  • Guyton KZ, Liu Y, Gorospe M, Xu Q, Holbrook NJ. Activation of mitogen-activated protein kinase by H2O2. Role in cell survival following oxidant injury. J Biol Chem. 1996;271(8):4138–4142. doi: 10.1074/jbc.271.8.4138. [PubMed] [Cross Ref]
  • Riedel H, Wang J, Hansen H, Yousaf N. PSM, an insulin-dependent, pro-rich, PH, SH2 domain containing partner of the insulin receptor. J Biochem. 1997;122(6):1105–1113. [PubMed]
  • Rui L, Mathews LS, Hotta K, Gustafson TA, Carter-Su C. Identification of SH2-Bβ as a substrate of the tyrosine kinase JAK2 involved in growth hormone signaling. Mol Cell Biol. 1997;17(11):6633–6644. [PMC free article] [PubMed]
  • Yousaf N, Deng Y, Kang Y, Riedel H. Four PSM/SH2-B alternative splice variants and their differential roles in mitogenesis. J Biol Chem. 2001;276(44):40940–40948. doi: 10.1074/jbc.M104191200. [PubMed] [Cross Ref]
  • Rui L, Carter-Su C. Platelet-derived growth factor (PDGF) stimulates the association of SH2-Bβ with PDGF receptor and phosphorylation of SH2-Bβ J Biol Chem. 1998;273(33):21239–21245. doi: 10.1074/jbc.273.33.21239. [PubMed] [Cross Ref]
  • Riedel H, Yousaf N, Zhao Y, Dai H, Deng Y, Wang J. PSM, a mediator of PDGF-BB-, IGF-I-, and insulin-stimulated mitogenesis. Oncogene. 2000;19:39–50. doi: 10.1038/sj.onc.1203253. [PubMed] [Cross Ref]
  • Wang J, Riedel H. Insulin-like growth factor-I receptor and insulin receptor association with a Src homology-2 domain-containing putative adapter. J Biol Chem. 1998;273(6):3136–3139. doi: 10.1074/jbc.273.6.3136. [PubMed] [Cross Ref]
  • Qian X, Riccio A, Zhang Y, Ginty DD. Identification and characterization of novel substrates of Trk receptors in developing neurons. Neuron. 1998;21(5):1017–1029. doi: 10.1016/S0896-6273(00)80620-0. [PubMed] [Cross Ref]
  • Kotani K, Wilden P, Pillay TS. SH2-Bα is an insulin-receptor adapter protein and substrate that interacts with the activation loop of the insulin-receptor kinase. Biochem J. 1998;335(Pt 1):103–109. [PubMed]
  • Lin WF, Chen CJ, Chang YJ, Chen SL, Chiu IM, Chen L. SH2B1beta enhances fibroblast growth factor 1 (FGF1)-induced neurite outgrowth through MEK-ERK1/2-STAT3-Egr1 pathway. Cell Signal. 2009;21(7):1060–1072. doi: 10.1016/j.cellsig.2009.02.009. [PubMed] [Cross Ref]
  • Kong M, Wang CS, Donoghue DJ. Interaction of fibroblast growth factor receptor 3 and the adapter protein SH2-B. A role in STAT5 activation. J Biol Chem. 2002;277(18):15962–15970. doi: 10.1074/jbc.M102777200. [PubMed] [Cross Ref]
  • Rui L, Herrington J, Carter-Su C. SH2-B is required for nerve growth factor-induced neuronal differentiation. J Biol Chem. 1999;274(15):10590–10594. doi: 10.1074/jbc.274.15.10590. [PubMed] [Cross Ref]
  • Donatello S, Fiorino A, Degl'Innocenti D, Alberti L, Miranda C, Gorla L, Bongarzone I, Rizzetti MG, Pierotti MA, Borrello MG. SH2B1beta adaptor is a key enhancer of RET tyrosine kinase signaling. Oncogene. 2007;26(45):6546–6559. doi: 10.1038/sj.onc.1210480. [PubMed] [Cross Ref]
