PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC Mar 1, 2011.
Published in final edited form as:
PMCID: PMC2943400
NIHMSID: NIHMS233623
Cocaine-induced chromatin remodeling increases BDNF transcription in the rat medial prefrontal cortex, which alters the reinforcing efficacy of cocaine
G. Sadri-Vakili,1 V. Kumaresan,2 H.D. Schmidt,3 K.R. Famous,2 P. Chawla,2 F.M. Vassoler,3 R.P. Overland,1 E. Xia,1 C.E. Bass,4 E.F. Terwilliger,5 R.C. Pierce,3 and J.-H.J. Cha1
1 MassGeneral Institute for Neurodegenerative Disease, Massachusetts General Hospital and Harvard Medical School, Boston, MA, 02129-4404
2 Department of Pharmacology, Boston University School of Medicine, Boston, MA 02118
3 Center for Neurobiology and Behavior, Department of Psychiatry, University of Pennsylvania School of Medicine, Philadelphia, PA 19104
4Department of Pharmacology and Physiology, Wake Forest University School of Medicine, Winston Salem, NC 27157
5 Division of Experimental Medicine, Harvard Institutes of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, MA 02115
Corresponding author: Ghazaleh Sadri-Vakili, MassGeneral Institute for Neurodegenerative Disease, Massachusetts General Hospital, 114 16th Street, Charlestown, MA 02129-4404. Telephone: 001-617-724-1487, Fax: 001-617-724-1480, gsadrivakili/at/partners.org
Cocaine self-administration alters patterns of gene expression in the brain that may underlie cocaine-induced neuronal plasticity. In the present study, male Sprague-Dawley rats were allowed to self-administer cocaine (0.25 µg/infusion) two hours per day for fourteen days followed by seven days of forced abstinence. Compared to yoked saline control rats, cocaine self-administration resulted in increased brain-derived neurotrophic factor (BDNF) protein levels in the rat medial prefrontal cortex (mPFC). In order to examine the functional relevance of this finding, cocaine self-administration maintained under a progressive ratio (PR) schedule of reinforcement was assessed following shRNA-induced suppression of BDNF expression in the mPFC. Decreased mPFC BDNF expression in the mPFC increased the cocaine self-administration break point. Next, the effect of cocaine self-administration on specific BDNF exons was assessed; results revealed selectively increased BDNF exon IV-containing transcripts in the mPFC. Moreover, there were significant cocaine-induced increases in acetylated histone H3 (AcH3) and phospho-cAMP response element binding protein (pCREB) association with BDNF promoter IV. In contrast, there was decreased methyl-CpG-binding protein 2 (MeCP2) association with BDNF promoter IV in the mPFC of rats that previously self-administered cocaine. Taken together, these results indicate that cocaine-induced increases in BDNF promoter IV transcript in the mPFC are driven by increased binding of AcH3 and pCREB as well as decreased MeCP2 binding at this BDNF promoter. Collectively, these results indicate that cocaine self-administration remodels chromatin in the mPFC resulting in increased expression of BDNF, which appears to represent a compensatory neuroadaptation that reduces the reinforcing efficacy of cocaine.
Keywords: BDNF, cocaine, chromatin remodeling, medial prefrontal cortex, addiction, histones, transcription, self-administration
Repeated intake of drugs of abuse, such as cocaine, promotes alterations in gene expression that underlie addiction as well as compensatory neuroadaptations (Wise, 2004; Kalivas, 2005; Nestler, 2005; Shaham and Hope, 2005; Pierce and Kumaresan, 2006). The most relevant of these cocaine-induced changes in gene expression occur in the ventral tegmental area (VTA), a major locus of dopamine neurons, as well as nuclei receiving dopaminergic inputs from the VTA including the medial prefrontal cortex (mPFC), nucleus accumbens and amygdala. A growing body of evidence indicates that cocaine alters the expression of neurotrophic factors. For example, previous studies have shown that an acute injection of cocaine increases brain-derived neurotrophic factor (BDNF) mRNA in the striatum, mPFC, and nucleus accumbens (Le Foll et al., 2005; Liu et al., 2005; Berglind et al., 2007). Similarly, a sensitizing regimen of cocaine injections or cocaine self-administration results in increased BDNF mRNA in the nucleus accumbens and striatum (Le Foll et al., 2002; Zhang et al., 2002; Kumar et al., 2005; Graham et al., 2007).
There are functional consequences of increases in BDNF transcription in various limbic nuclei. Three once-daily microinjections of BDNF into the VTA progressively augments BDNF-induced behavioral hyperactivity (Pierce et al., 1999). Moreover, continuous infusion of BDNF into the VTA or substantia nigra enhances the behavioral hyperactivity induced by an acute injection of cocaine (Martin-Iverson et al., 1994; Martin-Iverson and Altar, 1996; Horger et al., 1999). Repeated administration of BDNF into the nucleus accumbens augments the reinstatement of cocaine seeking (Graham et al., 2007). In addition, the time-dependent increases in cue-induced cocaine seeking is paralleled by increases in BDNF levels in the VTA, nucleus accumbens and amygdala over the first 90 days following cocaine self-administration (Grimm et al., 2003). Taken together, these results indicate that alterations in BDNF transcription in limbic nuclei have differential effects on cocaine-induced behavioral plasticity, including the reinstatement of cocaine seeking.
Recently, it was shown that exogenous BDNF infusions into the mPFC attenuate the reinstatement of cocaine seeking (Berglind et al., 2007; Berglind et al., 2009; McGinty et al., 2010). Here, we report that cocaine self-administration increased BDNF protein and mRNA levels in the mPFC. In order to determine the functional relevance of this finding, the influence of viral-mediated decreases of BDNF levels in the mPFC on cocaine self-administration maintained under a progressive ratio (PR) schedule of reinforcement was evaluated. In addition, chromatin immunoprecipitation (ChIP) was used to identify the molecular mechanisms underlying the increase in BDNF mRNA in the mPFC associated with cocaine self-administration.
Animals and housing
Male Sprague-Dawley rats (Rattus norvegicus) weighing 250-300 g were obtained from Taconic Laboratories (Germantown, NY). Animals were individually housed with food and water available ad libitum. A 12/12 hr light/dark cycle was used with the lights on at 7:00 a.m. All experimental procedures were performed during the light cycle. A total of 107 rats were used in this study.
Surgery
Prior to surgery, the rats were anesthetized with 80 mg/kg ketamine and 12 mg/kg xylazine (i.p.). An indwelling silastic catheter was placed into the right jugular vein (side opposite the heart) and sutured in place. The catheter was routed to a screw-on mount (Plastics One, Roanoke, VA) that was sutured below the skin between the shoulder blades. The catheters were sealed with plastic obturators when not in use. Following catheter implantation, some rats were mounted in a stereotaxic apparatus (Kopf Instruments, CA) and a viral vector (2 μl/side) was administered at the borders between the infralimbic/prelimbic cortices (+2.5 mm A/P, ±0.5 mm M/L, ±4.5 D/V) and prelimbic cortex/anterior cingulate (+2.5 mm A/P, ±0.5 mm M/L, ±3.0 D/V) via 33-gauge cannulae. All coordinates were relative to bregma according to the atlas of Paxinos and Watson (Paxinos and Watson, 1997). Thus, each rat was microinjected with a 4 μl of virus bilaterally into the infralimbic cortex, prelimbic cortex and anterior cingulate, which collectively form the mPFC in the rat. Each 2 μl microinjection was made over 10 minutes and the microinjector was left in place for 2 minutes after the infusion.
