PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jvirolPermissionsJournals.ASM.orgJournalJV ArticleJournal InfoAuthorsReviewers
 
J Virol. Oct 2010; 84(19): 9677–9684.
Published online Jul 21, 2010. doi:  10.1128/JVI.00978-10
PMCID: PMC2937807
Role of N-Linked Glycosylation of the 5-HT2A Receptor in JC Virus Infection[down-pointing small open triangle]
Melissa S. Maginnis, Sheila A. Haley, Gretchen V. Gee, and Walter J. Atwood*
Department of Molecular Biology, Cell Biology and Biochemistry, Brown University, Providence, Rhode Island 02912
*Corresponding author. Mailing address: Department of Molecular Biology, Cell Biology and Biochemistry, Brown University, 70 Ship Street, Providence, RI 02903. Phone: (401) 863-3116. Fax: (401) 863-9653. E-mail: Walter_Atwood/at/brown.edu
Received May 5, 2010; Accepted July 12, 2010.
JC virus (JCV) is a human polyomavirus and the causative agent of the fatal demyelinating disease progressive multifocal leukoencephalopathy (PML). JCV infection of host cells is dependent on interactions with cell surface asparagine (N)-linked sialic acids and the serotonin 5-hydroxytryptamine2A receptor (5-HT2AR). The 5-HT2AR contains five potential N-linked glycosylation sites on the extracellular N terminus. Glycosylation of other serotonin receptors is essential for expression, ligand binding, and receptor function. Also, glycosylation of cellular receptors has been reported to be important for JCV infection. Therefore, we hypothesized that the 5-HT2AR N-linked glycosylation sites are required for JCV infection. Treatment of 5-HT2AR-expressing cells with tunicamycin, an inhibitor of N-linked glycosylation, reduced JCV infection. Individual mutation of each of the five N-linked glycosylation sites did not affect the capacity of 5-HT2AR to support JCV infection and did not alter the cell surface expression of the receptor. However, mutation of all five N-linked glycosylation sites simultaneously reduced the capacity of 5-HT2AR to support infection and altered the cell surface expression. Similarly, tunicamycin treatment reduced the cell surface expression of 5-HT2AR. Mutation of all five N-linked glycosylation sites or tunicamycin treatment of cells expressing wild-type 5-HT2AR resulted in an altered electrophoretic mobility profile of the receptor. Treatment of cells with PNGase F, to remove N-linked oligosaccharides from the cell surface, did not affect JCV infection in 5-HT2AR-expressing cells. These data affirm the importance of 5-HT2AR as a JCV receptor and demonstrate that the sialic acid component of the receptor is not directly linked to 5-HT2AR.
The initial interaction between virus and host occurs via molecular interactions of viral attachment proteins and receptors on host cells. Therefore, receptor recognition is a critical host cell determinant and may play a key regulatory role in viral pathogenesis. The polyomavirus JC virus (JCV) is a ubiquitous human pathogen (21, 25, 32) that is initially subclinical yet establishes a persistent infection in the kidney (11). In immunosuppressed individuals JCV can become reactivated, leading to infection in the central nervous system (CNS) (13-15, 20), where the virus specifically targets glial cells, including astrocytes and the myelin-producing cells, oligodendrocytes (40, 48). JCV infection and cytolytic destruction of oligodendroglia cause the fatal disease progressive multifocal leukoencephalopathy (PML) (1, 22). The most common cause of PML is associated with human immunodeficiency virus (HIV) and AIDS (10, 23). However, in recent years PML has been reported in patients receiving immunosuppressive therapies for autoimmune diseases such as Crohn's disease (44), multiple sclerosis (MS) (24, 26, 28, 47), systemic lupus erythematosus (5, 33), and rheumatoid arthritis (5, 19, 37). The prognosis of PML is bleak, as the disease progresses rapidly and usually proves fatal within 1 year of the onset of symptoms. While current treatment options for PML are limited (23), recent studies suggest that mirtazapine, a serotonin receptor antagonist, may be capable of slowing the progression of PML (6, 27, 45, 46).
JCV has a nonenveloped, icosahedral capsid that encapsidates a circular double-stranded DNA (dsDNA) genome (39). JCV attachment to cells is mediated by an N-linked glycoprotein with either α(2,3)- or α(2,6)-linked sialic acid (16, 31), suggesting that N-linked glycosylation of cellular receptors is important for JCV infection. N-linked glycosylation is a posttranslational process by which oligosaccharides are added to asparagine residues, and this modification is important for protein processing, folding, expression, and function (43). Previous studies from our laboratory revealed that the JCV also requires the serotonin 5-hydroxytryptamine2A receptor (5-HT2AR) to mediate JCV infection (18, 35, 38), while others report that JCV infection can occur in the absence of 5-HT2AR (7, 8). 5-HT2AR is a seven-transmembrane-spanning G-protein-coupled receptor that belongs to a large family of 5-HT serotonin receptors. 5-HT2AR is abundantly expressed on cells in the brain (4), including glial cells (3), and in the kidney (4), which parallels the sites of JCV infection. N-linked glycosylation plays a key regulatory role in the function of serotonin receptors. Mutation of N-linked glycosylation sites in human 5-HT3AR and 5-HT5AR results in decreased expression at the plasma membrane, which is critical for receptor function (17, 34). N-linked glycosylation of murine 5-HT3AR regulates plasma membrane targeting, ligand binding, Ca2+ flux, and receptor trafficking (36), suggesting that glycosylation is essential for expression and function of serotonin receptors.
While previous studies have concluded that JCV utilizes an N-linked glycoprotein with α(2,3)-linked sialic acid (31) or α(2,6)-linked sialic acid (16) and 5-HT2AR (18) to initiate infection in host cells, the mechanism(s) by which JCV engages its cellular receptors and the importance of receptor glycosylation remain unclear. 5-HT2AR contains potential asparagine (N)-linked glycosylation sites, five of which are predicted to be expressed in the extracellular amino-terminal region, where they could be accessible to the virus (2). The goal of this study was to determine whether potential N-linked glycosylation sites expressed in 5-HT2AR are required for JCV infection. We found that N-linked glycosylation of 5-HT2AR is important for receptor expression but not necessary for JCV infection.
