PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Bone. Author manuscript; available in PMC 2011 October 1.
Published in final edited form as:
PMCID: PMC2939152
NIHMSID: NIHMS225291
Human embryonic stem cell-derived CD34+ cells function as MSC progenitor cells
Ross A. Kopher,1,2 Vesselin R. Penchev,1 Mohammad S. Islam,2 Katherine L. Hill,1 Sundeep Khosla,3 and Dan S. Kaufman1
1Department of Medicine and Stem Cell Institute, University of Minnesota, Minneapolis, MN, USA
2Department of Diagnostic and Biological Sciences, University of Minnesota, Minneapolis, MN, USA
3Endocrine Research Unit, College of Medicine, Mayo Clinic, Rochester, MN, USA
Corresponding Author: Dan S. Kaufman, M.D., Ph.D. Dept. of Medicine, 420 Delaware St. SE, MMC 480, Minneapolis, MN 55455. Telephone: 612-626-4916; Fax: 612-624-2436; kaufm020/at/umn.edu
Mesenchymal stem/stromal cells (MSCs) have been isolated from various tissues and utilized for an expanding number of therapies. The developmental pathways involved in producing MSCs, and the phenotypic precursor/progenitor cells that give rise to human MSCs remain poorly defined. Human embryonic stem cells (hESCs) have the capability to generate functional hemato-endothelial cells and other mesoderm lineage cells. hESC-derived CD73+ cells have been isolated and found to have similar phenotypic and functional characteristics as adult MSCs. Here we demonstrate hESC-derived CD34+CD73- cells can serve as MSC progenitor cells with the ability to differentiate into adipocytes, osteoblasts and chondrocytes. Additionally, gene array analysis of hESC-derived MSCs show substantially different gene expression compared to bone marrow (BM) - derived MSCs, especially with increased expression of pluripotent and multipotent stem cell and endothelial cell-associated genes. The isolation of functional MSCs from hESC-derived CD34+CD73- cells provides improved understanding of MSC development and utilization of pluripotent stem cells to produce MSCs suited for novel regenerative therapies.
Keywords: Human Embryonic Stem Cells, Mesenchymal Stem Cells, Hematopoietic Stem Cells, Progenitor Cells, Differentiation
Mesenchymal stem/stromal cells (MSCs) have been isolated from diverse tissues including bone marrow (BM) [1], adipose [2], muscle [3], periodontal ligament [4], umbilical cord blood [5] and other connective tissues [6]. MSCs are typically defined by their adherence to plastic, their proliferative abilities, expression of CD73, CD90, CD105, lack of hematopoietic markers and MHC class II expression, and ability to differentiate into cells of mesenchymal origin such as bone, cartilage and adipose tissue [7]. MSCs are currently under study to aid in several therapies, including tissue engineered bone and cartilage replacement constructs [8, 9], transplantation with bone marrow cells to reduce the onset of graft versus host disease (GVHD) [10-12], and therapies to repair infarcted myocardium [13-16]. Despite research and clinical interest in MSCs, adult MSCs are often isolated and expanded as a heterogeneous population of cells. There appears to be variation in the differentiation kinetics among various tissue-derived populations of MSCs. Specifically, cord blood-derived MSCs have higher osteogenic developmental potential and limited adipogenic capabilities, whereas BM- and adipose-derived MSCs have higher adipogenic capabilities [17-21]. Additionally, adult-derived MSCs may have limitations including donor availability, donor site morbidity and loss of multipotency upon culture expansion [22]. The multiple methods of isolation, culturing conditions and variances in phenotype, morphology and multipotency illustrate the need to better understand the developmental source of these cells [23].
Embryonic stem cells (ESCs) from mice, humans, and other species are able to self-renew indefinitely while retaining pluripotency [24-27]. Our group and others have utilized human ESCs (hESCs) to analyze development of mesodermal cell lineages, including CD34+ cells with hematopoietic and endothelial potential [28-34]. Previous studies have also been able to isolate MSCs from hESC differentiation cultures. Barberi et al. isolated CD73+ adherent fibroblast-like cells from hESCs co-cultured with OP9 cells that were phenotypically and functionally similar to MSCs [35]. Trivedi and Hematti isolated CD73+ cells in OP9 co-culture that again were phenotypically and functionally similar to MSCs; however, these cells were isolated in conjunction with functional hematopoietic progenitor CD34+ cells [36]. These studies demonstrated functional capabilities of hESC-derived MSCs, as well as characterizing the immune response of hESC-derived CD73+ cells to BM-derived MSCs by comparing the inhibition of T-cell proliferative responses when co-cultured with hESC-derived MSCs [37]. Others have derived karyotypically stable MSC-like cell lines from hESC lines in feeder-free culture conditions [38, 39]. Most recently, the osteogenic potential of hESC-derived MSCs was analyzed by incorporating a collagen1.1 reporter system to identify commitment to an osteoblastic lineage upon osteogenic culture conditions [40]. Additionally, the osteogenic potential of hESC-derived MSCs has been clearly documented in vitro within 3D constructs and in vivo calvarial defects of mice [41].
Remarkably, despite this history of studies of MSC biology, the characterization of progenitor cells that give rise to MSCs remains poorly understood. Previously, MSCs have been generated from adult CD34+ cells isolated from bone marrow [42, 43]. In addition, osteocalcin (OCN) and alkaline phosphatase (ALP) have been shown to be expressed on circulating cells of human peripheral blood, including cells that also express CD34 [44-46]. Isolation of osteogenic cells co-expressing a hemato-endothelial marker found mobilized in peripheral blood [47] may indicate the presence of multiple forms of mesodermal precursor cells. These findings illustrate the need to better define the developmental pathways of MSCs.
hESCs provide a uniform population of undifferentiated cells that do not express mesodermal-associated surface antigens such as CD34, CD31, CD73, or CD105. We have previously demonstrated the ability to utilize in vitro culture methods to derive CD34+ cells from hESCs with hemato-endothelial cell potential [32, 34, 48]. Based on this background, we hypothesized that hESC-derived CD34+ cells may also serve as MSC progenitor cells. Here, we demonstrate that hESC-derived CD34+CD73- cells function as precursors for CD34-CD73+ MSCs. These hESC-derived MSCs have typical potential to differentiate into adipocytes, chondrocytes, and osteoblasts in vitro and the ability form bone in vivo within subcutaneous pellets, but display a unique gene expression profile compared to BM-derived MSCs.