Self-administration training
Following a 10 to 14-day (for shRNA) or 7-day (all other experiments) recovery period from surgery, the rats were placed in operant chambers and allowed to lever press for intravenous cocaine infusions (0.25 mg cocaine/56 μl saline/infusion over 4 sec) for 14 days. Rats initially were trained using a fixed ratio (FR1) schedule of reinforcement with each daily self-administration session initiated by an intravenous priming injection of cocaine (0.25 mg). When the animals achieved stable responding with the FR1 schedule (i.e. less than 15% variation in response rates over three consecutive days) they were switched to an FR5 schedule for 14 consecutive days of self-administration. A 60-sec timeout period during which responses have no scheduled consequences followed each cocaine infusion. The rats were limited to a maximum of 30 cocaine infusions per daily 2-hour self-administration session.
Progressive Ratio
For those animals in cocaine reinforcement experiments (using the progressive ratio schedule), when stable responding with the FR5 schedule was achieved, as defined by a less than 15% change in the number of responses on two consecutive days, the rats were switched to a progressive ratio (PR) schedule of reinforcement. The progressive ratio schedule is based on that of Richardson and Roberts (Richardson and Roberts, 1996). The response requirement for the ith reinforcement was given by: R(i)=[5e0.2i – 5] where the brackets indicate the rounding function. Using this exponential function, the response requirement for the first ten injections was as follows: 1, 2, 4, 6, 9, 11, 15, 19, 25, 31 (etc.). Thus, under a PR schedule the response requirement for each subsequent drug delivery increased until the subject failed to meet a requirement. The session expired when an animal took more than one hour to receive an injection. The break point was operationally defined as the number of cocaine infusions administered prior to the termination of the session.
AAV cloning and packaging
The EGFP-U6-pACP plasmid contains AAV2 inverted terminal repeats flanking a CMV promoter, the coding sequence for EGFP, an intron and polyadenylation signal derived from SV40, and further downstream, a murine U6 pol III promoter. To obtain each AAV-shRNA, synthetic oligos encoding the shRNA and its respective complement (Integrated DNA Technologies, Coralville, IA) were annealed and ligated into unique BbsI and NheI sites in the AAV plasmid downstream of the U6 promoter. The BDNF mRNA target sequence used, ACCATAAGGACGCGGACTTGT (from NCBI reference sequence NM_012513), was selected following in vitro screening of multiple candidates (Bass and Terwilliger, unpublished). Control vectors included AAV10 encoding either EGFP alone, or AAV10 encoding EGFP plus a scrambled (scr) shRNA, (CTGTTACGCTGGCTCTATCGA) which does not correspond to any known rat mRNA sequence. Packaging of all AAV was carried out using a standard triple transfection protocol to generate helper virus-free pseudotyped AAV10 virus (Xiao et al., 1998). An AAV2/10 rep/cap plasmid provided AAV2 replicase and AAV10 capsid functions (Gao et al., 2002; De et al., 2006), while adenoviral helper functions were supplied by the pHelper plasmid (Stratagene, La Jolla, CA). Briefly, AAV-293 cells were transfected with 1.33 pmol of pHelper, and 1.15 pmol each of AAV2/10 and the shRNA-AAV vector plasmids, via calcium phosphate precipitation. The cells were harvested 48 hours later and the pellets resuspended in DMEM, freeze-thawed three times and centrifuged to produce a clarified viral lysate. The vector stocks were titered by real-time PCR using the ABI Prism 7700 Sequence Detection System from Perkin-Elmer Applied Biosystems (Foster City, CA) as previously described (Clark et al., 1999). The average titer of the preparations was approximately 1 × 1012 vector genomes/ml.
Immunohistochemistry
10 days after rats received unilateral microinjections with AAV-viral vector containing EGFP-linked scrambled BDNF shRNA, animals were perfused with formalin, brains were post-fixed in 10% formalin for 24 h and then cryoprotected in sucrose prior to freezing at -80°C. 40 μm sections were obtained using a cryostat and stored in a solution of 7% sucrose/20%ethylene glycol in 0.1 M PBS. For BDNF immunohistochemistry, free-floating sections were washed in 0.1 M PBS for 1 h. Antigen retrieval was carried out by heating sections in 10 mM sodium citrate (pH 6.0) at 80°C for 15 min. The sections were permeabilized in 0.5% Triton X-100 for 20 min and then incubated with 10% normal goat serum for 1 hr prior to overnight incubation at 4°C with a 1:250 dilution of anti-BDNF polyclonal antibody (ab1779, Chemicon International Inc., CA) prepared in 1X GDB buffer (1% gelatin solution, 5% Triton X-100). After washing in 0.5% Triton X-100 for 1 h, sections were incubated in a 1:1000 dilution of Cy3 goat-anti rabbit IgG in 1X GDB for 1 h at room temperature. Sections were washed in 0.1 M PBS for 1 hr and mounted with Vectashield (Vector). BDNF immunoreactivity and GFP expression were examined with an Olympus BX60 fluorescence microscope and images were acquired and intensity of staining was measured using ImageJ software.
Western blotting
For Western blot analysis histone extracts from dissected rat mPFC were used and the experiments were performed as described previously (Sadri-Vakili et al., 2007). Briefly, mPFC from both hemispheres of a cocaine or yoke rat was homogenized in 200 μl of lysis buffer (1% Nonidet P-40, 20 mM Tris, pH 8.0, 137 mM NaCl, 10% glycerol, 1 mM PMSF, sodium butyrate 1mM, and protease inhibitors) at 4°C. After removal of cellular debris by centrifugation, the supernatant was collected and protein levels in the lysates were measured by the Bradford assay (Bio- Rad Laboratories). 10-20 μg of each sample was boiled in the presence of sample buffer for 5 min before separation on 10-20% SDS- polyacrylamide gel, and proteins were transferred to nitrocellulose membranes. The immunoblots were blocked with 5% nonfat dry milk dissolved in Tris-buffered saline containing 0.2% Tween 20 (TBST) for 60 min. The membranes were then incubated overnight at 4°C with specific antibodies that included: di acetyl lysine 9 and lysine 14 histone H3 (AcH3) antibody (Upstate, Lake Placid, NY) at a dilution of 1:1500, anti-histone H3 antibody (Upstate, Lake Placid, NY) at a dilution of 1:500, anti-phospho-CREB (Abcam, Cambridge, MA) 1:500, and anti-MeCP2 (Abcam, Cambridge, MA). Primary antibody incubation was followed by 6 washes (10 min, rocking, RT) in TTBS before incubation with the secondary antibody (HRP-conjugated goat anti-rabbit IgG, Jackson ImmunoResearch Laboratories, West Grove, PA), 6 washes, and visualization using the ECL detection system (NEN, Boston, MA).
Enzyme-linked Immunosorbant Assay
Ten days after rats received unilateral microinjections in the medial prefrontal cortex with AAV10 vector containing EGFP-linked shRNA targeting BDNF, 4 animals were sacrificed and bilateral medial prefrontal cortices were dissected. Tissues were lysed and homogenized and diluted to 10 μg/μl and 20 μg/μl. The concentration of BDNF in the diluted lysates was quantified using the Chemikine™ Brain Derived Neurotrophic Factor (BDNF) Sandwich ELISA kit (Cat. No. CYT306, Chemicon International Inc., CA). The brain tissue samples and serial dilutions of BDNF standards were loaded in triplicate onto a microplate coated with rabbit anti-human BDNF polyclonal antibodies and incubated overnight at 4°C. After 4 washes, biotinylated mouse anti-human BDNF monoclonal antibody (1:1000) was added to the microplate for 2.5 h at room temperature. The plates were washed 4 times and the strepavidin-enzyme conjugate was added to the plate and allowed to incubate for 1 h. After further washing, tetramethylbenzidine chromagenic substrate was added and then 15 min later the reaction was stopped. The absorbance at 450 nm was measured with a plate reader. BDNF concentration in the brain tissue samples was measured by comparing values to the prepared standard curve.
