PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cancer Invest. Author manuscript; available in PMC 2010 August 28.
Published in final edited form as:
PMCID: PMC2929368
NIHMSID: NIHMS228016

Thymosin beta 10 is Aberrantly Expressed in Pancreatic Cancer and Induces JNK Activation

Abstract

BACKGROUND

Thymosin beta 10 (Tβ10) has been shown to be associated with several cancers; however, its role in pancreatic cancer is not understood.

METHODS

The expression of Tβ10 was determined by immunohistochemistry and real-time PCR. Phosphorylation of JNK and cytokine secretion were determined using the Bio-Plex phosphoprotein and cytokines assays.

RESULTS

Pancreatic cancer tissues and cells expressed higher amounts of Tβ10 than normal surrounding tissues and HPDE cells. Exogenous Tβ10 caused phosphorylation of JNK and increased secretion of cytokines IL-7 and IL-8 in BxPC-3 cells.

CONCLUSIONS

Tβ10 might be a promising marker and a novel therapeutic target for pancreatic cancer.

Keywords: Tβ10, pancreatic cancer

Introduction

Beta-thymosins are a family of structurally related small proteins originally isolated from the thymus. There are two major mammalian isoforms, thymosin beta 4 (Tβ4) and thymosin beta 10 (Tβ10), which are known to be actin monomer sequestering proteins involved in regulating actin filament assembly 1,2. Tβ10 is a 42 amino acid protein which shares 75% homology with Tβ4 3,4. Although initially thought to be primarily an immune component, which enhances the effects of immunomodulators in immunodeficiencies and other neoplastic malignancies 3, Tβ10 was also found to play an important role in regulating the cytoskeleton in nearly all cells. Additionally, it might serve as a diagnostic marker for many cancers 1,2,5,6.

Tβ10 has been found to be differentially expressed in several cancer types, including human melanoma, renal cell carcinoma, gastric, breast, lung, and thyroid cancers 712. In breast cancer, the intensity of staining positively correlated with the overall grade of the lesion 9. Similarly, increased levels of Tβ10 correlated with increased malignant behavior in thyroid carcinomas, with the highest expression seen in anaplastic variants, which also have the least distinct backbone morphology 3,13,14. Suppressing Tβ10 decreased anchorage independent growth and improved actin filament organization in thyroid carcinomas 15. A recent microarray study in five pancreatic cancer cell lines and primary isolates indicated that Tβ10 was upregulated in tumor cell lines but not in benign cells, suggesting a role for Tβ10 in the carcinogenesis of pancreatic carcinoma 16.

Despite these interesting findings, the exact function of Tβ10 in tumorigenesis is not completely understood. In pancreatic cancer, the fourth leading cause of cancer related deaths in America, Tβ10 was only indicated to be overexpressed in cancer cells and tissues, and no functional assays have been done. There are no studies available to connect the role of Tβ10 with pancreatic cancer pathogenesis. In this study, the expression of Tβ10 in human pancreatic cell lines and clinical specimens of pancreatic adenocarcinoma was evaluated using both real time RT PCR and immunohistochmistry. The effects of Tβ10 on cytokine secretion and signal transduction in pancreatic cancer cells were also examined by Bio-Plex cytokine and phosphoprotein assays.

Materials and Methods

Chemicals and Reagents

The recombinant human Tβ10 was purchased from ALPCO Diagnostics (Windham, NH). Rabbit anti-Tβ10 Ab was purchased from Biodesign International (Cincinnati, OH). The Ambion “RNAqueous-4PCR” kit and “DNA free” kits were purchased from Ambion (Austin, Texas). The iQ SYBR Green supermix and iScript cDNA synthesis kits were purchased from Bio-Rad (Hercules, CA).

Cell Culture and human tissue specimens

Human pancreatic cancer cell lines (Panc-1, BxPC-3, ASPC-1, Capan-2, HPAF-II, Panc 03.27, and PL45) were obtained from the American Type Culture Collection (ATCC, Rockville, MD). HPDE cells were provided as a generous gift from Dr. Ming-Sound Tsao at the University of Toronto, Canada, as previously described 17,18. Panc-1 and PL45 cells were cultured in DMEM with 10% fetal bovine serum (FBS) at 37°C with 5% CO2. BxPC-3, ASPC-1, and Panc03.27 cells were cultured in RPMI 1640 medium with 10% FBS at 37°C with 5% CO2. HPAF-II cells were cultured in Eagle’s MEM with 10% FBS at 37°C with 5% CO2. Capan-2 cells were cultured in McCoy’s medium with 10% FBS at 37°C with 5% CO2. Upon receipt from ATCC, cells were passaged less than 20 times and the media were refreshed every two to three days. HPDE cells were cultured in keratinocyte serum-free (KSF) medium supplied with 5 ng/mL EGF and 50 µg/mL bovine pituitary extract (Invitrogen, Carlsbad, CA). Human pancreatic adenocarcinoma specimens were collected from patients who underwent surgery according to an approved human protocol at Baylor College of Medicine (Houston, TX).

RNA Extraction

Total RNA was extracted from seven pancreatic cancer cell lines (Panc-1, BxPC-3, ASPC-1, Capan-2, HPAF-II, Panc 03.27, and PL45), HPDE cells, and clinical specimens using an Ambion “RNAqueous-4PCR” kit following the manufacturer’s instruction (Austin, Texas) as described previously 1921. Briefly, cell or tissue samples were lysed in Ambion lysis buffer for 20 min and the cell lysates were mixed with an equal volume of 64% ethanol. The lysates were then transferred to an Ambion mini-column, and centrifuged at 10,000 ×g for 1 min. The column was washed once with 700 µl of wash buffer 1, and twice with 500 µl of wash buffer 2/3. After incubation with 50 µl of elution buffer, the flow through was collected, and the RNA solution was then treated with DNAse I to remove any trace amounts of genomic DNA contamination by using an Ambion DNA removing kit. One µl of DNAse I was added to 20 µl of RNA solution with appropriate DNAse I buffer, and incubated at 37°C for 2 h. The DNAse I was removed by adding 0.1–0.2 volume of DNAse removing reagent, and the purified RNA was collected by centrifugation at 10,000 ×g for 1 min.