Cells, viruses, and antibodies.
HEK293A cells (ATCC, Manassas, VA) were grown in Dulbecco's minimal essential medium (DMEM) (Mediatech, Inc., Herndon, VA) supplemented with 5% fetal calf serum (FCS) (Atlanta Biologicals, Lawrenceville, GA) and penicillin-streptomycin (Mediatech, Inc.). Generation of the virus strain Mad-1/SVEΔ was described previously (29, 30). JCV infection in HEK293A cells was assessed using an antibody specific for JCV large T antigen (T Ag) (PAB962). The PAB962 hybridoma produces a monoclonal antibody (MAb) for JCV large T antigen that does not cross-react with simian virus 40 (SV40) T antigen and was provided by the Tevethia laboratory (Penn State University). The yellow fluorescent protein (YFP)-specific antibody (ab290) used for immunoblot analysis and pan-cadherin antibody (ab16505) used for confocal microscopy were purchased from Abcam (Cambridge, MA).
Analysis of 5-HT2AR potential glycosylation sites.
5-HT2AR protein was analyzed for topography and potential N-linked glycosylation sites using UniProt Knowledgebase (UniProtKb) (http://www.uniprot.org).
Generation of 5-HT2AR-YFP fusion construct.
The cDNA for human 5-HT2AR in pcDNA3.1 was purchased from the Missouri S&T cDNA Resource Center (Rolla, MO) (www.cdna.org). To generate the 5-HT2AR-YFP fusion construct, cDNA was PCR amplified with a 5′ primer containing an XhoI site followed by the Kozak sequence and the first 16 nucleotides of the open reading frame (ORF) (HT2aR F, 5′-CTCGAGCACCATGGATATTCTTTGTG-3′) and a 3′ primer complementary to the last 19 nucleotides of the ORF with a BamHI site in place of the stop codon (HT2aR R, 5′-GGATCCaaCACACAGCTCACCTTTTCA-3′; lowercase letters indicate linker nucleotides). This PCR product was cloned into the pCRII vector using the TA cloning kit dual promoter (Invitrogen, Carlsbad, CA). The product was digested with XhoI and BamHI and ligated into the pEYFP-N1 vector (Clontech, Mountain View, CA) to fuse YFP to the C terminus of the receptor. Directionality of cloning was confirmed by sequencing using 640 ng of plasmid and 8 pmol of primers designed to recognize YFP (5′→3′): TGGCACCAAAATCAACGGG and CTTCAGGGTCAGCTTGCC. Sequencing reactions were performed by Genewiz (New Brunswick, NJ) and analyzed using MacVector.
Site-directed mutagenesis of 5-HT2AR N-linked glycosylation sites.
Potential N-linked glycosylation sites in 5-HT2AR were mutated using the QuikChange II site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions. PCR mutagenesis primers were designed using Stratagene's web-based QuikChange primer design program and synthesized by Invitrogen. Primers used for mutagenesis (5′→3′) were as follows: N8A, CACCATGGATATTCTTTGTGAAGAAGCTACTTCTTTGAGCTCAACTACG and CGTAGTTGAGCTCAAAGAAGTAGCTTCTTCACAAAGAATATCCATGGTG; N38A, GACTTTAACTCCGGAGAAGCTGCCACTTCTGATGCATTTAACTG and CAGTTAAATGCATCAGAAGTGGCAGCTTCTCCGGAGTTAAAGTC; N44A, GAGAAGCTAACACTTCTGATGCATTTGCCTGGACAGTCGACT and AGTCGACTGTCCAGGCAAATGCATCAGAAGTGTTAGCTTCTC; N51AF, AACTGGACAGTCGACTCTGAAGCTCGAACCAACCTTTCCT and AGGAAAGGTTGGTTCGAGCTTCAGAGTCGACTGTCCAGTT; and N54A, CGACTCTGAAAATCGAACCGCCCTTTCCTGTGAAGGGTGC and GCACCCTTCACAGGAAAGGGCGGTTCGATTTTCAGAGTCG. Plasmids were transformed in DH5α competent cells (Invitrogen) and S.O.C. medium (Invitrogen). Mutations were confirmed by sequencing using 640 ng of plasmid and 8 pmol of the YFP primers. Sequencing reactions were performed by Genewiz and analyzed using MacVector.
Transfection of HEK293A cells.
HEK293A cells were plated on 22- by 22-mm glass coverslips (Fisher Scientific, Pittsburgh, PA) in six-well plates (Fisher Scientific) in DMEM with 5% FCS overnight. Cells at ~90% confluence were transfected with 1 μg of DNA per well using Lipofectamine 2000 (Invitrogen). Cells were incubated at 37°C for 4 h, and then the medium was replaced with DMEM containing 5% FCS and penicillin-streptomycin and incubated at 37°C for 20 h. Cells were monitored for transfection efficiency by YFP expression using an Eclipse E800 epifluorescence microscope (Nikon Inc., Melville, NY) at 24 h posttransfection.
Treatment of cells with tunicamycin.
At 4 h posttransfection, cells were treated with 0.2 μg/ml of tunicamycin (Sigma) (2) or an equivalent volume of methanol (MeOH) (vehicle control) in complete DMEM. Cells were incubated at 37°C for 24 h in the presence of tunicamycin. Cells were then infected as described below, treated with MeOH to fix cells for confocal microscopy, or harvested by mechanical scraping in phosphate-buffered saline (PBS) for immunoblot analysis.
Treatment of cells with neuraminidase.
At 24 h posttransfection, cells were treated with 0.8 U/ml of neuraminidase from Vibrio cholerae (Sigma Aldrich, St. Louis, MO) in PBS (pH 6.5) with 1 mM MgCl2 and 1 mM CaCl2 at 37°C for 1 h. Cells were then washed twice with minimal essential medium (MEM) containing 2% FCS prior to infection.
Treatment of cells with PNGase F.
At 24 h posttransfection, cells were treated with 2 or 10 U/μl of glycerol free PNGase F (N-glycosidase F) (New England BioLabs, Ipswich, MA) in Hanks buffered salt solution (HBSS) (Invitrogen) at 37°C for 1 h (41). Cells were washed with MEM containing 2% FCS prior to infection.