Chromatin immunoprecipitation (ChIP) assay
We have adapted the ChIP technique to the analysis of brain tissue and have recently published detailed methodology for performing ChIP experiments (Braveman et al., 2004; Chen-Plotkin et al., 2006: Sadri-Vakili et al., 2007). Briefly, mPFC from both hemispheres of an individual cocaine or yoke rat was cut into pieces and the pieces were weighed (< 30mg) and deposited into tubes. Formaldehyde was added (10 μl of 1% formaldehyde to 1 mg tissue) and brain pieces were incubated for 10 min at 37°C to cross-link DNA to associated proteins. Brain tissue was washed twice with ice-cold PBS containing protease inhibitors (PI, Complete Mini protease inhibitor cocktail tablets, Roche, Indianapolis, IN), and then suspended in SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1) containing PI at a ratio of 10μl buffer for each mg of brain. After incubating on ice for 10 min, brain lysates were sonicated to shear lengths of 200-1000 base pair DNA fragments using 10 sets of 10-15 sec pulses at setting 3 of a sonicator (Branson Cell Disruptor 350). We have found that this regimen yields DNA fragments appropriate for ChIP (200 – 1000 bp) (Braveman et al., 2004). The resulting homogenates from one brain were pooled and then centrifuged for 10 min at 13,000g at 4°C to remove debris, and 200 μl aliquots of the suspension were placed into separate sample tubes. Each sample was diluted 10-fold with ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8.1, 167 mM NaCl), and 20 μl (1%) of the diluted sample was set aside and designated ‘Input’ DNA. Samples were then either processed immediately or stored at –80°C.
For immunoprecipitation, 2000 μl of each sample was pre-cleared with 80 μl of salmon sperm DNA/Protein A-agarose 50% slurry (Upstate Biotechnology, Lake Placid, NY) by incubating at 4°C for 30 min with gentle agitation before overnight incubation (4°C) with 5 μg of each of the following antibodies: phospho-CREB, MeCP2, di-acetyl lysine 9 and lysine 14 histone H3 (AcH3), or 5-methyl-cytosine (Upstate, Lake Placid, NY). Negative controls included no antibody mock and IgG (Jackson, West Grove, PA). Mock immunoprecipitation conditions (mouse IgG) were also included as a control. After immunoprecipitation, 80 μl of the salmon sperm DNA/protein A-agarose 50% slurry was added to samples, and immunocomplexes were collected for 1 h at 4°C on a rocking platform. After pelleting agarose (1000 rpm, 4°C, 2 min), the chromatin-antibody/protein A-agarose complexes were washed sequentially (4 min each on a rotating platform) with 1 ml each of: a low salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 150 mM NaCl), a high salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 500 mM NaCl), a LiCl buffer (0.25 M LiCl, 1% NP-40, 1% deoxycholate, 1 mM EDTA, 10 mM Tris-HCl, pH 8.1), and a TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). Elution was performed by incubation in 250 μl of freshly made elution buffer (1% SDS, 0.1 M NaHCO3) for 15 min at room temperature; elution was repeated and eluates combined. Cross-links were then reversed by addition of 20 μl 5 M NaCl to the pooled eluates and heating of the mixture to 65°C for 4 h. The saved input DNA was diluted to a volume of 500 μl with sterile water, and cross-link reversal was performed in the same manner as for the ChIP samples. After cross-link reversal, all samples (ChIP and Input) were digested with 20 μg proteinase K (1 h, 45°C), and DNA was recovered with phenol/chloroform extraction and ethanol precipitation. DNA pellets were resuspended in 25 μl of sterile water.
One μl (1 or 4 μl for human samples) of ChIP-dreived DNA was used as template in 20 μl reactions containing 10 μl 2X SYBR Green Master Mix (Applied Biosystems, Foster City, CA) and 0.5 μM of each primer. Real-time thermal cycling was performed using an iCycler thermal cycler (Bio-Rad, Hercules, CA), with continuous SYBR Green monitoring according to the manufacturer's recommendations, using iCycler software. Cycling parameters for all amplifications were as follows: 60 cycles of 95°C for 30 sec, 57°C for 30 sec, and 72°C for 45 sec, followed by melt-curve analysis (55°C+ for 10 sec × 80 cycles). All PCR reactions were performed in triplicate and included negative controls (no DNA) as well as positive controls (serial dilutions of known amounts of genomic DNA).
Target DNA sequence quantities were estimated from threshold amplification cycle numbers (Tc) using iCycler software. For every gene sequence studied, a ΔTc value was calculated for each sample by subtracting the Tc value for the immunoprecipitated sample from the Tc value for the corresponding Input DNA to normalize for differences in ChIP sample aliquots before immunoprecipitation. DNA quantities were then expressed as percentages of corresponding Input using the following equation: (Antibody ChIP as a percentage of Input) = 2(ΔTc) × 100. Finally, DNA quantities (normalized to Input) were compared for immunoprecipitated vs. mock-immunoprecipitated samples; only when immunoprecipitated samples contained >1.5 times as much DNA were they considered to have sufficient DNA for analysis.
Input and IP samples were interrogated with gene promoter-specific primers in triplicate reactions in real-time PCR analysis as previously described (Braveman et al., 2004; Chen-Plotkin et al., 2006; Sadri-Vakili et al., 2007). Threshold amplification cycle numbers (Tc) using iCycler software were used to calculate IP DNA quantities as percentage of corresponding inputs. The following exon specific BDNF primers were designed based on previously published sequences (Chen et al., 2003; Martinowich et al., 2003; Jiang et al., 2008) and used for real-time PCR analysis. BDNF exon I: forward 5’-GCAGTTGGACAGTCATTGGTAACC-3’ and reverse 5’-ACGCAAACGCCCTCATTCTG-3’; BDNF exonII (a, b, c): forward 5’-GCAGAGTCCATTCAGCACCTTG-3’ and reverse 5’-TGGCTTGACAGCGAGGAAAAG-3’; BDNF exon IV (CREB and MeCP2 binding sites): forward 5’-AACAAGAGGCTGTGACACTATGCTC-3’ and reverse 5’-CAGTAAGTAAAGGCTAGGGCAGGC-3’, forward 5’-AAAGCATGCAATGCCCT-3 and reverse 5’-GAGATTTCATGCTAGCTCGC-3’, 5’-GGCTTCTGTGTGCGTGAATTTGC-3’ and reverse 5’-AAAGTGGGTGGGAGTCCACGAG-3’; BDNF exon IV: forward 5’-TTTGGGGCAGACGAGAAAGC-3’ and reverse 5’-GGCAGT GGAGTCACATTGTTGTC-3’.
DNA quantitation
ChIP products were quantified using the luciferase- and T4 DNA polymerase-based DNA Quantitation System (Promega, Madison, WI) according to manufacturer's instructions. The light output was immediately measured in a luminometer (TD-20/20 Luminometer, Turner Designs, Sunnyvale, CA). ChIP products were also quantified using Quant-iT PicoGreen dsDNA reagent (Invitrogen, Carlsbad, CA) and assayed on the Wallac Victor 1420 Multilabel Counter (PerkinElmer, Waltham, MA) with excitation and emission wavelengths of 485 nm and 535 nm, respectively.