Cell Culture
The hESC line H9 (obtain from WiCell, Madison, WI, USA) was maintained as undifferentiated cells as previously described by co-culture with irradiated mouse embryonic fibroblasts (MEF) cells in DMEM/F12 supplemented with 15% Knockout Serum Replacer (KOSR) (Invitrogen Corporation, Carlsbad, CA, USA), 1% MEM-nonessential amino acids (Invitrogen), 0.5% penicillin-streptomycin (P/S), 1mM L-glutamine, 0.1 mM β-mercaptoethanol (Sigma, St. Louis, MO, USA), and 4 ng/ml human bFGF (Invitrogen) [48, 49]. The mouse bone marrow stromal cell line M2-10B4 (American Type Culture Collection (ATCC), Manassas, VA) was grown in DMEM (Invitrogen) containing 10% fetal bovine serum (FBS) (Hyclone, Logan, Utah, USA), 1% P/S, 1% MEM-nonessential amino acids, and 0.1 mM β-mercaptoethanol. M2-10B4 cells were inactivated with 10 μg/mL mitomycin C in M2-10B4-conditioned media for 3 hours at 37°C with 5% CO2 prior to culture on gelatin- (Sigma) coated plates. Sorted CD34+CD73- and CD34+CD73+ cells were cultured on Matrigel- (Becton Dickenson Biosciences, San Jose, CA, USA) coated plates and grown in EBM-2 (Lonza, Walkersville, MD, USA) media containing EGM-2 MV SingleQuots including 5% FBS, 0.04% hydrocortisone, 0.4% human fibroblast growth factor (hFGF), 0.1% vascular endothelial growth factor (VEGF), 0.1% insulin-like growth factor (IGF-1), 0.1% ascorbic acid, 0.1% human epidermal growth factor (hEGF), 0.1% GA-1000 (Gentamicin Sulfate and Amphotericin-B). Sorted CD34-CD73+ cells were plated onto gelatin-coated plates and grown in mesenchymal stem cell (MSC) media containing αMEM (Invitrogen) supplemented with 10% FBS, 1% P/S, 1% MEM-nonessential amino acids, 1mM L-glutamine and 0.1 mM β-mercaptoethanol. For sorted cells, media changes occurred every 2-3 days. Human BM-MSCs were either derived from bone marrow aspirates obtained from normal volunteers, following approval of the protocol by the Mayo Institutional Review Board and obtaining informed consent, or isolated from whole bone marrow (AllCells, Emeryville, CA, USA) using standard methods [50]. BM-MSCs were cultured in MSC media as described above. Adherent cells were selected for during culture expansion. Media changes occurred every 2-3 days and were passaged upon 80-90% confluency. Neonatal human dermal fibroblasts (NHDFs) were cultured in DMEM high glucose supplemented with 10% FBS, 1% NEAA, 1% L-glutamine and 1% P/S. Media changes occurred every 3-4 days and were passaged upon 80-90% confluency.
Mesenchymal Differentiation by Stromal Co-culture
Mesenchymal differentiation of hESCs occurred after culture on stromal cell layers. hESCs were passaged onto M2-10B4 mouse stromal cells with differentiation media consisting of RPMI supplemented with 15% defined FBS (Hyclone), 2 mM L-glutamine, 0.1 mM β-mercaptoethanol, 1% MEM-nonessential amino acids, and 1% P/S. Media was changed every 2-3 days. After 10-17 days, differentiated hESCs were made into a single cell suspension by treatment with Collagenase IV (1mg/ml) (Invitrogen), followed by 0.05% Trypsin/EDTA (Gibco/Invitrogen) supplemented with 2% chick serum (Sigma) [32, 48, 49].
Flow Cytometric Analysis and Enrichment
Single-cell suspensions of differentiated hESCs and M2-10B4s were prepared as previously described [32, 48, 49]. Cells were treated with an antibody against human CD73 conjugated with PE (Pharmingen, San Jose, CA, USA). Antibodies for PE conjugated with magnetic beads were used to select CD73+ cells from single cell suspension using the EasySep PE selection kit (Stemcell Technologies, Inc., Vancouver, BC, Canada). Post-sorted CD73+ cells were plated under MSC conditions. For flow cytometric analysis, post-sorted cell populations were washed with Mg2+ and Ca2+-free phosphate buffered saline (PBS) (Hyclone) and removed from culture plates using 0.25% Trypsin/EDTA. After washing with PBS supplemented with 2% FBS and 0.1% sodium azide, the cells were incubated with antibodies for CD34-APC and CD73-PE (all IgG1, all from Pharmingen, San Jose, CA, USA) and their corresponding IgG1 controls. Live cell populations identified using 7AAD exclusion were analyzed on FACS Calibur (Becton Dickenson, Franklin Lakes, NJ, USA) for different surface antigen expression using Flow-Jo Software (TreeStar, Ashland, OR, USA). For cell sorting, cells were prepared in buffers as described above but without sodium azide, and 7AAD was not used as a live cell indicator. Cells of the following surface antigen populations: CD34+CD73-, CD34+CD73+, and CD34-CD73+, were sorted using FACS Aria (Becton Dickenson), and collected in either EGM-2 media (CD34+CD73- and CD34+CD73+ cells) or MSC media (CD34-CD73+ cells). Sorted cells were either plated on Matrigel- or gelatin-coated 6-well plates (Nunc, Roskilde, Denmark) for further proliferation and subsequent passage (a total of 5 individual flow sorts) or on Matrigel- or gelatin-coated BD Falcon 4-chamber glass culture slides (BD Biosciences) for immunofluorescence analysis (a total of 2 individual flow sorts).