  • Wang X, Chen L, Maures TJ, Herrington J, Carter-Su C. SH2-B is a positive regulator of nerve growth factor-mediated activation of the Akt/Forkhead pathway in PC12 cells. J Biol Chem. 2004;279(1):133–141. doi: 10.1074/jbc.M310040200. [PubMed] [Cross Ref]
  • de Melker AA, Desban N, Duband JL. Cellular localization and signaling activity of beta-catenin in migrating neural crest cells. Dev Dyn. 2004;230(4):708–726. doi: 10.1002/dvdy.20091. [PubMed] [Cross Ref]
  • Ciechomska I, Pyrzynska B, Kazmierczak P, Kaminska B. Inhibition of Akt kinase signalling and activation of Forkhead are indispensable for upregulation of FasL expression in apoptosis of glioma cells. Oncogene. 2003;22(48):7617–7627. doi: 10.1038/sj.onc.1207137. [PubMed] [Cross Ref]
  • Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson MJ, Arden KC, Blenis J, Greenberg ME. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell. 1999;96(6):857–868. doi: 10.1016/S0092-8674(00)80595-4. [PubMed] [Cross Ref]
  • Biggs III WH, Meisenhelder J, Hunter T, Cavenee WK, Arden KC. Protein kinase B/Akt-mediated phosphorylation promotes nuclear exclusion of the winged helix transcription factor FKHR1. Proc Natl Acad Sci USA. 1999;96(13):7421–7426. doi: 10.1073/pnas.96.13.7421. [PubMed] [Cross Ref]
  • Tang ED, Nunez G, Barr FG, Guan KL. Negative regulation of the forkhead transcription factor FKHR by Akt. J Biol Chem. 1999;274(24):16741–16746. doi: 10.1074/jbc.274.24.16741. [PubMed] [Cross Ref]
  • Gilley J, Coffer PJ, Ham J. FOXO transcription factors directly activate bim gene expression and promote apoptosis in sympathetic neurons. J Cell Biol. 2003;162(4):613–622. doi: 10.1083/jcb.200303026. [PMC free article] [PubMed] [Cross Ref]
  • Asada S, Daitoku H, Matsuzaki H, Saito T, Sudo T, Mukai H, Iwashita S, Kako K, Kishi T, Kasuya Y. et al. Mitogen-activated protein kinases, Erk and p38, phosphorylate and regulate Foxo1. Cell Signal. 2007;19(3):519–527. doi: 10.1016/j.cellsig.2006.08.015. [PubMed] [Cross Ref]
  • Huang H, Tindall DJ. Dynamic FoxO transcription factors. J Cell Sci. 2007;120(Pt 15):2479–2487. doi: 10.1242/jcs.001222. [PubMed] [Cross Ref]
  • Yang W, Dolloff NG, El-Deiry WS. ERK and MDM2 prey on FOXO3a. Nat Cell Biol. 2008;10(2):125–126. doi: 10.1038/ncb0208-125. [PubMed] [Cross Ref]
  • Fiers W, Beyaert R, Declercq W, Vandenabeele P. More than one way to die: apoptosis, necrosis and reactive oxygen damage. Oncogene. 1999;18(54):7719–7730. doi: 10.1038/sj.onc.1203249. [PubMed] [Cross Ref]
  • Degterev A, Boyce M, Yuan J. A decade of caspases. Oncogene. 2003;22(53):8543–8567. doi: 10.1038/sj.onc.1207107. [PubMed] [Cross Ref]
  • Degterev A, Yuan J. Expansion and evolution of cell death programmes. Nat Rev Mol Cell Biol. 2008;9(5):378–390. doi: 10.1038/nrm2393. [PubMed] [Cross Ref]
  • Yuan J, Lipinski M, Degterev A. Diversity in the mechanisms of neuronal cell death. Neuron. 2003;40(2):401–413. doi: 10.1016/S0896-6273(03)00601-9. [PubMed] [Cross Ref]