RNA extraction and reverse transcription
RNA was extracted from dissected brain regions from one hemisphere of cocaine or yoke rats using RNeasy kit (Qiagen, Valencia, CA) according to manufacturer's instructions and as described previously (Sadri-Vakili et al., 2007). Reverse transcription reactions were performed using the Superscript First Strand Synthesis System for RT-PCR reactions (Invitrogen, Carlsbad, CA) using specific primers to quantitate the amount of gene expression as compared to a standard curve. The following primers were used for real-time PCR in order to quantitate the amount of gene expression. The exon specific BDNF primers were designed based on previously published results (Nakayama et al., 1994; Chen et al., 2003; Martinowich et al., 2003: Jiang et al., 2008). BDNF exon I: forward 5’-AAGCCGAACTTCTCACATGATGA -3’ and reverse 5’-TGCAACCGAAGTATGAAATAACCATAG -3’; BDNF exon II (a, b, c): forward 5’-GCAGAGTCCATTCAGCACCTT G-3’ and reverse 5’-TGGCTTGACAGCGAGGAAAAG-3’; BDNF exon IV: forward, 5’-CTGCCTAGATCAAATGGAGCTTCT-3’ and reverse 5’-GGAAATTGCATGGCGGAGGTAA-3’; BDNF exon IV: forward 5’-TTTGGGGCAGACGAGAAAGC-3’ and reverse 5’-GGCAGT GGAGTCACATTGTTGTC-3’; CB1: forward 5’- CCTCTACGTGGG CTCAAATG-3’ and reverse 5’-GGAAGGGACTACCCCTGAAG-3’; DRD2: forward 5’-GGTCTGCAAAGCCTTCTCTC-3’ and reverse 5’-TACTAT GCCATGCTGCTCAC-3’; GAPDH: forward 5’-AACAGCAAC TCCCATTC TTC-3’ and reverse 5’-TGGTCCAGGGTTTCTTACTC-3’; GluR1: forward 5’-ATGCTGACCTCCTT CTGTGG-3’ and reverse 5’-TCCTGTAGTTCCGGGCGTAG-3’; GluR2: forward 5’-ATTTCGGGTAGGGATGGTTC-3’ and reverse 5’-GCGAAACTGTTGGCTACCTC; mGluR5: forward 5’-GCACAGTCCAGTGAGAGG AG-3’ and reverse 5’-TTGTCCACAGTTGGTTGGTG-3’; NR1: forward 5’-TAGTTAGCCACCCGCCTAC-3’ and reverse 5’-GACATTCGGGTAGTCAGTCC-3’; PPD: forward 5’-CTGCACACAGGGAACACAAG-3’ and reverse 5’-TGATACAGAATGGCGTGGTC; PPE: forward 5’-GCTTGGGTGTTCTGCTTCTC-3’ and reverse 5’- TCCAGGGTTCT TAGTGCTGG-3’; SAP97: forward 5’-ACCCGTGGACATTCTCAATC-3’ and reverse 5’-CGGTATCAGGACGAAGAGG-3’. Quantitative real time-PCR was performed in an iCycler (Bio-Rad) with the use of SYBR-green PCR Master Mix (Applied Biosystems, Foster City, CA) through 50 PCR cycles (95°C for 30 sec, 57°C for 60 sec, 72°C for 90 sec). The threshold cycle for each sample was chosen from the linear range and converted to a starting quantity by interpolation from a standard curve run on the same plate for each set of primers. The mRNA levels were normalized for each well to the GAPDH mRNA levels. Single PCR products were verified by assessing that the melting temperature of the product had a single value.
Cocaine self-administration increases BDNF protein levels in the mPFC
Following fourteen days of cocaine self-administration and seven days of forced abstinence the animals were sacrificed and the mPFC was removed. Figure 1A is diagram depicting a coronal section of the rat brain at the level of the mPFC (3.20 mm anterior to bregma, Paxinos and Watson, 1997). The mPFC dissection (shown in back) included the anterior cingulate, prelimbic and infralimbic cortices. There was a significant increase in BDNF protein levels in the mPFC (relative to yoked saline controls) as measured by western blot analysis [t(6)=3.753, p<0.0095; see Figure 1B] and ELISA [t(5)=6.727, p<0.0011; see Figure 1C].
Figure 1
Figure 1
BDNF protein levels are increased in the mPFC following cocaine self-administration
Decreasing BDNF in the mPFC enhances the reinforcing efficacy of cocaine
In order to assess if this cocaine-induced increase in BDNF levels in the mPFC has functional consequences, we used a viral vector to deliver interfering RNA to the mPFC to suppress BDNF mRNA levels. In initial experiments, adeno-associated viral vectors (AAV10) encoding enhanced green fluorescent protein (EGFP) together with short hairpin RNA (shRNA) targeting BDNF exon IX, which is common to all BDNF transcripts, or a scrambled sequence that is not found in any known mRNA (scrambled control) were microinjected into the mPFC using stereotaxic surgery. Ten days after treatment with AAV10-BDNF shRNA there was an approximately 58% decrease in BDNF staining intensity/cell in the mPFC as measured by immunohistochemistry (see Figure 2), which was statistically significant [t(5)=3.683, p<0.0142]. Six rats were used in this control experiment and a total of 380 cells from the control side were compared to 231 cells from AAV10-BDNF shRNA treated mPFC in these animals. The reduction in BDNF levels persisted for at least three weeks (data not shown). Although precise quantification of immunohistochemistry is problematic, these data indicate that there was extensive transfection of the AAV10-BDNF shRNA in the mPFC that clearly suppressed BDNF expression. However, it is acknowledged that the 58% reduction cited above is an estimate rather than an absolute quantification of BDNF knockdown by the shRNA. The decrease in BDNF following shRNA treatment was specific for BDNF as there was no change in neurotrophin-3 or microtubule associated protein 2 (MAP2) levels in the treated animals (data not shown).
Figure 2
Figure 2
shRNA-induced down-regulation of BDNF expression in the mPFC enhances the reinforcing efficacy of cocaine, as assessed with a PR schedule
In a group of naïve rats, cocaine self-administration commenced 10-14 days following AAV10-BDNF shRNA administration into the mPFC. Importantly, all rats were within the same weight range (300-325 g) at the onset and throughout cocaine self-administration. Approximately equal numbers of rats were administered control vectors (AAV10 encoding EGFP and AAV10 encoding EGFP plus a scrambled (scr) AAV-shRNA). The behavioral data from these treatments did not differ significantly; therefore, these treatments were combined into a single control group. Rats initially were allowed to self-administer cocaine under a fixed ratio (FR) schedule of reinforcement with no prior training of any sort or food restriction. Results indicated no significant differences in the rate of acquisition or number of cocaine infusions per session between the BDNF shRNA and control virus-treated groups (data not shown). After 12 days of cocaine self-administration under the FR schedule of reinforcement, the reinforcing efficacy of cocaine was assessed using a PR schedule. Under the PR schedule, the breakpoint of AAV10-BDNF shRNA-treated rats was significantly higher than the control rats [t(12)=2.323, p<0.0385] (Figure 2G). There were seven subjects per treatment. The time courses for two representative subjects responding under the PR schedule are shown in Figure 2H. The breakpoints (cumulative responses per session) for each control subject were 685,563,417,647,882,871,341; breakpoints for the siRNA subjects were 567,1064,1328,1533,1645,267,2066. These results indicate that rats administered BDNF shRNA work substantially harder than control subjects to receive cocaine, which indicates that the reinforcing efficacy of cocaine is increased when BDNF in the mPFC is decreased.