In Vivo Osteogenic Differentiation by Subcutaneous Pellet Implantation
hESC-derived CD73+ MSCs with constitutive expression of GFP and luciferase, BM-derived MSCs and NHDFs were cultured for one week in their respective basal media with osteogenic supplements dexamethasone (0.1 μM) and ascorbic acid (50 μg/mL). Cells from each group (1.5×106) were individually resuspended in 15 μl mouse fibrinogen (3.2 mg/ml, Enzyme Research, South Bend, IN) and 20 μl rat thrombin (25 U/ml, Sigma) and added to a human decellularized cancellous crushed bone chip (Allosource, Centennial, CO), creating a 3-dimensional pellet matrix.
6-8 week-old male Nod-SCID mice were anesthetized using Avertin (200 mg/kg 2,2,2 Tribromoethanol and 200μl/kg tert-amyl alcohol). The dorsum of each mouse was shaved and cleaned with 10% Povidone and 70% ethanol. Four small (5 mm) incisions were made in the four quadrants of each mouse dorsum. A subcutaneous pocket was made between the dermis and the underlying tissue. For each animal, a cell-seeded pellet with either GFP+luc+ hESC-derived MSCs, BM-derived MSCs, NHDFs, or non-donor cell controls, were implanted randomly into one of the four induced subcutaneous pockets and sutured with nylon sutures. All mice were housed, treated, and handled in accordance with the guidelines set forth by the University of Minnesota Institutional Animal Care and Use Committee.
Live Bioluminescent Imaging of hESC-derived Cells
Prior to imaging, mice were anesthetized with Avertin. Anesthetized mice were injected intraperitoneally with D-luciferin substrate (150 μl of 25.0 mg/mL in PBS; Xenogen, Alameda, CA). At 10 minutes after injection, luciferase activity was detected as emitted light by exposure to an intensified, charge-coupled device camera for 1 minute using the Xenogen imaging system (series 50). All images were analyzed by Living Image software (version 2.50; Lake Oswago, OR).
Histological Examination of Explanted Pellets
Explanted pellets were fixed overnight in 10% formalin and transferred to 70% ethanol. Pellets were processed at the University of Minnesota's Masonic Cancer Center Pathology Shared Resource. Pellets were decalcified, embedded in paraffin and sectioned. Sections were either stained with H&E, Masson's Trichrome, Safranin O/Fast Green or left unstained for immunohistochemistry.
Immunofluorescence
Unstained, demineralized sections of an hESC-derived MSC-seeded pellet post-explantation were immunostained for GFP-expressing cells. Sections were deparaffinized, rehydrated and antigen retrieval was performed (Target Retrieval Solution, Dako, Carpinteria, CA). Sections were permeabilized using 0.25% Triton-X and blocked with 10% donkey serum. A 1:200 dilution of rabbit anti-GFP (Invitrogen) incubated overnight followed by a 1:200 dilution of FITC-conjugated donkey anti-rabbit (Jackson ImmunoResearch Labs, West Grove, PA) for 1 hour. Sections washed with donkey serum, dehydrated and cover-slipped with Prolong Gold plus DAPI. CD34+CD73-, CD34+CD73+ and CD34-CD73+ cells plated on 4-chamber glass slides were prepared for immunolabeling by washing with PBS and fixation with 10% formalin. Slides were blocked with 0.1% bovine serum albumin (BSA) in PBS. A 1:200 dilution of mouse anti-human CD73 (Abcam, Cambridge, MA, USA) incubated overnight was followed by 1:400 dilution of anti-mouse AlexaFluor 555 (Molecular Probes, Eugene, OR, USA) for 1 hour. Mouse anti-human CD34-FITC (Pharmingen) was added at a 1:11.5 dilution overnight. Slides were washed with 0.1% BSA and cover-slips were affixed with Prolong Gold plus DAPI (Invitrogen) overnight. Mouse anti-human IgG1 (eBioscences, San Diego, CA, USA) and mouse anti-human IgG1-FITC (Pharmingen) were used as isotype controls. hESC-derived CD34-CD73+ cells and BM-MSCs were prepared as above with PBS, formalin fixation and BSA blocking and given a 1:100 dilution of mouse anti-human FLK-1 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) overnight, followed by a 1:200 dilution of anti-mouse AlexaFluor 488. Slides were processed as above with BSA and cover-slipped with Prolong Gold plus DAPI. Immunofluorescent cells were imaged on a Zeiss Axiovert 200M fluorescent microscope (Zeiss) with AxioVision Ver. 4.6 imaging software (Zeiss).
MSC Differentiation Assays
Sorted CD34+CD73-, CD34+CD73+, and CD34-CD73+ cells underwent mesenchymal differentiation for osteo-, chondro- and adipogenic differentiation. Cells were plated on culture dishes prepared with 0.1% gelatin and cultured in osteogenic supplemented media for up to 4 weeks. Osteogenic supplement: α-MEM supplemented with 10% FBS, 2 mM L-glutamine, 1% MEM-nonessential amino acids, 1% P/S, dexamethasone (0.1 μM), β -glycerolphosphate (10 mM), and ascorbic acid (50 μg/mL). Cells were plated on culture dishes prepared with 0.1% gelatin and cultured in adipogenic supplemented media for up to 4 weeks. Adipogenic supplement: α-MEM supplemented with 10% FBS, 2 mM L-glutamine, 1% MEM-nonessential amino acids, 1% P/S, dexamethasone (0.5 μM), isobutyl xanthine (0.5 μM) and indomethacine (60 μM). Cells (2.5×105) were spun into a pellet and cultured in a conical tube in chondrogenic supplemented media for up to 4 weeks. Chondrogenic supplement: α-MEM supplemented as above with FBS, L-glutamine, NEAA and P/S, including TGF-β (10 μg/mL) and ascorbic acid (45 μg/mL). After 4 weeks, osteogenic, adipogenic and chondrogenic cultures were fixed with 10% formalin and stained with von Kossa, Oil Red O or Alcian Blue staining, respectively. Chondrogenic cell pellets were embedded in paraffin wax, and sectioned. Stained cultures were imaged on a Zeiss Axiovert 200M fluorescent microscope (Zeiss) with AxioVision Ver. 4.6 imaging software (Zeiss).