  • Rosenbaum DM, Degterev A, David J, Rosenbaum PS, Roth S, Grotta JC, Cuny GD, Yuan J, Savitz SI. Necroptosis, a novel form of caspase-independent cell death, contributes to neuronal damage in a retinal ischemia-reperfusion injury model. J Neurosci Res. pp. 1569–1576. [PubMed]
  • Kitanaka C, Kuchino Y. Caspase-independent programmed cell death with necrotic morphology. Cell Death Differ. 1999;6(6):508–515. doi: 10.1038/sj.cdd.4400526. [PubMed] [Cross Ref]
  • Kim R, Emi M, Tanabe K, Murakami S, Uchida Y, Arihiro K. Regulation and interplay of apoptotic and non-apoptotic cell death. J Pathol. 2006;208(3):319–326. doi: 10.1002/path.1885. [PubMed] [Cross Ref]
  • Stefanis L. Caspase-dependent and -independent neuronal death: two distinct pathways to neuronal injury. Neuroscientist. 2005;11(1):50–62. doi: 10.1177/1073858404271087. [PubMed] [Cross Ref]
  • Yakovlev AG, Faden AI. Caspase-dependent apoptotic pathways in CNS injury. Mol Neurobiol. 2001;24(1-3):131–144. doi: 10.1385/MN:24:1-3:131. [PubMed] [Cross Ref]
  • Huang H, Tindall DJ. FOXO factors: a matter of life and death. Future Oncol. 2006;2(1):83–89. doi: 10.2217/14796694.2.1.83. [PubMed] [Cross Ref]
  • Tang ED, Nunez G, Barr FG, Guan KL. Negative regulation of the forkhead transcription factor FKHR by Akt. J Biol Chem. 1999;274(24):16741–16746. doi: 10.1074/jbc.274.24.16741. [PubMed] [Cross Ref]
  • Barthelemy C, Henderson CE, Pettmann B. Foxo3a induces motoneuron death through the Fas pathway in cooperation with JNK. BMC Neurosci. 2004;5:48. doi: 10.1186/1471-2202-5-48. [PMC free article] [PubMed] [Cross Ref]
  • Chen L, Maures TJ, Jin H, Huo JS, Rabbani SA, Schwartz J, Carter-Su C. SH2B1beta (SH2-Bbeta) enhances expression of a subset of nerve growth factor-regulated genes important for neuronal differentiation including genes encoding urokinase plasminogen activator receptor and matrix metalloproteinase 3/10. Mol Endocrinol. 2008;22(2):454–476. doi: 10.1210/me.2007-0384. [PubMed] [Cross Ref]
  • Duan C, Yang H, White MF, Rui L. Disruption of SH2-B causes age-dependent insulin resistance and glucose intolerance. Mol Cell Biol. 2004;24(17):743507443. doi: 10.1128/MCB.24.17.7435-7443.2004. [PMC free article] [PubMed] [Cross Ref]
  • Qian X, Riccio A, Zhang Y, Ginty DD. Identification and characterization of novel substrates of Trk receptors in developing neurons. Neuron. 1998;21(5):1017–1029. doi: 10.1016/S0896-6273(00)80620-0. [PubMed] [Cross Ref]
  • Ren D, Li M, Duan C, Rui L. Identification of SH2-B as a key regulator of leptin sensitivity, energy balance and body weight in mice. Cell Metab. 2005;2 doi: 10.1016/j.cmet.2005.07.004. [PubMed] [Cross Ref]
  • Fatokun AA, Stone TW, Smith RA. Oxidative stress in neurodegeneration and available means of protection. Front Biosci. 2008;13:3288–3311. doi: 10.2741/2926. [PubMed] [Cross Ref]