Cocaine self-administration selectively increases the expression of BDNF exon IV in the mPFC
The rat BDNF gene contains multiple promoters that are used to generate mRNAs (Timmusk et al., 1993; Aid et al., 2006; Liu et al., 2006). There are eight untranslated 5’ exons that are spliced onto the coding 3’ exon containing the coding domain for the BDNF protein. The different function of these transcripts is not known, but they are differentially targeted and translated within cells. We next assessed BDNF exon I, II, IV, and VI transcripts in the mPFC of cocaine-experienced rats (and yoked saline controls) following seven days of forced abstinence. There was no expression of BDNF exon II mRNA in the mPFC. These data were analyzed with two-way ANOVA, which revealed significant main effects of drug treatment [F(1,39)=4.19, p<0.0473] and exon [F(3,39)=3.53, p<0.0234]. Although the treatment × exon interaction was not significant, a planned comparison using Tukey's HSD (which adequately controls for the family-wise error rate of the entire data set) indicated a significant difference between the cocaine and saline groups for exon IV (see Figure 3). There were no other significant differences between cocaine and saline treated subjects. There were eight cocaine self-administration rats and four yoked saline controls analyzed for each exon in this experiment.
Figure 3
Figure 3
Cocaine self-administration selectively increases BDNF exon IV mRNA in the mPFC
Increased association of acetylated histone H3 with BDNF gene following cocaine self-administration
Chromatin remodeling through modification of histone proteins is a requisite mechanism of gene expression. In general, histone acetylation corresponds to increased transcription, which is a possible mechanism underlying cocaine-induced increases in BDNF expression in the mPFC. In order to test this hypothesis we used ChIP to assess the association of AcH3 with BDNF promoters in the mPFC. As shown in Figure 4A and 4B, western blotting indicated that there was no change in overall levels of AcH3 in the mPFC. However, ChIP assays revealed that there was an increase in the association of AcH3 with BDNF promoter IV in the mPFC following cocaine self-administration (Figure 4C). These data were analyzed with a two-way ANOVA, which revealed significant main effects of treatment (cocaine or saline) [F(1,29)=5.59, p<0.025], exon [F(3,29)=12.84 p<0.0001] as well as a significant treatment × exon interaction [F(3,29)=6.12, p<0.0023]. Subsequently pairwise comparisons (Tukey's HSD) showed that there was a significant difference between treatments only for exon IV (saline, n=5; cocaine, n=4). This finding suggests that cocaine self-administration followed by seven days of forced abstinence results in enhanced association of acetylation H3 with BDNF exon IV in the mPFC.
Figure 4
Figure 4
Increased association of acetylated histone H3 with BDNF exon IV in mPFC following cocaine self-administration
Acetylated H3 results in an open chromatin configuration, which allows for sequence-specific binding of transcription factors to promoter regions, which influences gene expression. It is likely, therefore, that cocaine-induced increases in BDNF mRNA in the mPFC results from alterations in the assembly of transcription factors at BDNF promoters. BDNF gene expression is regulated by a number of transcription factors, including CREB and MeCP2 (West et al., 2001; Chen et al., 2003; Martinowich et al., 2003). Therefore, we next measured changes in pCREB (the active form of CREB) and MeCP2 following cocaine self-administration and seven days of forced abstinence.
Cocaine self-administration increased the association of pCREB with BDNF exon IV in the mPFC
As shown in Figures 5A and 5B, western blotting indicated no difference in global pCREB levels between animals allowed to self-administer cocaine and yoked saline controls. However, global pCREB levels do not reflect what happens at individual gene promoters. Therefore, we measured changes in pCREB association with BDNF gene promoters using ChIP. Following cocaine self-administration and seven days of forced abstinence, there was an increase in pCREB association with BDNF promoter IV, but not with promoters I, II or VI in the mPFC (Figure 5C). These data were analyzed with a two-way ANOVA, which indicated significant main effects of treatment [F(1,31)=5.51, p<0.0255] and exon [F(3,31)=9.28, p<0.0002] as well as a significant treatment × exon interaction [F(3,31)=4.02, p<0.0159]. Subsequent pairwise comparisons (Tukey's HSD, p<0.05) showed a significant difference between treatments for exon IV (saline, n=9; cocaine, n=5). These results indicate that one mechanism whereby cocaine increases BDNF expression is by specifically increasing the association of pCREB with BDNF promoter IV.
Figure 5
Figure 5
Cocaine self-administration results in increased association of pCREB with BDNF exon IV in the mPFC
Cocaine self-administration decreases MeCP2 association with BDNF exon IV in the mPFC
MeCP2 repression of BDNF promoter IV has been well described in previous studies (Chen et al., 2003; Martinowich et al., 2003). A requisite step in BDNF promoter IV-containing gene expression is de-repression caused by the dissociation of MeCP2 from promoter IV (Chen et al., 2003). Although there was no global difference in MeCP2 levels in the mPFC (Figures 6A and 6B), there was a decrease in MeCP2 association with BDNF promoter IV following cocaine self-administration with seven days of forced abstinence in the mPFC (Figure 6C), while MeCP2 association with other BDNF promoters was unchanged. These data were analyzed with a two-way ANOVA, which indicated significant main effects of treatment [F(1,31)=5.32, p<0.0279] and exon [F(3,31)=9.24, p<0.0002]. Although the treatment × exon interaction did not reach statistical significance [F(3,31)=2.61, p<0.069], planned pairwise comparisons using Tukey's HSD (p<0.05), which accounts for the family-wise error rate of the overall ANOVA, showed a significant difference between treatments for exon IV (saline, n=5; cocaine, n=5). These data indicate that decreased association of MeCP2 with BDNF exon IV, resulting in de-repression, contributes to cocaine-induced increases in BDNF transcription in the mPFC.
Figure 6
Figure 6
Decreased association of MeCP2 with BDNF exon IV in the mPFC after cocaine self-administration
Given that MeCP2 binds to methylated cytosines there is a possibility that the dissociation of MeCP2 from BDNF promoter IV is due to a decrease in DNA methylation in response to cocaine self-administration. In order to assess this effect we measured methylated DNA levels using ChIP with an antibody specific for 5-methyl-cytosine followed by DNA quantitation. While both saline and cocaine groups yielded higher levels of DNA compared to the control no antibody mock sample, a t-test revealed no difference in the amount of DNA that was precipitated in the saline (0.9125 ± 0.4303, n=4) versus the cocaine group (0.4250 ± 0.08539, n=4), suggesting that that the dissociation of MeCP2 from BDNF promoter IV is not due to changes in DNA methylation.
In the current study, cocaine self-administration followed by seven days of forced abstinence increased BDNF mRNA and protein levels in the rat mPFC. Furthermore, decreasing BDNF levels using RNA interference enhanced cocaine self-administration under a PR schedule, suggesting that increased mPFC BDNF levels counteract the reinforcing efficacy of cocaine. Examination of specific BDNF exons revealed that cocaine self-administration selectively increased BDNF exon IV in the mPFC. Cocaine self-administration increased the association of acetylated histone H3 with mPFC BDNF promoter IV, which confers an open chromatin confirmation. Increased pCREB and decreased MeCP2 association with mPFC BDNF promoter IV also were observed following cocaine self-administration and seven days of forced abstinence. Thus, the molecular mechanisms underlying the functionally relevant increase in BDNF expression in the mPFC induced by previous cocaine self-administration appear to focus at least in part on CREB-induced promotion and MeCP2-mediated de-repression of BDNF transcription.