Polymerase Chain Reaction
RNA was extracted from osteogenic, chondrogenic and adipogenic samples using the Qiagen RNeasy Kit (Valencia, CA). Reverse-transcription (RT) reactions were done using Superscript RTIII (Invitrogen Life Technologies) according to the manufacturer's instructions. RT reactions were primed using oligo(dT) primers. Polymerase chain reactions (PCRs) were done with GoTaq (Promega) using 100-150ng product per reaction according to the manufacturer's conditions. Conditions used for PCR were as follows: 10 minutes at 95°C, 35 cycles of 95°C for 30 seconds, annealing temperature (Ta, noted with primer sequence) for 30 seconds, and 72°C for 60 seconds. A final 10 minutes at 72°C was included at the end. Primers used: GAPDH-FWD: GAAGGTGAAGGTCGGAGT, REV: GAAGATGGTGATGGGATTTC (Ta: 58°C); RUNX2-FWD: CCAAATTTGCCTAACCAGAA, REV: GCTCGATTGCAATTGTCTCT (Ta: 58°C); SOX9-FWD: GTACCCGCACTTGCACAAC, REV: TCGCTCTCGTTCAGAAGTCTC (Ta: 54°C); PPARγ-FWD: GCCAAAAGCATTCCTGGTT, REV: TTGGGCTCCATAAAGTCACC (Ta: 58°C) Products were analyzed on 1% agarose gel and visualized with ethidium bromide staining.
cDNA Array Analysis
A cDNA array (PAHS-082, SA Biosciences, Frederick, MD) focused on MSC genes was completed using 1-2 μg of RNA extracted from BM-derived MSCs and hESC-derived CD34+CD73-, CD34+CD73+ and CD34-CD73+ MSCs. cDNA array used two replicates for all hESC-derived MSC populations and BM-derived MSCs. Selected genes were considered up-regulated or down-regulated only upon at least a 3-fold change in expression in both of the array replicates. Average fold changes were calculated only if a gene change met this qualification.
Derivation of hESC-derived CD73+ MSCs
We have previously demonstrated hESCs differentiation via co-culture with M2-10B4 cells leads to development of CD34+ cells with the ability to develop into blood and endothelial cell lineages [32-34, 48, 49]. Here, we evaluated this differentiated cell population at various time points for markers of human MSCs. These analyses demonstrate that some CD34+ hESC-derived cells also co-express CD73 (Figure 1A), as well as some CD34-CD73+ cells after 14-17 days of differentiation. To initially demonstrate MSC potential of the hESC-derived CD73+ cells, we sorted the CD73+ cells (including both CD34+CD73+ and CD34-CD73+ cells) into media to support MSC proliferation. Under these conditions, these cells developed into a population with an MSC phenotype, while losing expression of CD34 over a period of 12 days (Figure 1B). Specifically, these putative hESC-derived cells expressed typical MSC markers, including CD90, CD105, CD44, and CD71 (Figures 1C-E). To confirm that the sorted CD73+ cells were multipotent, cells were placed into culture conditions conducive for osteogenic, chondrogenic, and adipogenic differentiation (Figures 1F-H). Osteogenic cultures stained positive for mineralization using von Kossa and expressed transcripts for RUNX2 (Figures 1F and I), chondrogenic cultures stained positive for glycosaminoglycans using an Alcian Blue stain and expressed transcripts for SOX9 (Figures G and I), and adipogenic cultures stained positive for lipid accumulation using Oil Red O stain and expressed transcripts for PPARγ (Figures 1H and I). This trilineage developmental potential along with appropriate phenotypic markers for MSCs suggests the sorted hESC-derived CD34+ cells that subsequently differentiate into CD34-CD73+ cells function as MSCs.
Figure 1
Figure 1
Generation of hESC-derived MSCs
hESC-derived MSC In Vivo Bone Generation
For functional in vivo confirmation of osteogenic differentiation, GFP+Luc+ hESC-derived MSCs partially differentiated under in vitro osteogenic culture conditions, were resuspended in a fibrinogen and thrombin matrix and added to a decellularized human bone chip to form a 3-dimensional pellet construct. Additionally, pellets were made using BM-derived MSCs, NHDFs and controls with no donor cells. Pellets were implanted subcutaneously into the dorsum of male Nod-SCID mice. After nine weeks post-surgical implantation, mice were shown to maintain luciferase expression within GFP+Luc+ hESC-derived MSC implants using a luminescence imager (Figure 2A). Explanted hESC-derived MSC pellets were also imaged for luciferase-expressing donor cells, and show robust survival of donor cells 9 weeks post-implantation (Figure 2B). Immunohistological analysis of the explanted GFP+Luc+ hESC-derived MSC pellet showed periodic expression of GFP+ donor cells (Figure 2C, white arrowheads) located along the boundary of osteoid or mineralized tissue within the explants (Figure 2D, dotted line). Histological staining for H&E and Masson's Trichrome identified areas that exhibited morphological evidence of mineralization (Figure 2E-L). Safranin O/Fast green was also used, confirming the absence of cartilage production (data not shown). Controls with no donor cells showed collagen positive areas (Figure 2I), however apart from the decellularized bone chip within the scaffold (Figure 2E-L, dark lines), no areas were morphologically similar to osteoid matrix (Figure 2E). Similar results were seen in pellets composed of NHDFs (Figure 2F,J) and surprisingly, BM-derived MSCs (Figure 2G,K). Unlike pellets composed of non cell controls, NHDFs and BM-derived MSCs, pellets with hESC-derived MSCs exhibited typical morphological evidence of osteogenesis, including wide ranging collagen staining (Figure 2L, dotted lines, black arrow) in areas composed of osteoid matrix (Figure 2H, dotted lines, black arrow).