Indirect immunofluorescence assay of JCV infection.
Cells were infected with JCV at a multiplicity of infection (MOI) of 1 focus-forming unit (FFU)/cell in MEM containing 2% FCS at 37°C for 1 h, DMEM containing 5% FCS and penicillin-streptomycin was added, and cells were incubated at 37°C. At 48 h postinfection, cells were washed with PBS and fixed either in 2% paraformaldehyde (PFA) at room temperature (RT) for 10 min or in MeOH at −20°C for >10 min. Cells were washed with PBS, permeabilized with 0.5% Triton X-100 at RT for 15 min, and then blocked with 10% goat serum (MP Biomedicals, Solon, OH) in PBS at RT for 1 h. Cells were stained with the JCV T-Ag-specific antibody PAB962 (1:10) in PBS at 37°C for 1 h, washed with PBS, and then incubated with a goat anti-mouse Alexa 594 antibody (1:500) in PBS (Invitrogen) and washed with PBS. Coverslips were mounted on slides using Vectashield with DAPI (4′,6′-diamidino-2-phenylindole) (Vector Labs, Burlingame, CA). Cells were analyzed by epifluorescence microscopy (Nikon), and infected cells were quantitated based on nuclear T-Ag expression.
Confocal imaging of cell surface expression of 5-HT2AR-YFP.
Cells were washed with PBS at 24 h following transfection or tunicamycin treatment and fixed in cold MeOH at −20°C for >10 min. Cells were then washed, permeabilized using 1% Triton X-100 at RT for 5 min, and blocked in PBS with 5% bovine serum albumin (BSA) and 0.1% Tween 20 (PBS-BT) at RT for 30 min. Cells were stained with a plasma membrane marker (pan-cadherin-specific antibody; Abcam) (4 μg/ml) in PBS-BT at RT for 1 h, washed in PBS-BT, incubated with a goat anti-rabbit Alexa 546 (Invitrogen) (1:1,000) in PBS-BT at RT for 1 h, and washed in PBS-BT. Coverslips were rinsed with distilled water prior to being mounted on slides using Vectashield with DAPI (Vector Labs). Cells were analyzed using a Zeiss 510 confocal microscope equipped with a Meta detector and Meta software (Carl Zeiss, New York, NY). Multiple images were captured using a 63× objective. The cell surface expression of 5-HT2AR-YFP was quantitated using Metamorph imaging software (Universal Imaging, Downingtown, PA). Images were separated by color and set to an inclusive threshold. A total of 35 individual cells per sample were outlined for measurement. Colocalization of 5-HT2AR-YFP was quantitated as a function of pan-cadherin (a plasma membrane marker) to determine the percentage of 5-HT2AR-YFP expressed on the cell surface.
Immunoblot analysis of 5-HT2AR glycosylation.
HEK293A cells were transfected as described above, washed with PBS, and harvested by mechanically scraping cells in PBS. Cells were pelleted and resuspended in 50 μl of cold 50 mM Tris (pH 7.6) with protease inhibitor cocktail (PIC) (Sigma) on ice. Samples were sonicated using a 150 series Sonic Dismembrator (Fisher Scientific, Pittsburgh, PA) on a low-power setting equivalent to approximately 10 W on ice for 10 s and then pelleted at 19,060 × g at 4°C for 10 min. Supernatants were removed, and pellets (membrane fraction) were resuspended in cold Tris buffer with PIC on ice and pelleted again. Pellets were resuspended in 50 μl cold Tris buffer without PIC and mixed with 50 μl of sample buffer (Bio-Rad, Hercules, CA). Samples were boiled at 95°C for 5 min, and 50 μl of the sample was resolved by SDS-PAGE on 10% Tris-HCl gels (Bio-Rad). Proteins were transferred to polyvinylidene difluoride (PVDF) membranes (Bio-Rad) using a semidry Trans Blot apparatus (Bio-Rad). Membranes were blocked in 5% milk-PBS-T overnight and then incubated with ab290 (1:2,000) in 5% milk-PBS-T at RT for 1 h and washed with PBS-T. Membranes were incubated with goat anti-rabbit Alexa 680 (Invitrogen) (1:2,000) in 5% milk-PBS-T at RT for 1 h and washed in PBS-T. Membranes were rinsed in PBS and analyzed using the LiCor Odyssey (LiCor Biosciences, Lincoln, NE). Images are shown in gray scale.
Statistical analysis.
A two-tailed Student t test was performed using Microsoft Excel. P values of <0.05 were considered to be statistically significant.
JCV infection of 5-HT2AR-expressing HEK293A cells is sensitive to tunicamycin and neuraminidase.
Previous studies have indicated that JCV requires an N-linked glycoprotein for infection (31). Thus, we wanted to determine the effect of tunicamycin, an inhibitor of N-linked glycosylation, on JCV infection in cells expressing 5-HT2AR. HEK293A cells, a poorly permissive cell line, were transfected with a 5-HT2AR-YFP fusion construct or YFP alone, treated with tunicamycin, and then infected with JCV (Fig. (Fig.11 A). Tunicamycin treatment decreased JCV infection in 5-HT2AR-YFP-expressing HEK293A cells, suggesting that N-linked glycosylation may be important for JCV infection. HEK293A cells expressing either 5-HT2AR-pcDNA3.1 or 5-HT2AR-YFP support JCV infection equivalently, suggesting that the appendage of a YFP fusion does not affect the capacity of 5-HT2AR to support JCV infection (data not shown). To assess whether JCV infection of 5-HT2AR-YFP-expressing HEK293A cells is sialic acid dependent, transfected cells were treated with neuraminidase to remove cell surface sialic acids and then infected with JCV (Fig. (Fig.1B).1B). Neuraminidase treatment of 5-HT2AR-YFP-expressing HEK293A cells reduced JCV infection, suggesting that infection is sialic acid dependent.
FIG. 1.
FIG. 1.
JCV infection of 5-HT2AR-YFP-expressing HEK293A cells is tunicamycin sensitive and sialic acid dependent. (A) HEK293A cells were transfected with YFP or 5-HT2AR-YFP and then treated with 0.2 μg/ml of tunicamycin or MeOH (vehicle control) prior (more ...)