Cocaine-induced changes in gene expression
Previous studies have shown that alterations in gene expression underlie cocaine-induced neuronal and behavioral plasticity (Nestler et al., 1996; Nestler, 2004). Both acute and repeated cocaine administration result in transient changes in gene expression in a number of brain regions (Yuferov et al., 2005). The cocaine-induced genes encode for neurotransmitter receptors, transporters, transcription factors, neuropeptides, and molecules involved in calcium signaling (Freeman et al., 2001; Backes and Hemby, 2003; Tang et al., 2003; Yuferov et al., 2005). Here, following fourteen days of self-administration and seven days of forced abstinence, we observed a specific increase in BDNF exon IV-containing transcript in the mPFC. Previous work indicates that cocaine self-administration also increases BDNF expression in the VTA (Grimm et al., 2003). In addition, studies have shown that both acute and repeated injections of cocaine have been shown to influence the expression of BDNF in dopaminoreceptive limbic nuclei. Thus, an acute injection of cocaine increases BDNF mRNA in the striatum, mPFC, and nucleus accumbens (Le Foll et al., 2005; Liu et al., 2005). Likewise a sensitizing regimen of cocaine injections or cocaine self-administration results in increased BDNF mRNA in the mPFC, nucleus accumbens and striatum (Le Foll et al., 2002; Zhang et al., 2002; Kumar et al., 2005; Fumagalli et al., 2007).
Behavioral consequences of cocaine-induced changes in BDNF transcription
Several studies have shown that BDNF influences cocaine reward, reinforcement and the reinstatement of cocaine seeking. Thus, BDNF knockout mice have deficits in the ability to express conditioned place preference to cocaine (Hall et al., 2003), indicating that BDNF plays an important role in conditioned cocaine reward. Similarly, inducible knockout of BDNF in nucleus accumbens neurons reduced cocaine reinforcement, as assessed with cocaine self-administration under a fixed ratio schedule (Graham et al., 2007). BDNF also has been shown to influence the reinstatement of cocaine seeking, an animal model of craving and relapse (Shalev et al., 2002). The enhancement (or “incubation”) of cue-induced cocaine seeking with time following the extinction of cocaine self-administration is paralleled by increases in BDNF protein levels in the VTA, nucleus accumbens and amygdala (Grimm et al., 2003). Moreover, a single infusion of BDNF into the VTA enhanced the reinstatement of cocaine seeking (Lu et al., 2004). Repeated administration of BDNF into the nucleus accumbens also results in enduring enhancement of the reinstatement of cocaine seeking (Graham et al., 2007). Taken together, these findings indicate that BDNF in several key nuclei contributes significantly to cocaine reinforcement and the reinstatement of cocaine seeking.
Among human cocaine addicts as well as in animals allowed to chronically self-administer cocaine there are decreases in D2 dopamine receptor expression in the nucleus accumbens (Volkow et al., 1999; Nader and Czoty, 2005), which may prompt further cocaine intake to compensate for this deficit (Volkow et al., 1999). The present results demonstrate a similar homeostatic mechanism consistent with the opponent-process view of addiction (Solomon and Corbit, 1974). Thus, decreasing BDNF in the mPFC increased the self-administration of cocaine, suggesting that cocaine-induced increases in mPFC BDNF transcription is a compensatory reaction to decrease the reinforcing efficacy of cocaine. Since animals and humans allowed repeated access to cocaine ultimately develop robust and persistent patterns of cocaine self-administration, other changes in the limbic system must override the homeostatic plasticity associated with BDNF in the mPFC. Conversely, our results suggest that increasing BDNF expression in the mPFC may diminish the reinforcing efficacy of cocaine. Consistent with this notion, recent evidence indicates that exogenous BDNF infusions into the mPFC suppress the reinstatement of cocaine seeking (Berglind et al., 2007) by normalizing cocaine-induced alterations in glutamate transmission the nucleus accumbens (Berglind et al., 2009; McGinty et al., 2010).
Mechanisms underlying cocaine-induced changes in BDNF transcription
Several recent studies have demonstrated that chromatin remodeling is an important mechanism underlying cocaine-induced alterations in gene expression. Specifically, cocaine hyper-acetylates histone H3 and H4 associated with gene promoters (Brami-Cherrier et al., 2005; Kumar et al., 2005; Levine et al., 2005; Black et al., 2006; Cassel et al., 2006; Freeman et al., 2007; Renthal et al., 2007; Schroeder et al., 2007). Specifically, there is hyper-acetylation of histone H3 at BDNF promoters following chronic cocaine administration (Kumar et al., 2005). The rapid recruitment of histone deacetylases (HDACs) in response to cocaine represents a potential mechanism whereby cocaine regulates gene expression. Indeed, chronic cocaine exposure decreases HDAC function in the nucleus accumbens and the loss of HDAC5 enhances the behavioral response induced by chronic cocaine (Renthal et al., 2007). In addition, it was shown that administration of a HDAC inhibitor significantly reduced the break point for cocaine under a PR schedule, which correlated with measurements of HDAC activity in the frontal cortex (Romieu et al., 2008). This behavioral finding is consistent with the current results, which revealed that increased histone H3 acetylation in the mPFC specifically associated with BDNF exon IV enhanced the cocaine break point. Collectively, these results indicate that repeated exposure to cocaine results in the acetylation of histones in specific brain regions, including the mPFC resulting in an active chromatin confirmation, which allows for sequence-specific transcription factor binding to promoter regions.
Numerous studies have demonstrated that the repeated intake of drugs of abuse increases PKA activity thereby increasing phosphorylation of the transcription factor CREB, which leads to CREB-mediated transcription of genes including BDNF (Turgeon et al., 1997; Shaw-Lutchman et al., 2002; Carlezon et al., 2005). For example, acute exposure to cocaine results in the recruitment of CREB-binding protein to the fosB promoter to acetylate H4 (Levine et al., 2005). The present results showed was a significant increase in pCREB association with BDNF exon IV following cocaine self-administration, which suggests cocaine-induced hyperactylation at histone H3 allows pCREB to promote BDNF expression by interacting specifically with exon IV.
The rat BDNF exon IV promoter contains eight CpG sites that serve as binding domains for methyl-CpG binding protein 2 (MeCP2) (Martinowich et al., 2003). MeCP2 has been shown to repress BDNF promoter IV expression in the absence of neuronal activity (Chen et al., 2003). MeCP2 silencing of the BDNF gene may occur through chromatin remodeling given that MeCP2 has been shown to recruit histone deacetylases, co-repressors and histone methyltransferases (Chen et al., 2003; Martinowich et al., 2003). A prerequisite step in BDNF promoter IV-containing gene expression is de-repression caused by the dissociation of MeCP2 from promoter IV (Chen et al., 2003). The current findings indicated that there was no change in overall levels of MeCP2 in response to cocaine self-administration, which contrasts with a report of increased MeCP2 in response to cocaine (Cassel et al., 2006). It should be noted, however, that in the previous study animals were treated with daily cocaine injections for ten days with no withdrawal period (Cassel et al., 2006), whereas in the present study rats self-administered cocaine for fourteen days and MeCP2 levels were measured after seven days of forced drug abstinence. We also demonstrated that cocaine self-administration resulted in decreased association of MeCP2 with BDNF promoter IV that was not due to changes in DNA methylation at this promoter. Thus, the current data suggest that cocaine-induced increases in BDNF expression in the mPFC are partially due to de-repression of BDNF transcription via the dissociation of MeCP2 from the exon IV promoter.
The present findings indicate that cocaine self-administration increases BDNF expression in the mPFC. This cocaine-induced increase in BDNF in the mPFC appears to represent a homeostatic neuroadaptation that acts to decrease the reinforcing efficacy of cocaine. The current results also define a series of molecularly precise mechanisms whereby cocaine self-administration increases mPFC BDNF transcription including enhanced association of AcH3 and pCREB with BDNF exon IV as well as decreased association of MeCP2 with this BDNF promoter. Delineating novel and specific molecular consequences of cocaine self-administration such as these may lead to novel avenues for the development of treatments for cocaine craving and addiction.