Figure 2
Figure 2
In Vivo hESC-derived MSC Bone Generation within Subcutaneous Pellet
MSCs from a homozygous population of hESC-derived CD34+ CD73+ cells
We sought to compare the MSC potential of both the CD34+CD73- and CD34+CD73+ populations. We used flow cytometry to sort for two separate populations of cells: CD34+CD73- and CD34+CD73+ cells. Both populations of CD34+ cells were cultured in conditions conducive to attachment and expansion in vitro. Cells with a CD34+CD73+ phenotype were sorted from differentiated hESCs (Figure 3A-B) and cultured for up to 3 weeks. We observed over this time course that the CD34+CD73+ cells gradually lost phenotypic expression of CD34, while maintaining expression of CD73 (Figure 3C-F). Immunofluorescent microscopy of sorted cells confirmed the co-expression for both CD34 and CD73 on a single cell showing typical MSC morphology; additionally demonstrating co-expression was not an artifact from flow cytometry (Figure 3G-H). The resulting CD34-CD73+ cells exhibited typical MSC phenotype markers, including CD73, CD105, CD71 and CD44 (Figure 4A). When the resulting CD34-CD73+ cells were put into specific differentiation conditions, we were able to demonstrate osteogenic, chondrogenic, and adipogenic differentiation (Figure 4B-D).
Figure 3
Figure 3
Time course of MSC development and surface antigen expression from hESC-derived CD34+CD73+ cells
Figure 4
Figure 4
Antigen expression of CD34+CD73+-derived MSCs from hESCs
MSCs from hESC-derived CD34+ CD73- cells
Next, we evaluated the MSC potential of hESC-derived CD34+CD73- cells (Figure 5AB). In contrast to the CD34+CD73+ cells after only 1 week of culture, cells that were CD34+CD73- developed into a 90-95% CD73+ population (Figure 5C-D). A majority of cells (80%) were CD34-CD73+, but a small population (10%) of cells still maintained a CD34+ expression, though nearly all CD34+ cells were also CD73+ (Figure 5D). After 3 weeks of culture expansion, the CD34+CD73- population of cells was almost entirely CD34-CD73+ cells (Figure 5E-F). As with CD34+CD73+ sorted cells, CD34+CD73- sorted cells were also analyzed using immunofluorescence for expression of CD34 and CD73 (Fig 5G-H). Immunofluorescent imaging of sorted CD34+CD73- cells confirmed the co-expression patterns of CD34 and CD73 on a single cell (Figure 5G). Compared to CD34+CD73+ cells, these cells failed to express CD34 after a prolonged time in culture. Again, this confirms flow cytometric analysis (Figure 5H). Again, the resulting CD34-CD73+ cells exhibited typical phenotypic surface antigens indicative of MSCs, including CD73, CD105, CD71 and CD44 (Figure 6A). When these CD34-CD73+ cells were put into specific differentiation conditions, we were able to demonstrate osteogenic, chondrogenic, and adipogenic differentiation (Figure 6B-D). Taken together, CD34+CD73- and CD34+CD73+ cell populations derived from hESCs appear to be progenitor populations of cells that differentiate into multipotent MSCs, though with differing kinetics.
Figure 5
Figure 5
Time course of MSC development and surface antigen expression from hESC-derived CD34+CD73- cells
Figure 6
Figure 6
Antigen expression of post-sorted CD34+CD73--derived MSCs from hESCs
cDNA Array Analysis
Next, we used focused MSC cDNA arrays to evaluate the gene expression in the three hESC-derived MSCs populations compared to BM-derived MSCs. The result of the cDNA arrays showed a distinct gene expression pattern between all hESC-derived MSCs populations compared to BM-MSCs (Figure 7). There is a significantly higher expression of genes associated with pluripotent or multipotent stem cells, REX-1, human Telomerase Reverse Transcriptase (hTERT) and CD133 (Figure 7A-C) in all hESC-derived MSCs compared to BM-derived MSCs. The hemato-endothelial genes vWF, and FLK-1(Figure 7D-E) were also present in all three hESC-derived MSCs at significantly higher levels compared to BM-derived MSCs. Immunostaining for FLK-1 confirms the increased cellular expression of FLK-1 on hESC-derived MSCs (Figure 7Q), compared to expression of FLK-1 that is reduced in BM-derived MSCs (Figure 7R). hESC-derived MSCs also exhibited consistently higher expression values for a greater range of MSC lineage differentiation markers (Figure 7F-J), suggesting the potential for increased developmental potency of the hESC-derived MSCs. Additionally, common surface antigens/receptors typically expressed by BM-derived MSCs such as CD13, CD15, CD105, CD106, CD271 and VEGFA (Figure 7K-P) are found at reduced levels in all populations of hESC-derived MSCs.
Figure 7
Figure 7
cDNA gene array expression data comparing hESC-derived MSCs and BM-derived MSCs
While hESC-derived MSCs have been previously isolated and characterized [35-41], here we advance these studies to better define the phenotypic and functional precursor cell populations that give rise to these MSCs. In these studies, both hESC-derived CD34+CD73- and CD34+CD73+ cells were induced into functional CD73+ MSCs with the ability to differentiate into terminal mesenchymal lineages. The specific isolation of functional MSCs from hESC-derived CD34+CD73- cells that differentiate into CD34+CD73+ and CD34-CD73+ cells provides new insight for mesodermal development and differentiation. Previously, our group and others have shown the hemato-endothelial potential of hESC-derived CD34+ cells [29, 32-34, 51, 52], but these data also demonstrate a mesenchymal potential of hESC-derived CD34+ cells. These cellular and genetic analyses suggest that hESC-derived CD34+ cells have unique characteristics compared to MSCs cultured from bone marrow.
Within this study, we find that the hESC-derived CD34+ populations phenotypically change during expansion by acquiring and retaining a CD73+ mesenchymal lineage. Culture expanded hESC-derived CD34+CD73- cells developed and maintained CD73 expression and lost CD34 expression. The time course for CD34 expression loss in CD34+CD73- cells was more rapid compared to hESC-derived CD34+CD73+ cells. All CD34-CD73+ populations that were derived from CD34+CD73- and CD34+CD73+ cell populations were phenotypically characterized as MSCs with multiple mesenchymal surface markers, along with successful differentiation into osteogenic, chondrogenic and adipogenic lineages.