The 5-HT2A receptor contains potential N-linked glycosylation sites that are surface exposed.
Given that JC virus utilizes an N-linked glycoprotein with α(2,3)- or α(2,6)-linked sialic acid and 5-HT2AR to infect host cells and that JCV infection is sensitive to tunicamycin (Fig. (Fig.1),1), we analyzed the nucleotide sequence of 5-HT2AR for the presence of potential N-linked glycosylation sites. A potential N-linked glycosylation site is denoted by the motif Asn-X-Ser/Thr, where X is any amino acid. Upon sequence analysis of 5-HT2AR, we observed eight potential N-linked glycosylation sites at residues N8, N38, N44, N51, N54, N75, N107, and N384 (Fig. (Fig.22 A). However, topographical analysis of the seven-transmembrane receptor revealed that N75 is localized at the plasma membrane and that sites N107 and N384 are expressed on intracellular loops, suggesting that these residues may not be accessible to ligands. The potential N-linked glycosylation sites N8, N38, N44, N51, and N54 are expressed on the extreme N-terminal region of the receptor in an area presumably accessible to JCV. These residues were selected for further characterization of their role in JCV infection.
FIG. 2.
FIG. 2.
Mutation of individual 5-HT2AR N-linked glycosylation sites does not alter JCV infection. (A) Schematic diagram of the seven-transmembrane-spanning human 5-HT2AR, with potential N-linked glycosylation sites (Asn-X-Ser/Thr) indicated by position in the (more ...)
Mutation of individual N-linked glycosylation sites does not affect the capacity of 5-HT2AR to support JCV infection.
The presence of five potential N-linked glycosylation sites in a surface-exposed N-terminal region of 5-HT2AR suggested that JC virus might utilize potential N-linked glycosylation sites in 5-HT2AR to mediate infection of host cells. To test this possibility, asparagine residues in potential N-linked glycosylation sites (Asn-X-Ser/Thr) were mutated to alanine residues by site-directed mutagenesis in the 5-HT2AR-YFP fusion construct. Wild-type and N-linked glycosylation mutant 5-HT2AR-YFP constructs were transfected into HEK293A cells and tested for the capacity to support JCV infection (Fig. (Fig.2B).2B). Mutation of individual N-linked glycosylation sites in 5-HT2AR-YFP did not affect the capacity of 5-HT2AR-YFP to support JCV infection. These data suggest that JC virus does not utilize a specific N-linked glycosylation site to mediate infection in a 5-HT2AR-dependent manner. However, it was necessary to determine whether the cell surface expression of the serotonin receptor was affected by mutation of the potential glycosylation sites, as previous studies have found that point mutation of N-linked glycosylation sites in serotonin receptors interfered with cell surface expression and receptor functions (17, 34). To test whether mutation of potential N-linked glycosylation sites affected the cell surface expression of 5-HT2AR-YFP, HEK293A cells transfected with wild-type and mutant constructs were fixed at 24 h posttransfection, stained with the plasma membrane marker pan-cadherin, and analyzed by confocal microscopy (Fig. (Fig.33 A). 5-HT2AR-YFP was observed at the cell surface as well as in other subcellular locations, and this likely represents receptor that is being processed or recycled. 5-HT2AR-YFP cell surface expression was analyzed as a function of pan-cadherin expression using Metamorph imaging analysis to determine the percentage of 5-HT2AR that was expressed at the cell surface (Fig. (Fig.3B).3B). Cell surface expression of the wild-type and mutant constructs was determined to be equivalent, suggesting that mutation of individual N-linked glycosylation sites in 5-HT2AR-YFP does not affect the normal localization of the receptor.
FIG. 3.
FIG. 3.
Mutation of individual 5-HT2AR N-linked glycosylation sites does not alter the cell surface expression of 5-HT2AR-YFP. HEK293A cells were transfected with 5-HT2AR-YFP or individual N-linked glycosylation site mutants. At 24 h posttransfection, cells were (more ...)
Mutation of all N-linked glycosylation sites reduces the capacity of 5-HT2AR to support JCV infection.
The observation that JCV infection of 5-HT2AR-YFP-expressing HEK293A cells is tunicamycin sensitive indicates that glycosylation of 5-HT2AR may be important for JCV infection, yet mutation of individual glycosylation sites had no effect on JCV infection (Fig. (Fig.2B).2B). Thus, a 5-HT2AR-YFP construct in which all five N-linked glycosylation sites were mutated to alanine residues (5-HT2AR-YFP-N8/38/44/51/54A) was generated and tested for the capacity to support JCV infection (Fig. (Fig.4).4). Mutation of all potential N-linked glycosylation sites in 5-HT2AR resulted in a significant reduction in JCV infection. These data indicate that glycosylation of 5-HT2AR is required for the receptor to support JCV infection.
FIG. 4.
FIG. 4.
Mutation of all 5-HT2AR N-linked glycosylation sites reduces JCV infection. HEK293A cells were transfected with YFP, 5-HT2AR-YFP or 5-HT2AR-YFP-N8/38/44/51/54A and infected with JCV. At 48 h postinfection, cells were fixed and stained using JCV T-Ag-specific (more ...)
Mutation of all N-linked glycosylation sites alters the cell surface localization of 5-HT2AR-YFP.