Acknowledgements
The authors would like to thank Dr. Caroline Benn for valuable discussions. This work was supported by NIDA grants DA22339, DA18678 (R.C.P.); DA017543, DA024763 (C.E.B.), DA18333-02 (E.F.T.), and the Glendorn Foundation (J.-H.J.C.). K.R.F. was partially supported by a National Research Service Award (NRSA) from the NIH (F30 DA19304), as well as an NIH training grant (T32 GM008541-7). H.D.S. was also partially supported by an NRSA from the NIH (DA16824).
  • Aid T, Kazantseva A, Piirsoo M, Palm K, Timmusk T. Mouse and rat BDNF gene structure and expression revisited. J Neurosci Res. 2007;85:525–535. [PMC free article] [PubMed]
  • Backes E, Hemby SE. Discrete cell gene profiling of ventral tegmental dopamine neurons after acute and chronic cocaine self-administration. J Pharmacol Exp Ther. 2003;307:450–459. [PubMed]
  • Berglind WJ, Whitfield TW, Jr., LaLumiere RT, Kalivas PW, McGinty JF. A single intra-PFC infusion of BDNF prevents cocaine-induced alterations in extracellular glutamate within the nucleus accumbens. J Neurosci. 2009;29:3715–3719. [PMC free article] [PubMed]
  • Berglind WJ, See RE, Fuchs RA, Ghee SM, Whitfield TW, Jr., Miller SW, McGinty JF. A BDNF infusion into the medial prefrontal cortex suppresses cocaine seeking in rats. Eur J Neurosci. 2007;26:757–766. [PubMed]
  • Black YD, Maclaren FR, Naydenov AV, Carlezon WA, Jr., Baxter MG, Konradi C. Altered attention and prefrontal cortex gene expression in rats after binge-like exposure to cocaine during adolescence. J Neurosci. 2006;26:9656–9665. [PubMed]
  • Brami-Cherrier K, Valjent E, Herve D, Darragh J, Corvol JC, Pages C, Simon AJ, Girault JA, Caboche J. Parsing molecular and behavioral effects of cocaine in mitogen- and stress-activated protein kinase-1-deficient mice. J Neurosci. 2005;25:11444–11454. [PubMed]
  • Braveman MW, Chen-Plotkin AS, Yohrling GJ, Cha JH. Chromatin immunoprecipitation technique for study of transcriptional dysregulation in intact mouse brain. Methods Mol Biol. 2004;277:261–276. [PubMed]
  • Carlezon WA, Jr., Duman RS, Nestler EJ. The many faces of CREB. Trends Neurosci. 2005;28:436–445. [PubMed]
  • Cassel S, Carouge D, Gensburger C, Anglard P, Burgun C, Dietrich JB, Aunis D, Zwiller J. Fluoxetine and cocaine induce the epigenetic factors MeCP2 and MBD1 in adult rat brain. Mol Pharmacol. 2006;70:487–492. [PubMed]
  • Chen WG, Chang Q, Lin Y, Meissner A, West AE, Griffith EC, Jaenisch R, Greenberg ME. Derepression of BDNF transcription involves calcium-dependent phosphorylation of MeCP2. Science. 2003;302:885–889. [PubMed]
  • Chen-Plotkin AS, Sadri-Vakili G, Yohrling GJ, Braveman MW, Benn CL, Glajch KE, DiRocco DP, Farrell LA, Krainc D, Gines S, MacDonald ME, Cha JH. Decreased association of the transcription factor Sp1 with genes downregulated in Huntington's disease. Neurobiol Dis. 2006;22:233–241. [PubMed]
  • Clark K, Liu X, McGrath J, Johnson P. Highly purified recombinant adeno-associated virus vectors are biologically active and free of detectable helper and wild-type viruses. Hum Gene Ther. 1999;10:1031–1039. [PubMed]
  • De B, Heguy A, Hackett N, Ferris B, Leopold P, Lee J, Pierre L, Gao G, Wilson J, Crystal R. High levels of persistent expression of alpha1-antitrypsin mediated by the nonhuman primate serotype rh.10 adeno-associated virus despite preexisting immunity to common human adeno-associated viruses. Mol Ther. 2006;13:67–76. [PubMed]
  • Freeman W, Patel K, Brucklacher R, Lull M, Erwin M, Morgan D, Roberts D, Vrana K. Persistent Alterations in Mesolimbic Gene Expression with Abstinence from Cocaine Self-Administration. Neuropsychopharmacology. 2007;33:1807–1817. [PMC free article] [PubMed]
  • Freeman WM, Brebner K, Lynch WJ, Robertson DJ, Roberts DC, Vrana KE. Cocaine-responsive gene expression changes in rat hippocampus. Neuroscience. 2001;108:371–380. [PubMed]
  • Fumagalli F, Di Pasquale L, Caffino L, Racagni G, Riva M. Repeated exposure to cocaine differently modulates BDNF mRNA and protein levels in rat striatum and prefrontal cortex. Eur J Neurosci. 2007;26:2756–2763. [PubMed]
  • Gao G, Alvira M, Wang L, Calcedo R, Johnston J, Wilson J. Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy. Proc Natl Acad Sci USA. 2002;99:11854–11859. [PubMed]
  • Graham DL, Edwards S, Bachtell RK, DiLeone RJ, Rios M, Self DW. Dynamic BDNF activity in nucleus accumbens with cocaine use increases self-administration and relapse. Nat Neurosci. 2007;10:1029–1037. [PubMed]
  • Grimm JW, Lu L, Hayashi T, Hope BT, Su TP, Shaham Y. Time-dependent increases in brain-derived neurotrophic factor protein levels within the mesolimbic dopamine system after withdrawal from cocaine: implications for incubation of cocaine craving. J Neurosci. 2003;23:742–747. [PubMed]
  • Hall FS, Drgonova J, Goeb M, Uhl GR. Reduced behavioral effects of cocaine in heterozygous brain-derived neurotrophic factor (BDNF) knockout mice. Neuropsychopharmacology. 2003;28:1485–1490. [PubMed]
  • Horger BA, Iyasere CA, Berhow MT, Messer CJ, Nestler EJ, Taylor JR. Enhancement of locomotor activity and conditioned reward to cocaine by brain-derived neurotrophic factor. J Neurosci. 1999;19:4110–4122. [PubMed]
  • Jiang X, Tian F, Du Y, Copeland NG, Jenkins NA, Tessarollo L, Wu X, Pan H, Hu XZ, Xu K, Kenney H, Egan SE, Turley H, Harris AL, Marini AM, Lipsky RH. BHLHB2 controls Bdnf promoter 4 activity and neuronal excitability. J Neurosci. 2008;28:1118–1130. [PubMed]
  • Kalivas PW. How do we determine which drug-induced neuroplastic changes are important? Nat Neurosci. 2005;8:1440–1441. [PubMed]
  • Kumar A, Choi KH, Renthal W, Tsankova NM, Theobald DE, Truong HT, Russo SJ, Laplant Q, Sasaki TS, Whistler KN, Neve RL, Self DW, Nestler EJ. Chromatin remodeling is a key mechanism underlying cocaine-induced plasticity in striatum. Neuron. 2005;48:303–314. [PubMed]
  • Le Foll B, Diaz J, Sokoloff P. A single cocaine exposure increases BDNF and D3 receptor expression: implications for drug-conditioning. Neuroreport. 2005;16:175–178. [PubMed]
  • Le Foll B, Frances H, Diaz J, Schwartz JC, Sokoloff P. Role of the dopamine D3 receptor in reactivity to cocaine-associated cues in mice. Eur J Neurosci. 2002;15:2016–2026. [PubMed]