Previous studies of hESC-derived MSCs [35-41] have not evaluated the precursor or progenitor populations that gave rise to these cells. CD34 has typically been considered a marker for hemato-endothelial stem/precursor cells. Evidence here suggests that CD73+ MSCs may be derived from cells of a CD34+ lineage. Interestingly, the gene expression studies characterize these cells to have increased expression patterns of genes associated with hemangioblast cells and pericytes (CD133 and FLK-1) compared to adult BM-MSCs; whereas typical genes associated with adult MSCs, including CD13, CD15, CD105, CD106, CD271, and VEGFA show decreased expression patterns when hESC-derived MSCs are compared to adult BM-MSCs. Also of interest are the increased expression in hESC-derived MSCs of genes typically associated with pluripotent stem cells, such as hTERT and REX-1. hESC-derived MSCs may function as a multipotent population of stem cells for longer passages compared to their adult BM counterparts, thus making their usage more practical for research and clinical purposes. Further analysis of the gene expression data in specific cell populations demonstrates that the expression of genes typically associated with pluripotency (hTERT, REX-1, CD133) are expressed most in the MSCs derived from CD34+CD73- cells, at intermediate levels in MSCs derived from CD34+CD73- cells, and at lower levels in the MSCs derived from CD34-CD73+ cells. Overall, these results demonstrate that the starting cell population used to derive MSCs affects the gene expression pattern in the cultured MSC population. These differences in gene expression may mediate functional differences between the cultured cells. Additionally, considering the multipotent mesenchymal nature of these cells, this could indicate that CD34+ cells derived from hESCs are a mesodermal precursor stem cell.
Interestingly, several studies using other systems demonstrate MSCs can be derived from postnatal CD34 expressing cells [42, 43, 53, 54]. Better defining the phenotype and functional characteristics of MSCs derived from hESCs is interesting in the context of other MSCs studies. Early work on MSCs by Simmons and Torok-Storb identified a population of CD34+ cells (~5%) from adult human bone marrow that co-expressed the mesenchymal marker STRO-1 [42]. These cells were successfully able to differentiate into fibroblasts, adipocytes, smooth muscle cells and macrophages. Second, a population of CD34+CD45+ cells was found to produce adherent fibroblast-like cell colonies [43]. Adherent cells quickly lost expression of CD34, but did express other mesenchymal markers, including CD73, CD90 and CD105, and induced differentiation produced positive multipotent cultures. Third, CD34+ cells from human bone marrow were shown to differentiate into osteogenic cells capable of forming in vitro mineralized nodules [53]. Fourth, CD34+ cells were found to localize to the fracture sites of immunocompromised rat femurs and subsequently enhancing fracture healing through endothelial and osteogenic differentiation [54]. Last, OCN, a marker for osteogenic lineage differentiation, has been found co-localized on CD34+ circulating cells of peripheral blood [44-46].
We define two distinct hESC-derived CD34+ cells that serve to function as MSC progenitor cells. Both CD34+CD73- and CD34+CD73+ cell populations differentiated during in vitro expansion towards a CD34-CD73+ lineage. Both differentiated populations co-expressed numerous mesenchymal markers and were successful in multipotent differentiation. CD34 has traditionally been used as a marker that selects against MSC's; however, we have shown that two progenitor cell populations expressing CD34 have differentiated into functional MSCs. Because fetal- and adult-derived MSCs appear to have some limitations, including disparate differentiation tendencies [17-21], we postulate that hESC-derived MSCs will provide improved opportunities for regenerative medicine. CD34 has been linked to cellular homing patterns to the bone marrow [55] and also adhesion of cells to stromal microenvironments or sites of inflammation [56, 57]. Multiple studies show CD34+ cells derived from hESCs are capable of functional hemato-endothelial development [28-34]. However, the relationship between CD34 and hESC-derived MSC progenitor cells remains unclear. Future studies are aimed at the developmental hierarchy of CD34 and MSCs, the functional engraftment of our hESC-derived MSC progenitor cells and the potential clinical application for bone and tissue repair.
Acknowledgements
We would like to thank Dr. Genya Gekker for her assistance in the operation and data analysis for flow cytometry and sorting. We would like to thank the Masonic Cancer Center Pathology Shared Resource at the University of Minnesota for explant processing and histology. We would also like to thank Jeremy Allred and Dr. Anita Undale for their technical assistance. This project was supported by: NIH/NHLBI R01-HL77923 (DSK), a University of Minnesota-Mayo Clinic Collaborative Grant (DSK and SK), and the Minnesota Craniofacial Research Training Program (RAK). The project described was supported by Grant Numbers T32DE007288 and F32DE020976 from the National Institute of Dental & Craniofacial Research. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institute of Dental & Craniofacial Research or the National Institutes of Health.