Previous studies have found that the process of N-linked glycosylation is important for targeting the serotonin receptor to the plasma membrane (17, 34, 36). To test whether mutation of all potential N-linked glycosylation sites affected the cell surface expression of 5-HT2AR-YFP, HEK293A cells were transfected with wild-type 5-HT2AR-YFP or 5-HT2AR-YFP-N8/38/44/51/54A and either treated with tunicamycin or left untreated. Cells were fixed at 24 h posttransfection, stained for pan-cadherin as a plasma membrane marker, and analyzed by confocal microscopy (Fig. (Fig.55 A). 5-HT2AR-YFP was observed at the cell surface as well as in other subcellular compartments, as seen in Fig. Fig.3.3. However, in either cells transfected with 5-HT2AR-YFP and treated with tunicamycin or cells transfected with 5-HT2AR-YFP-N8/38/44/51/54A, a significant alteration in the cellular localization of 5-HT2AR-YFP was observed by confocal microscopy (Fig. (Fig.5A).5A). 5-HT2AR-YFP cell surface expression was analyzed as a function of pan-cadherin expression using Metamorph imaging analysis to determine the percentage of the receptor that was expressed at the plasma membrane (Fig. (Fig.5B).5B). Through imaging analysis it was determined that the cell surface expression of 5-HT2AR-YFP-N8/38/44/51/54A is reduced, and the cellular expression pattern of 5-HT2AR-YFP-N8/38/44/51/54A parallels that observed in tunicamycin-treated 5-HT2AR-YFP-expressing HEK293A cells (Fig. 5A and B). These data demonstrate that glycosylation of 5-HT2AR plays an important role in the proper cell surface expression of the receptor. Further, these data suggest that a reduction in JCV infection in cells expressing 5-HT2AR-YFP-N8/38/44/51/54A or in cells treated with tunicamycin is likely due to a reduction of 5-HT2AR expression at the cell surface.
FIG. 5.
FIG. 5.
Mutation of all 5-HT2AR N-linked glycosylation sites reduces cell surface expression of 5-HT2AR-YFP. HEK293A cells were transfected with 5-HT2AR-YFP or 5-HT2AR-YFP-N8/38/44/51/54A. Cells were untreated or treated with either MeOH or tunicamycin for 24 (more ...)
Inhibition of N-linked glycosylation alters the electrophoretic mobility of 5-HT2AR-YFP.
Glycosylation of serotonin receptors has previously been assessed by immunoblot analysis of tunicamycin-treated cells expressing 5-HT receptors and 5-HT the receptor N-linked glycosylation mutants (17, 34, 36). To determine the glycosylation status of the human 5-HT2AR, we analyzed the electrophoretic mobility of 5-HT2AR-YFP in the presence and absence of tunicamycin. HEK293A cells transfected with either YFP or 5-HT2AR-YFP were treated with tunicamycin or MeOH (vehicle control), harvested, and analyzed by immunoblot analysis using a YFP-specific antibody (Fig. (Fig.66 A). Cells expressing 5-HT2AR-YFP produced a major YFP-immunoreactive species at approximately 50 kDa and minor species at approximately 60, 70, and 75 kDa. Tunicamycin treatment of cells resulted in an altered electrophoretic mobility pattern of 5-HT2AR-YFP. The immunoreactive species at ~75 kDa was reduced under tunicamycin treatment, suggesting that this represents a glycosylated form of the receptor. To further probe the importance of N-linked glycosylation, wild-type and N-linked glycosylation site mutant 5-HT2AR-YFP constructs were expressed in HEK293A cells, harvested, and subjected to immunoblot analysis (Fig. (Fig.6B).6B). The apparent electrophoretic mobility of 5-HT2AR-YFP was reduced by ~3 kDa by point mutations of individual N-linked glycosylation sites. However, mutation of all five sites resulted in a reduction in the ~75-kDa band as in the tunicamycin-treated sample (Fig. (Fig.6B),6B), suggesting that inhibition of 5-HT2AR N-linked glycosylation by either mutation or tunicamycin treatment results in an altered electrophoretic mobility profile. These data show that 5-HT2AR is normally glycosylated and that glycosylation is critical for cell surface localization.
FIG. 6.
FIG. 6.
Inhibition of 5-HT2AR glycosylation by tunicamycin treatment or mutation alters the electrophoretic mobility of 5-HT2AR. (A) HEK293A cells were transfected with YFP or 5-HT2AR-YFP and then treated with 0.2 μg/ml of tunicamycin or MeOH (vehicle (more ...)
JCV infection of 5-HT2AR-YFP-expressing HEK293A cells is resistant to PNGase F treatment.
Treatment of 5-HT2AR-YFP-expressing HEK293A cells with tunicamycin (Fig. (Fig.1A)1A) or mutation of all five N-linked glycosylation sites (Fig. (Fig.4)4) results in a decreased capacity of 5-HT2AR to support JCV infection yet also reduces the cell surface expression of the receptor (Fig. (Fig.5).5). Thus, to further address whether N-linked glycosylation of 5-HT2AR is required for JCV infection, cells were treated with PNGase F to specifically remove N-linked oligosaccharides from the surface of 5-HT2AR-YFP-expressing HEK293A cells (41) and then infected with JCV (Fig. (Fig.77 A). Interestingly, PNGase F had no effect on JCV infection. Immunoblot analysis revealed that PNGase F treatment of 5-HT2AR-YFP-expressing cells resulted in an electrophoretic mobility pattern of 5-HT2AR (Fig. (Fig.7B)7B) similar to that observed in tunicamycin-treated cells, suggesting that the PNGase F used in the experiments effectively removed cell surface N-linked oligosaccharides. Taken together, these data indicate that the sialic acid component of the JCV receptor is not linked to 5-HT2AR.
FIG. 7.
FIG. 7.
Treatment of 5-HT2AR-YFP-expressing HEK293A cells with PNGase F has no effect on JCV infection. (A) HEK293A cells were transfected with 5-HT2AR-YFP and then treated with 2 or 10 U/μl of PNGase F or HBSS (vehicle control) prior to infection with (more ...)
