PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jvirolPermissionsJournals.ASM.orgJournalJV ArticleJournal InfoAuthorsReviewers
 
J Virol. 2010 September; 84(18): 9655.
PMCID: PMC2937618

Kaposi's Sarcoma-Associated Herpesvirus Latent Gene vFLIP Inhibits Viral Lytic Replication through NF-κB-Mediated Suppression of the AP-1 Pathway: a Novel Mechanism of Virus Control of Latency

Volume 82, no. 9, p. 4235-4249, 2008. Page 4236, column 2, paragraph 3, lines 4 to 9: “To generate BAC36ΔvF, a PCR product was first obtained with the primers 5′-GAGCACCCTGAAATCCAGGCTCTACAGGTAGGCCACATACGCTCGCCACTCTATATGGTGTAGGCTGGAGCTGCTTC-3′ (forward) and 5′-CCGCCCTAAACAAAATCACAAGCTTAATAGCTGTCCAGAATGCGCAGATCAAAGTCCCATATGAATATCCTCCTTAG-3′ (reverse), using plasmid pMS102-Zeocin as a template.” should read “To generate BAC36ΔvF, a PCR product was first obtained with the primers 5′CCTTTGTTTTTCCACATCGGTGCCTTCACATATACAAGCCGGCACCATGGCCACTTACGTGTAGGCTGGAGCTGCTTC-3′ (forward) and 5′-ATTAGCAACAGCTTGTTATCTATGGTGTATGGCGATAGTGTTGGGAGTGTGATGGGCCATATGAATATCCTCCTTAG-3′ (reverse), using plasmid pMS102-Zeocin as a template.”


Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)