Supported by: NIH/NHLBI R01-77923 (DSK), a University of Minnesota-Mayo Clinic Collaborative Grant (DSK and SK), the Minnesota Craniofacial Research Training Program, NIH/NIDCR Grant #s T32DE007288 and F32DE020976-01(RAK)
Footnotes
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
1. Lazarus HM, Haynesworth SE, Gerson SL, Rosenthal NS, Caplan AI. Ex vivo expansion and subsequent infusion of human bone marrow-derived stromal progenitor cells (mesenchymal progenitor cells): implications for therapeutic use. Bone Marrow Transplant. 1995;16:557–64. [PubMed]
2. Guilak F, Awad HA, Fermor B, Leddy HA, Gimble JM. Adipose-derived adult stem cells for cartilage tissue engineering. Biorheology. 2004;41:389–99. [PubMed]
3. Young HE, Steele TA, Bray RA, Hudson J, Floyd JA, Hawkins K, et al. Human reserve pluripotent mesenchymal stem cells are present in the connective tissues of skeletal muscle and dermis derived from fetal, adult, and geriatric donors. Anat Rec. 2001;264:51–62. [PubMed]
4. Seo BM, Miura M, Gronthos S, Bartold PM, Batouli S, Brahim J, et al. Investigation of multipotent postnatal stem cells from human periodontal ligament. Lancet. 2004;364:149–55. [PubMed]
5. Erices A, Conget P, Minguell JJ. Mesenchymal progenitor cells in human umbilical cord blood. Br J Haematol. 2000;109:235–42. [PubMed]
6. Caplan AI. Adult mesenchymal stem cells for tissue engineering versus regenerative medicine. J Cell Physiol. 2007;213:341–7. [PubMed]
7. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, et al. Multilineage potential of adult human mesenchymal stem cells. Science. 1999;284:143–7. [PubMed]
8. Petite H, Viateau V, Bensaid W, Meunier A, de Pollak C, Bourguignon M, et al. Tissue-engineered bone regeneration. Nat Biotechnol. 2000;18:959–63. [PubMed]
9. Uematsu K, Hattori K, Ishimoto Y, Yamauchi J, Habata T, Takakura Y, et al. Cartilage regeneration using mesenchymal stem cells and a three-dimensional polylactic-glycolic acid (PLGA) scaffold. Biomaterials. 2005;26:4273–9. [PubMed]
10. Maitra B, Szekely E, Gjini K, Laughlin MJ, Dennis J, Haynesworth SE, et al. Human mesenchymal stem cells support unrelated donor hematopoietic stem cells and suppress T-cell activation. Bone Marrow Transplant. 2004;33:597–604. [PubMed]
11. Aggarwal S, Pittenger MF. Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood. 2005;105:1815–22. [PubMed]
12. Lazarus HM, Koc ON, Devine SM, Curtin P, Maziarz RT, Holland HK, et al. Cotransplantation of HLA-identical sibling culture-expanded mesenchymal stem cells and hematopoietic stem cells in hematologic malignancy patients. Biol Blood Marrow Transplant. 2005;11:389–98. [PubMed]
13. Shake JG, Gruber PJ, Baumgartner WA, Senechal G, Meyers J, Redmond JM, et al. Mesenchymal stem cell implantation in a swine myocardial infarct model: engraftment and functional effects. Ann Thorac Surg. 2002;73:1919–25. discussion 1926. [PubMed]
14. Zhang S, Jia Z, Ge J, Gong L, Ma Y, Li T, et al. Purified human bone marrow multipotent mesenchymal stem cells regenerate infarcted myocardium in experimental rats. Cell Transplant. 2005;14:787–98. [PubMed]
15. Zhang S, Ge J, Sun A, Xu D, Qian J, Lin J, et al. Comparison of various kinds of bone marrow stem cells for the repair of infarcted myocardium: single clonally purified non-hematopoietic mesenchymal stem cells serve as a superior source. J Cell Biochem. 2006;99:1132–47. [PubMed]
16. Yamada Y, Yokoyama S, Fukuda N, Kidoya H, Huang XY, Naitoh H, et al. A novel approach for myocardial regeneration with educated cord blood cells cocultured with cells from brown adipose tissue. Biochem Biophys Res Commun. 2007;353:182–8. [PubMed]
17. Bieback K, Kern S, Kluter H, Eichler H. Critical parameters for the isolation of mesenchymal stem cells from umbilical cord blood. Stem Cells. 2004;22:625–34. [PubMed]
18. Chang YJ, Shih DT, Tseng CP, Hsieh TB, Lee DC, Hwang SM. Disparate mesenchyme-lineage tendencies in mesenchymal stem cells from human bone marrow and umbilical cord blood. Stem Cells. 2006;24:679–85. [PubMed]
19. Kern S, Eichler H, Stoeve J, Kluter H, Bieback K. Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells. 2006;24:1294–301. [PubMed]
20. Rebelatto CK, Aguiar AM, Moretao MP, Senegaglia AC, Hansen P, Barchiki F, et al. Dissimilar differentiation of mesenchymal stem cells from bone marrow, umbilical cord blood, and adipose tissue. Exp Biol Med (Maywood) 2008;233:901–13. [PubMed]
21. in 't Anker PS, Noort WA, Scherjon SA, Kleijburg-van der Keur C, Kruisselbrink AB, van Bezooijen RL, et al. Mesenchymal stem cells in human second-trimester bone marrow, liver, lung, and spleen exhibit a similar immunophenotype but a heterogeneous multilineage differentiation potential. Haematologica. 2003;88:845–52. [PubMed]
22. Siddappa R, Licht R, van Blitterswijk C, de Boer J. Donor variation and loss of multipotency during in vitro expansion of human mesenchymal stem cells for bone tissue engineering. J Orthop Res. 2007;25:1029–41. [PubMed]
23. Wagner W, Ho AD. Mesenchymal stem cell preparations--comparing apples and oranges. Stem Cell Rev. 2007;3:239–48. [PubMed]
24. Evans MJ, Kaufman MH. Establishment in culture of pluripotential cells from mouse embryos. Nature. 1981;292:154–6. [PubMed]
25. Martin GR. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A. 1981;78:7634–8. [PubMed]
26. Thomson JA, Kalishman J, Golos TG, Durning M, Harris CP, Becker RA, et al. Isolation of a primate embryonic stem cell line. Proc Natl Acad Sci U S A. 1995;92:7844–8. [PubMed]
27. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, et al. Embryonic stem cell lines derived from human blastocysts. Science. 1998;282:1145–7. [PubMed]
28. Wang L, Li L, Shojaei F, Levac K, Cerdan C, Menendez P, et al. Endothelial and hematopoietic cell fate of human embryonic stem cells originates from primitive endothelium with hemangioblastic properties. Immunity. 2004;21:31–41. [PubMed]