This study was conducted to determine whether JCV utilizes potential N-linked glycosylation sites on the 5-HT2A receptor to mediate JCV infection. Treatment of 5-HT2AR-YFP-expressing cells with tunicamycin, an inhibitor of N-linked glycosylation, blocked JCV infection. We identified potential N-linked glycosylation sites in the N terminus of 5-HT2AR and subjected them to site-directed mutagenesis and expression in a poorly permissive cell line. Cells expressing 5-HT2AR with individual point mutations in the N-linked glycosylation sites were equally capable of supporting JCV infection as cells expressing wild-type 5-HT2AR, yet mutation of all five sites resulted a significant reduction in the capacity of 5-HT2AR to support infection. Further, mutation of all five 5-HT2AR N-linked glycosylation sites resulted in decreased cell surface expression of the receptor, yet mutation of individual sites did not. While JCV infection of 5-HT2AR-YFP-expressing cells was tunicamycin sensitive, tunicamycin also reduced the cell surface expression of the receptor, suggesting that infection is reduced due to the decreased availability of the receptor. Moreover, the electrophoretic mobility of 5-HT2AR was altered by tunicamycin treatment or mutation of all 5-HT2AR N-linked glycosylation sites but was unaffected by mutation of individual N-linked glycosylation sites, suggesting that the receptor is normally glycosylated. PNGase F, which enzymatically removes N-linked oligosaccharides from the cell surface, does not affect JCV infection. Taken together, these data suggest that N-linked glycosylation of 5-HT2AR is required for proper cell surface expression yet is not required for JCV infection. These findings provide a better understanding of how JC virus engages host cell receptors to mediate infection. This is also the first characterization of the glycosylation profile of the human 5-HT2AR. Previous studies have suggested that glycosylation of serotonin receptors is essential for plasma membrane localization of the receptor, signaling events, and ligand binding (17, 34, 36). For example, treatment of cells expressing human 5-HT3AR with tunicamycin results in a reduction in the molecular weight of the receptor as assessed by electrophoretic mobility. Further, mutation of the individual N-linked glycosylation sites also results in a reduction in electrophoretic mobility of ~3 kDa, suggesting that human 5-HT3AR is normally glycosylated by N-linked oligosaccharides. Mutation of these sites results in a decreased capacity for the receptor to support ligand binding, indicating an essential role for N-linked glycosylation in the function of human 5-HT3AR (34). Thus, our data suggest that like for other serotonin receptor family members, N-linked glycosylation regulates the expression and function of the human 5-HT2A receptor.
These data also show that N-linked glycosylation of 5-HT2AR is important for receptor expression but not required for JCV infection. Point mutation of individual N-linked glycosylation sites in 5-HT2AR did not affect the function of the receptor in JCV infection, indicating that JCV does not engage a specific N-linked sialic acid expressed on 5-HT2AR. Treatment of 5-HT2AR-expressing HEK293A cells with neuraminidase significantly reduced infection, indicating that the mechanism by which 5-HT2AR mediates JCV infection is via sialic acid. These data further indicate that the sialic acid component is likely expressed on an alternate coreceptor.
JCV has a very restricted host cell tropism, infecting cells in the kidney (9, 12), B lymphocytes of the bone marrow (9), and oligodendrocytes and astrocytes in the CNS (40, 48). Thus, it seems plausible that JCV could utilize sialic acid as a low-affinity binding step to adhere to 5-HT2AR, and then the virus may interact with specific residues in 5-HT2AR to mediate entry into host cells. It is also possible that JCV engages sialic acid on another molecule through a low-affinity binding step and then interacts with 5-HT2AR to mediate entry. A recent study reports that JCV isolates from PML patients contain polymorphisms in sialic acid binding domains in the viral capsid protein VP1 (42), suggesting that the mechanism by which JCV engages host cell receptors in the brain may differ from that in the kidney or tissue culture systems. Given that JCV reactivation occurs during immunosuppression due to HIV/AIDS or in patients receiving immunosuppressive therapies, it is possible that the virus engages host cell receptors in a different manner due to selective pressures in the host.
This study provides new information regarding the role of 5-HT2AR in JCV infection and the development of PML. As treatment options for PML are very limited, the prognosis is dismal (23). However, recent case studies have found that treatment of PML patients with mirtazapine (a serotonin 5-HT2A, 5-HT2C, and 5-HT3 receptor antagonist used for treatment of depression) reduced the normally rapid progression of PML (6, 27, 45, 46). Treatment of PML patients with mirtazapine was most effective when a patient was treated at the early onset of symptoms; therefore, this may provide a viable treatment option to extend the lives of PML patients (6). These clinical studies suggest that treatment of PML patients with mirtazapine, a serotonin receptor antagonist, may effectively inhibit JCV binding to 5-HT2AR on oligodendrocytes and thereby reduce JCV spread in the brain. This highlights the importance of understanding the molecular interactions between JCV and the 5-HT2A receptor. Future studies will provide a platform for continued pharmacological development of 5-HT2A receptor antagonists and inhibitors to treat and prevent PML.
Acknowledgments
We thank members of the Atwood lab for critical discussions and review of the manuscript. We thank Bethany O'Hara for technical assistance.
Work in our laboratory was supported by grants R01CA71878 (W.J.A.) and R01NS43097 (W.J.A.) and by Ruth L. Kirschstein National Research Service Award F32NS064870 from the National Institute of Neurological Disorders and Stroke (M.S.M.). Confocal microscopy analysis was completed in the Leduc Bioimaging Facility at Brown University. Immunoblot analysis was performed in the Center for Genomics and Proteomics at Brown University, which is supported by grant P20RR015578 (W.J.A.).
Footnotes
[down-pointing small open triangle]Published ahead of print on 21 July 2010.