  • Zheng WH, Kar S, Quirion R. Insulin-like growth factor-1-induced phosphorylation of transcription factor FKHRL1 is mediated by phosphatidylinositol 3-kinase/Akt kinase and role of this pathway in insulin-like growth factor-1-induced survival of cultured hippocampal neurons. Mol Pharmacol. 2002;62(2):225–233. doi: 10.1124/mol.62.2.225. [PubMed] [Cross Ref]
  • Jover-Mengual T, Miyawaki T, Latuszek A, Alborch E, Zukin RS, Etgen AM. Acute estradiol protects CA1 neurons from ischemia-induced apoptotic cell death via the PI3K/Akt pathway. Brain Res. pp. 1–12. [PMC free article] [PubMed] [Cross Ref]
  • Wine RN, McPherson CA, Harry GJ. IGF-1 and pAKT signaling promote hippocampal CA1 neuronal survival following injury to dentate granule cells. Neurotox Res. 2009;16(3):280–292. doi: 10.1007/s12640-009-9060-y. [PubMed] [Cross Ref]
  • Peltier J, O'Neill A, Schaffer DV. PI3K/Akt and CREB regulate adult neural hippocampal progenitor proliferation and differentiation. Dev Neurobiol. 2007;67(10):1348–1361. doi: 10.1002/dneu.20506. [PubMed] [Cross Ref]
  • Storz P, Doppler H, Toker A. Protein kinase D mediates mitochondrion-to-nucleus signaling and detoxification from mitochondrial reactive oxygen species. Mol Cell Biol. 2005;25(19):8520–8530. doi: 10.1128/MCB.25.19.8520-8530.2005. [PMC free article] [PubMed] [Cross Ref]
  • Imada K, Leonard WJ. The Jak-STAT pathway. Mol Immunol. 2000;37(1-2):1–11. doi: 10.1016/S0161-5890(00)00018-3. [PubMed] [Cross Ref]
  • Yu HM, Zhi JL, Cui Y, Tang EH, Sun SN, Feng JQ, Chen PX. Role of the JAK-STAT pathway in protection of hydrogen peroxide preconditioning against apoptosis induced by oxidative stress in PC12 cells. Apoptosis. 2006;11(6):931–941. doi: 10.1007/s10495-006-6578-9. [PubMed] [Cross Ref]
  • Negoro S, Kunisada K, Fujio Y, Funamoto M, Darville MI, Eizirik DL, Osugi T, Izumi M, Oshima Y, Nakaoka Y. et al. Activation of signal transducer and activator of transcription 3 protects cardiomyocytes from hypoxia/reoxygenation-induced oxidative stress through the upregulation of manganese superoxide dismutase. Circulation. 2001;104(9):979–981. doi: 10.1161/hc3401.095947. [PubMed] [Cross Ref]
  • Fujiyoshi M, Ozaki M. Molecular mechanisms of liver regeneration and protection for treatment of liver dysfunction and diseases. J Hepatobiliary Pancreat Sci. 2010. in press . [PubMed]
  • Stephanou A, Brar BK, Knight RA, Latchman DS. Opposing actions of STAT-1 and STAT-3 on the Bcl-2 and Bcl-x promoters. Cell Death Differ. 2000;7(3):329–330. doi: 10.1038/sj.cdd.4400656. [PubMed] [Cross Ref]
  • Roback JD, Large TH, Otten U, Wainer BH. Nerve growth factor expression in the developing hippocampus isolated in vitro. Dev Biol. 1990;137(2):451–455. doi: 10.1016/0012-1606(90)90270-S. [PubMed] [Cross Ref]
  • Brewer GJ. Isolation and culture of adult rat hippocampal neurons. J Neurosci Methods. 1997;71(2):143–155. doi: 10.1016/S0165-0270(96)00136-7. [PubMed] [Cross Ref]

Articles from Journal of Molecular Signaling are provided here courtesy of Ubiquity Press