29. Zambidis ET, Peault B, Park TS, Bunz F, Civin CI. Hematopoietic differentiation of human embryonic stem cells progresses through sequential hematoendothelial, primitive, and definitive stages resembling human yolk sac development. Blood. 2005;106:860–70. [PubMed]
30. Kennedy M, D'Souza SL, Lynch-Kattman M, Schwantz S, Keller G. Development of the hemangioblast defines the onset of hematopoiesis in human ES cell differentiation cultures. Blood. 2007;109:2679–87. [PubMed]
31. Lu SJ, Feng Q, Caballero S, Chen Y, Moore MA, Grant MB, et al. Generation of functional hemangioblasts from human embryonic stem cells. Nat Methods. 2007;4:501–9. [PubMed]
32. Kaufman DS, Hanson ET, Lewis RL, Auerbach R, Thomson JA. Hematopoietic colony-forming cells derived from human embryonic stem cells. Proc Natl Acad Sci U S A. 2001;98:10716–21. [PubMed]
33. Kaufman DS, Lewis RL, Hanson ET, Auerbach R, Plendl J, Thomson JA. Functional endothelial cells derived from rhesus monkey embryonic stem cells. Blood. 2004;103:1325–32. [PubMed]
34. Woll PS, Morris JK, Painschab MS, Marcus RK, Kohn AD, Biechele TL, et al. Wnt signaling promotes hematoendothelial cell development from human embryonic stem cells. Blood. 2008;111:122–31. [PubMed]
35. Barberi T, Willis LM, Socci ND, Studer L. Derivation of multipotent mesenchymal precursors from human embryonic stem cells. PLoS Med. 2005;2:e161. [PMC free article] [PubMed]
36. Trivedi P, Hematti P. Simultaneous generation of CD34+ primitive hematopoietic cells and CD73+ mesenchymal stem cells from human embryonic stem cells cocultured with murine OP9 stromal cells. Exp Hematol. 2007;35:146–54. [PubMed]
37. Trivedi P, Hematti P. Derivation and immunological characterization of mesenchymal stromal cells from human embryonic stem cells. Exp Hematol. 2008;36:350–9. [PMC free article] [PubMed]
38. Olivier EN, Rybicki AC, Bouhassira EE. Differentiation of human embryonic stem cells into bipotent mesenchymal stem cells. Stem Cells. 2006;24:1914–22. [PubMed]
39. Lian Q, Lye E, Suan Yeo K, Khia Way Tan E, Salto-Tellez M, Liu TM, et al. Derivation of clinically compliant MSCs from CD105+, CD24- differentiated human ESCs. Stem Cells. 2007;25:425–36. [PubMed]
40. Brown SE, Tong W, Krebsbach PH. The derivation of mesenchymal stem cells from human embryonic stem cells. Cells Tissues Organs. 2009;189:256–60. [PMC free article] [PubMed]
41. Arpornmaeklong P, Brown SE, Wang Z, Krebsbach PH. Phenotypic Characterization, Osteoblastic Differentiation and Bone Regeneration Capacity of Human Embryonic Stem Cell-derived Mesenchymal Stem Cells. Stem Cells Dev. 2009 [PMC free article] [PubMed]
42. Simmons PJ, Torok-Storb B. CD34 expression by stromal precursors in normal human adult bone marrow. Blood. 1991;78:2848–53. [PubMed]
43. Kaiser S, Hackanson B, Follo M, Mehlhorn A, Geiger K, Ihorst G, et al. BM cells giving rise to MSC in culture have a heterogeneous CD34 and CD45 phenotype. Cytotherapy. 2007;9:439–50. [PubMed]
44. Eghbali-Fatourechi GZ, Lamsam J, Fraser D, Nagel D, Riggs BL, Khosla S. Circulating osteoblast-lineage cells in humans. N Engl J Med. 2005;352:1959–66. [PubMed]
45. Eghbali-Fatourechi GZ, Modder UI, Charatcharoenwitthaya N, Sanyal A, Undale AH, Clowes JA, et al. Characterization of circulating osteoblast lineage cells in humans. Bone. 2007;40:1370–7. [PMC free article] [PubMed]
46. Gossl M, Modder UI, Atkinson EJ, Lerman A, Khosla S. Osteocalcin expression by circulating endothelial progenitor cells in patients with coronary atherosclerosis. J Am Coll Cardiol. 2008;52:1314–25. [PMC free article] [PubMed]
47. Tondreau T, Meuleman N, Delforge A, Dejeneffe M, Leroy R, Massy M, et al. Mesenchymal stem cells derived from CD133-positive cells in mobilized peripheral blood and cord blood: proliferation, Oct4 expression, and plasticity. Stem Cells. 2005;23:1105–12. [PubMed]
48. Tian X, Kaufman DS. Hematopoietic development of human embryonic stem cells in culture. Methods Mol Biol. 2008;430:119–33. [PubMed]
49. Hill KL, Kaufman DS. Hematopoietic differentiation of human embryonic stem cells by cocultivation with stromal layers. Curr Protoc Stem Cell Biol. 2008;6 Chapter 1:Unit 1F. [PubMed]
50. Hicok KC, Thomas T, Gori F, Rickard DJ, Spelsberg TC, Riggs BL. Development and characterization of conditionally immortalized osteoblast precursor cell lines from human bone marrow stroma. J Bone Miner Res. 1998;13:205–17. [PubMed]
51. Chadwick K, Wang L, Li L, Menendez P, Murdoch B, Rouleau A, et al. Cytokines and BMP-4 promote hematopoietic differentiation of human embryonic stem cells. Blood. 2003;102:906–15. [PubMed]
52. Vodyanik MA, Bork JA, Thomson JA, Slukvin II. Human embryonic stem cell-derived CD34+ cells: efficient production in the coculture with OP9 stromal cells and analysis of lymphohematopoietic potential. Blood. 2005;105:617–26. [PubMed]
53. Chen JL, Hunt P, McElvain M, Black T, Kaufman S, Choi ES. Osteoblast precursor cells are found in CD34+ cells from human bone marrow. Stem Cells. 1997;15:368–77. [PubMed]
54. Matsumoto T, Kawamoto A, Kuroda R, Ishikawa M, Mifune Y, Iwasaki H, et al. Therapeutic potential of vasculogenesis and osteogenesis promoted by peripheral blood CD34-positive cells for functional bone healing. Am J Pathol. 2006;169:1440–57. [PubMed]
55. Greenberg AW, Kerr WG, Hammer DA. Relationship between selectin-mediated rolling of hematopoietic stem and progenitor cells and progression in hematopoietic development. Blood. 2000;95:478–86. [PubMed]
56. Healy L, May G, Gale K, Grosveld F, Greaves M, Enver T. The stem cell antigen CD34 functions as a regulator of hemopoietic cell adhesion. Proc Natl Acad Sci U S A. 1995;92:12240–4. [PubMed]
57. Gangenahalli GU, Singh VK, Verma YK, Gupta P, Sharma RK, Chandra R, et al. Hematopoietic stem cell antigen CD34: role in adhesion or homing. Stem Cells Dev. 2006;15:305–13. [PubMed]