  • Levine AA, Guan Z, Barco A, Xu S, Kandel ER, Schwartz JH. CREB-binding protein controls response to cocaine by acetylating histones at the fosB promoter in the mouse striatum. Proc Natl Acad Sci U S A. 2005;102:19186–19191. [PubMed]
  • Liu QR, Lu L, Zhu XG, Gong JP, Shaham Y, Uhl GR. Rodent BDNF genes, novel promoters, novel splice variants, and regulation by cocaine. Brain Res. 2006;1067:1–12. [PubMed]
  • Lu L, Dempsey J, Liu SY, Bossert JM, Shaham Y. A single infusion of brain-derived neurotrophic factor into the ventral tegmental area induces long-lasting potentiation of cocaine seeking after withdrawal. J Neurosci. 2004;24:1604–1611. [PubMed]
  • Martin-Iverson MT, Altar CA. Spontaneous behaviours of rats are differentially affected by substantia nigra infusions of brain-derived neurotrophic factor and neurotrophin-3. Eur J Neurosci. 1996;8:1696–1706. [PubMed]
  • Martin-Iverson MT, Todd KG, Altar CA. Brain-derived neurotrophic factor and neurotrophin-3 activate striatal dopamine and serotonin metabolism and related behaviors: interactions with amphetamine. J Neurosci. 1994;14:1262–1270. [PubMed]
  • Martinowich K, Hattori D, Wu H, Fouse S, He F, Hu Y, Fan G, Sun YE. DNA methylation-related chromatin remodeling in activity-dependent BDNF gene regulation. Science. 2003;302:890–893. [PubMed]
  • McGinty JF, Whitfield TW, Jr., Berglind WJ. Brain-derived neurotrophic factor and cocaine addiction. Brain Res. 2010;1314:183–193. [PMC free article] [PubMed]
  • Nader M, Czoty P. PET imaging of dopamine D2 receptors in monkey models of cocaine abuse: genetic predisposition versus environmental modulation. Am J Psychiatry. 2005;162:1473–1482. [PubMed]
  • Nakayama M, Gahara Y, Kitamura T, Ohara O. Distinctive four promoters collectively direct expression of brain-derived neurotrophic factor gene. Brain Res Mol Brain Res. 1994;21:206–218. [PubMed]
  • Nestler EJ. Molecular mechanisms of drug addiction. Neuropharmacology. 2004;47(Suppl 1):24–32. [PubMed]
  • Nestler EJ. Is there a common molecular pathway for addiction? Nat Neurosci. 2005;8:1445–1449. [PubMed]
  • Nestler EJ, Berhow MT, Brodkin ES. Molecular mechanisms of drug addiction: adaptations in signal transduction pathways. Mol Psychiatry. 1996;1:190–199. [PubMed]
  • Paxinos G, Watson C. The rat brain in stereotaxic coordinates. Academic Press; New York: 1997.
  • Pierce RC, Kumaresan V. The mesolimbic dopamine system: The final common pathway for the reinforcing effect of drugs of abuse? Neurosci Biobehav Rev. 2006;30:215–238. [PubMed]
  • Pierce RC, Pierce-Bancroft AF, Prasad BM. Neurotrophin-3 contributes to the initiation of behavioral sensitization to cocaine by activating the Ras/Mitogen-activated protein kinase signal transduction cascade. J Neurosci. 1999;19:8685–8695. [PubMed]
  • Renthal W, Maze I, Krishnan V, Covington HE, 3rd, Xiao G, Kumar A, Russo SJ, Graham A, Tsankova N, Kippin TE, Kerstetter KA, Neve RL, Haggarty SJ, McKinsey TA, Bassel-Duby R, Olson EN, Nestler EJ. Histone deacetylase 5 epigenetically controls behavioral adaptations to chronic emotional stimuli. Neuron. 2007;56:517–529. [PubMed]
  • Richardson NR, Roberts DC. Progressive ratio schedules in drug self-administration studies in rats: a method to evaluate reinforcing efficacy. J Neurosci Methods. 1996;66:1–11. [PubMed]
  • Romieu P, Host L, Gobaille S, Sandner G, Aunis D, Zwiller J. Histone deacetylase inhibitors decrease cocaine but not sucrose self-administration in rats. J Neurosci. 2008;28:9342–9348. [PubMed]
  • Sadri-Vakili G, Bouzou B, Benn C, Kim M, Chawla P, Overland R, Glajch K, Xia E, Qiu Z, Hersch S, Clark T, Yohrling G, Cha J. Histones associated with downregulated genes are hypo-acetylated in Huntington's disease models. Hum Mol Genet. 2007;16:1293–1306. [PubMed]
  • Schroeder FA, Lin CL, Crusio WE, Akbarian S. Antidepressant-like effects of the histone deacetylase inhibitor, sodium butyrate, in the mouse. Biol Psychiatry. 2007;62:55–64. [PubMed]
  • Shaham Y, Hope BT. The role of neuroadaptations in relapse to drug seeking. Nat Neurosci. 2005;8:1437–1439. [PubMed]
  • Shalev U, Grimm JW, Shaham Y. Neurobiology of relapse to heroin and cocaine seeking: a review. Pharmacol Rev. 2002;54:1–42. [PubMed]
  • Shaw-Lutchman TZ, Barrot M, Wallace T, Gilden L, Zachariou V, Impey S, Duman RS, Storm D, Nestler EJ. Regional and cellular mapping of cAMP response element-mediated transcription during naltrexone-precipitated morphine withdrawal. J Neurosci. 2002;22:3663–3672. [PubMed]
  • Solomon RL, Corbit JD. An opponent-process theory of motivation. I. Temporal dynamics of affect. Psychol Rev. 1974;81:119–145. [PubMed]
  • Tang WX, Fasulo WH, Mash DC, Hemby SE. Molecular profiling of midbrain dopamine regions in cocaine overdose victims. J Neurochem. 2003;85:911–924. [PMC free article] [PubMed]
  • Timmusk T, Palm K, Metsis M, Reintam T, Paalme V, Saarma M, Persson H. Multiple promoters direct tissue-specific expression of the rat BDNF gene. Neuron. 1993;10:475–489. [PubMed]
  • Turgeon S, Pollack A, Fink J. Enhanced CREB phosphorylation and changes in c-Fos and FRA expression in striatum accompany amphetamine sensitization. Brain Res. 1997;749:120–126. [PubMed]
  • Volkow ND, Fowler JS, Wang GJ. Imaging studies on the role of dopamine in cocaine reinforcement and addiction in humans. J Psychopharmacol. 1999;13:337–345. [PubMed]
  • West AE, Chen WG, Dalva MB, Dolmetsch RE, Kornhauser JM, Shaywitz AJ, Takasu MA, Tao X, Greenberg ME. Calcium regulation of neuronal gene expression. Proc Natl Acad Sci U S A. 2001;98:11024–11031. [PubMed]
  • Wise RA. Dopamine, learning and motivation. Nat Rev Neurosci. 2004;5:483–494. [PubMed]
  • Xiao X, Li J, Samulski R. Production of high-titer recombinant adeno-associated virus vectors in the absence of helper adenovirus. J Virol. 1998;72:2224–2232. [PMC free article] [PubMed]
  • Yuferov V, Nielsen D, Butelman E, Kreek M. Microarray studies of psychostimulant-induced changes in gene expression. Addict Biol. 2005;10:101–118. [PubMed]
  • Zhang D, Zhang L, Lou DW, Nakabeppu Y, Zhang J, Xu M. The dopamine D1 receptor is a critical mediator for cocaine-induced gene expression. J Neurochem. 2002;82:1453–1464. [PubMed]