1. Astrom, K. E., E. L. Mancall, and E. P. Richardson, Jr. 1958. Progressive multifocal leuko-encephalopathy; a hitherto unrecognized complication of chronic lymphatic leukaemia and Hodgkin's disease. Brain 81:93-111. [PubMed]
2. Backstrom, J. R., R. S. Westphal, H. Canton, and E. Sanders-Bush. 1995. Identification of rat serotonin 5-HT2C receptors as glycoproteins containing N-linked oligosaccharides. Brain Res. Mol. Brain Res. 33:311-318. [PubMed]
3. Bockaert, J., S. Claeysen, C. Becamel, A. Dumuis, and P. Marin. 2006. Neuronal 5-HT metabotropic receptors: fine-tuning of their structure, signaling, and roles in synaptic modulation. Cell Tissue Res. 326:553-572. [PubMed]
4. Bonhaus, D. W., C. Bach, A. DeSouza, F. H. Salazar, B. D. Matsuoka, P. Zuppan, H. W. Chan, and R. M. Eglen. 1995. The pharmacology and distribution of human 5-hydroxytryptamine2B (5-HT2B) receptor gene products: comparison with 5-HT2A and 5-HT2C receptors. Br. J. Pharmacol. 115:622-628. [PubMed]
5. Carson, K. R., A. M. Evens, E. A. Richey, T. M. Habermann, D. Focosi, J. F. Seymour, J. Laubach, S. D. Bawn, L. I. Gordon, J. N. Winter, R. R. Furman, J. M. Vose, A. D. Zelenetz, R. Mamtani, D. W. Raisch, G. W. Dorshimer, S. T. Rosen, K. Muro, N. R. Gottardi-Littell, R. L. Talley, O. Sartor, D. Green, E. O. Major, and C. L. Bennett. 2009. Progressive multifocal leukoencephalopathy after rituximab therapy in HIV-negative patients: a report of 57 cases from the Research on Adverse Drug Events and Reports project. Blood 113:4834-4840. [PubMed]
6. Cettomai, D., and J. C. McArthur. 2009. Mirtazapine use in human immunodeficiency virus-infected patients with progressive multifocal leukoencephalopathy. Arch. Neurol. 66:255-258. [PubMed]
7. Chapagain, M. L., L. Sumibcay, U. Gurjav, P. H. Kaufusi, R. E. Kast, and V. R. Nerurkar. 2008. Serotonin receptor 2A blocker (risperidone) has no effect on human polyomavirus JC infection of primary human fetal glial cells. J. Neurovirol. 14:448-454. [PMC free article] [PubMed]
8. Chapagain, M. L., S. Verma, F. Mercier, R. Yanagihara, and V. R. Nerurkar. 2007. Polyomavirus JC infects human brain microvascular endothelial cells independent of serotonin receptor 2A. Virology 364:55-63. [PMC free article] [PubMed]
9. Chesters, P. M., J. Heritage, and D. J. McCance. 1983. Persistence of DNA sequences of BK virus and JC virus in normal human tissues and in diseased tissues. J. Infect. Dis. 147:676-684. [PubMed]
10. Cinque, P., I. J. Koralnik, S. Gerevini, J. M. Miro, and R. W. Price. 2009. Progressive multifocal leukoencephalopathy in HIV-1 infection. Lancet Infect. Dis. 9:625-636. [PMC free article] [PubMed]
11. Dorries, K. 1998. Molecular biology and pathogenesis of human polyomavirus infections. Dev. Biol. Stand. 94:71-79. [PubMed]
12. Dorries, K., and V. ter Meulen. 1983. Progressive multifocal leucoencephalopathy: detection of papovavirus JC in kidney tissue. J. Med. Virol. 11:307-317. [PubMed]
13. Dorries, K., E. Vogel, S. Gunther, and S. Czub. 1994. Infection of human polyomaviruses JC and BK in peripheral blood leukocytes from immunocompetent individuals. Virology 198:59-70. [PubMed]
14. Dubois, V., H. Dutronc, M. E. Lafon, V. Poinsot, J. L. Pellegrin, J. M. Ragnaud, A. M. Ferrer, and H. J. Fleury. 1997. Latency and reactivation of JC virus in peripheral blood of human immunodeficiency virus type 1-infected patients. J. Clin. Microbiol. 35:2288-2292. [PMC free article] [PubMed]
15. Dubois, V., M. E. Lafon, J. M. Ragnaud, J. L. Pellegrin, F. Damasio, C. Baudouin, V. Michaud, and H. J. Fleury. 1996. Detection of JC virus DNA in the peripheral blood leukocytes of HIV-infected patients. AIDS 10:353-358. [PubMed]
16. Dugan, A. S., M. L. Gasparovic, and W. J. Atwood. 2008. Direct correlation between sialic acid binding and infection of cells by two human polyomaviruses (JC virus and BK virus). J. Virol. 82:2560-2564. [PMC free article] [PubMed]
17. Dutton, A. C., A. N. Massoura, T. J. Dover, N. A. Andrews, and N. M. Barnes. 2008. Identification and functional significance of N-glycosylation of the 5-ht5A receptor. Neurochem Int. 52:419-425. [PubMed]
18. Elphick, G. F., W. Querbes, J. A. Jordan, G. V. Gee, S. Eash, K. Manley, A. Dugan, M. Stanifer, A. Bhatnagar, W. K. Kroeze, B. L. Roth, and W. J. Atwood. 2004. The human polyomavirus, JCV, uses serotonin receptors to infect cells. Science 306:1380-1383. [PubMed]
19. Fleischmann, R. M. 2009. Progressive multifocal leukoencephalopathy following rituximab treatment in a patient with rheumatoid arthritis. Arthritis Rheum. 60:3225-3228. [PubMed]
20. Houff, S. A., E. O. Major, D. A. Katz, C. V. Kufta, J. L. Sever, S. Pittaluga, J. R. Roberts, J. Gitt, N. Saini, and W. Lux. 1988. Involvement of JC virus-infected mononuclear cells from the bone marrow and spleen in the pathogenesis of progressive multifocal leukoencephalopathy. N. Engl. J. Med. 318:301-305. [PubMed]
21. Kean, J. M., S. Rao, M. Wang, and R. L. Garcea. 2009. Seroepidemiology of human polyomaviruses. PLoS Pathog. 5:e1000363. [PMC free article] [PubMed]
22. Khalili, K., and M. K. White. 2006. Human demyelinating disease and the polyomavirus JCV. Mult. Scler. 12:133-142. [PubMed]
23. Kishida, S. 2007. Progressive multifocal leukoencephalopathy-epidemiology, clinical pictures, diagnosis and therapy. Brain Nerve 59:125-137. [PubMed]
24. Kleinschmidt-DeMasters, B. K., and K. L. Tyler. 2005. Progressive multifocal leukoencephalopathy complicating treatment with natalizumab and interferon beta-1a for multiple sclerosis. N. Engl. J. Med. 353:369-374. [PubMed]
