PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

Logo of wjgLink to Publisher's site
 
From:
Published online 2010 September 21. doi: 10.3748/wjg.v16.i35.4443

Table 1

Polymerase chain reaction primers for amplification of cagA, iceA1 and iceA2 genes

Amplified genePrimer destinationSequence of primerSize of PCR product (bp)Ref.
cagAD008 FATAATGCTAAATTAGACAACTTGAGCGA297
R008 RTTAGAATAATCAACAAACATCACGCCAT[4,5]
iceA1iceA1 FGTGTTTTTAACCAAAGTATC247
iceA1 RCTATAGCCASTYTCTTTGCA[6]
iceA2iceA2 FGTTGGGTATATCACAATTTAT229 or 334[1]
iceA2 RTTRCCCTATTTTCTAGTAGGT

PCR: Polymerase chain reaction; F: Forward primer; R: Reverse primer.