25. Knowles, W. A., P. Pipkin, N. Andrews, A. Vyse, P. Minor, D. W. Brown, and E. Miller. 2003. Population-based study of antibody to the human polyomaviruses BKV and JCV and the simian polyomavirus SV40. J. Med. Virol. 71:115-123. [PubMed]
26. Langer-Gould, A., S. W. Atlas, A. J. Green, A. W. Bollen, and D. Pelletier. 2005. Progressive multifocal leukoencephalopathy in a patient treated with natalizumab. N. Engl. J. Med. 353:375-381. [PubMed]
27. Lanzafame, M., S. Ferrari, E. Lattuada, F. Corsini, R. Deganello, S. Vento, and E. Concia. 2009. Mirtazapine in an HIV-1 infected patient with progressive multifocal leukoencephalopathy. Infez. Med. 17:35-37. [PubMed]
28. Linda, H., A. von Heijne, E. O. Major, C. Ryschkewitsch, J. Berg, T. Olsson, and C. Martin. 2009. Progressive multifocal leukoencephalopathy after natalizumab monotherapy. N. Engl. J. Med. 361:1081-1087. [PubMed]
29. Liu, C. K., and W. J. Atwood. 2001. Propagation and assay of the JC virus. Methods Mol. Biol. 165:9-17. [PubMed]
30. Liu, C. K., A. P. Hope, and W. J. Atwood. 1998. The human polyomavirus, JCV, does not share receptor specificity with SV40 on human glial cells. J. Neurovirol. 4:49-58. [PubMed]
31. Liu, C. K., G. Wei, and W. J. Atwood. 1998. Infection of glial cells by the human polyomavirus JC is mediated by an N-linked glycoprotein containing terminal alpha(2-6)-linked sialic acids. J. Virol. 72:4643-4649. [PMC free article] [PubMed]
32. Major, E. O., K. Amemiya, C. S. Tornatore, S. A. Houff, and J. R. Berger. 1992. Pathogenesis and molecular biology of progressive multifocal leukoencephalopathy, the JC virus-induced demyelinating disease of the human brain. Clin. Microbiol. Rev. 5:49-73. [PMC free article] [PubMed]
33. Molloy, E. S., and L. H. Calabrese. 2008. Progressive multifocal leukoencephalopathy in patients with rheumatic diseases: are patients with systemic lupus erythematosus at particular risk? Autoimmun Rev. 8:144-146. [PubMed]
34. Monk, S. A., J. M. Williams, A. G. Hope, and N. M. Barnes. 2004. Identification and importance of N-glycosylation of the human 5-hydroxytryptamine3A receptor subunit. Biochem. Pharmacol. 68:1787-1796. [PubMed]
35. O'Hara, B. A., and W. J. Atwood. 2008. Interferon beta1-a and selective anti-5HT(2a) receptor antagonists inhibit infection of human glial cells by JC virus. Virus Res. 132:97-103. [PMC free article] [PubMed]
36. Quirk, P. L., S. Rao, B. L. Roth, and R. E. Siegel. 2004. Three putative N-glycosylation sites within the murine 5-HT3A receptor sequence affect plasma membrane targeting, ligand binding, and calcium influx in heterologous mammalian cells. J. Neurosci. Res. 77:498-506. [PubMed]
37. Rahmlow, M., E. A. Shuster, J. Dominik, H. G. Deen, Jr., D. W. Dickson, A. J. Aksamit, Jr., H. A. Robles, and W. D. Freeman. 2008. Leflunomide-associated progressive multifocal leukoencephalopathy. Arch. Neurol. 65:1538-1539. [PubMed]
38. Schaumburg, C., B. A. O'Hara, T. E. Lane, and W. J. Atwood. 2008. Human embryonic stem cell-derived oligodendrocyte progenitor cells express the serotonin receptor and are susceptible to JC virus infection. J. Virol. 82:8896-8899. [PMC free article] [PubMed]
39. Shah, K. V., B. N. Fields, D. M. Knipe, and P. M. Howley. 1996. Fields virology, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa.
40. Silverman, L., and L. J. Rubinstein. 1965. Electron microscopic observations on a case of progressive multifocal leukoencephalopathy. Acta Neuropathol. 5:215-224. [PubMed]
41. Straumann, N., A. Wind, T. Leuenberger, and T. Wallimann. 2006. Effects of N-linked glycosylation on the creatine transporter. Biochem. J. 393:459-469. [PubMed]
42. Sunyaev, S. R., A. Lugovskoy, K. Simon, and L. Gorelik. 2009. Adaptive mutations in the JC virus protein capsid are associated with progressive multifocal leukoencephalopathy (PML). PLoS Genet. 5:e1000368. [PMC free article] [PubMed]
43. Trombetta, E. S. 2003. The contribution of N-glycans and their processing in the endoplasmic reticulum to glycoprotein biosynthesis. Glycobiology 13:77R-91R. [PubMed]
44. Van Assche, G., M. Van Ranst, R. Sciot, B. Dubois, S. Vermeire, M. Noman, J. Verbeeck, K. Geboes, W. Robberecht, and P. Rutgeerts. 2005. Progressive multifocal leukoencephalopathy after natalizumab therapy for Crohn's disease. N. Engl. J. Med. 353:362-368. [PubMed]
45. Verma, S., K. Cikurel, I. J. Koralnik, S. Morgello, C. Cunningham-Rundles, Z. R. Weinstein, C. Bergmann, and D. M. Simpson. 2007. Mirtazapine in progressive multifocal leukoencephalopathy associated with polycythemia vera. J. Infect. Dis. 196:709-711. [PubMed]
46. Vulliemoz, S., F. Lurati-Ruiz, F. X. Borruat, J. Delavelle, I. J. Koralnik, T. Kuntzer, J. Bogousslavsky, F. Picard, T. Landis, and R. A. Du Pasquier. 2006. Favourable outcome of progressive multifocal leucoencephalopathy in two patients with dermatomyositis. J. Neurol. Neurosurg. Psychiatry 77:1079-1082. [PMC free article] [PubMed]
47. Wenning, W., A. Haghikia, J. Laubenberger, D. B. Clifford, P. F. Behrens, A. Chan, and R. Gold. 2009. Treatment of progressive multifocal leukoencephalopathy associated with natalizumab. N. Engl. J. Med. 361:1075-1080. [PubMed]
48. Zurhein, G., and S. M. Chou. 1965. Particles resembling papova viruses in human cerebral demyelinating disease. Science 148:1477-1479. [PubMed]
Articles from Journal of Virology are provided here courtesy of
American Society for Microbiology (ASM)