Real-Time RT-PCR

Specific primers for Tβ10 were designed with the Beacon Designer 5.1 software (PREMIER Biosoft International, Palo Alto, CA). The primer sequences for human Tβ10 gene are: Sense 5’CCCAGTCGTGATGTGGAGGAA3’; and anti-sense 5’ AGAATTTGGCAGTCCGATTGGG 3’. The homology between different subtypes and the template secondary structure were carefully examined and the primers were chosen to avoid homologies. β-actin was used as a house-keeping gene control. The sequences for β-actin primers were as follws: sense: 5’ CTGGAACGGTGAAGGTGACA 3’; and antisense: 5’ AAGGGACTTCCTGTAACAATGCA 3’. The mRNA levels for Tβ10 in human pancreatic cancer cells and tissue specimens were analyzed by real-time RT-PCR using an iCycler system (Bio-Rad). The mRNA was reverse-transcribed into cDNAs using the iScript cDNA synthesis kit. Real-time PCR was performed using the SYBR supermix kit. PCR reaction included the following components: 100 nM each primer, diluted cDNA templates and iQ SYBR Green supermix (0.2 mM of each dNTP, 25 units/ml iTaq DNA polymerase, SYBR Green I, 10 nM fluorescein, 3 mM MgCl2, 50 mM KCl, 20 mM Tris-HCl), and was run for 40 cycles at 95°C for 20 sec and 60°C for 1 min. Each cDNA sample was run in triplicate, and the corresponding no-reverse transcriptase (RT) mRNA sample was included as a negative control. The β-actin primer was included in every plate to avoid sample variations. The mRNA level of Tβ10 in each sample was normalized to that of the β-actin mRNA. The relative mRNA level was presented as unit values of 2^[Ct(β-actin) – Ct(gene of interest)].

Immunohistochemistry Assay

Clinical human pancreatic adenocarcinoma and surrounding normal tissues were collected and processed into 5 µm slices. For immunohistochemistry analysis, fixed tissue slides were incubated with anti-Tβ10 Ab for 30 min at 4°C. The sections were washed with PBS, and incubated with biotinylated secondary Ab for 30 min before being mounted. An avidin-biotin reaction using peroxidase enzyme was used for protein detection (ABC kit; Vector Laboratories, Burlingham, CA). Immune complexes were detected with diaminobenzidine (DAB) under a phase contrast microscope (Olympus USA, Melville, NY). Images were captured with an attached SPOT-RT digital camera (Diagnostic Instruments, Sterling Heights, MI).

Bio-Plex Phosphoprotein Assay

BxPC-3 cells were treated with 200 ng/mL of Tβ10 for 5, 15, 30, or 60 min. Protein lysates were prepared using Cell lysis kit (Bio-Rad) on samples collected at each time point. The presence of p-Jun N-terminal Kinase (p-JNK) was detected by Bio-Plex 4-plex phosphoprotein assay kit (Bio-Rad) and the Phosphoprotein Testing Reagent kit (Bio-Rad) according to the manufacturer’s protocol as described previously 20. Briefly, 50 µl of cell lysate (adjusted to a concentration of 100–450 µg/ml of protein) was plated in the 96-well filter plate coated with anti-p-JNK Ab and incubated overnight on a platform shaker at 300 rpm at room temperature. After a series of washes to remove the unbound proteins, a mixture of biotinylated detection antibodies, each specific for a different epitope, was added to the reaction resulting in the formation of sandwiches of antibodies around the target proteins. Streptavidin-phycoerythrin (streptavidin-PE) was then added to bind to the biotinylated detection antibodies on the bead surface. Data from the reaction was then acquired and analyzed using the Bio-Plex suspension array system (Luminex 100 system) from Bio-Rad Laboratories. The total proteins for JNK were tested using the Bio-plex 4-plex total protein assay kit (Bio-Rad).

Bio-Plex Cytokine Assay

BxPC-3 cells were treated with 200 ng/mL of Tβ10 for 24 hrs and the supernatant was collected. Cytokine concentrations were determined using the Bioplex multiplex Human Cytokine Assay kit (Bio-Rad) and the Cytokine Reagent kit (Bio-Rad) according to the manufacturer’s protocol as described previously 20. 50 µl of culture supernatants or cytokine standards were plated in a 96-well filter plate coated with a multiplex of antibodies against a panel of cytokines and incubated on a platform shaker at 300 rpm at room temperature. Data from the reaction was then acquired and analyzed using the Bio-Plex suspension array system (Luminex 100 system) from Bio-Rad Laboratories.

Statistical analysis

Data from real-time PCR and Bio-Plex were expressed as mean±SEM. Significant differences were determined by Student’s t-test (p<0.05).

Results

Tβ10 is overexpressed in human pancreatic adenocarcinoma tissues and cell lines

To investigate the expression of Tβ10 in pancreatic cancer, seven pancreatic adenocarcinoma specimens and their surrounding normal pancreatic tissues were collected from the operating room under an approved IRB protocol. Tβ10 protein expression was determined via immunohistochemistry using antibodies specific for Tβ10. As shown in table 1, intense immunoreactivity was noted in cancer tissues, whereas only weak or negative staining was observed in surrounding benign tissues. A representative staining from normal and tumor tissues was shown in Fig. 1. We also confirmed the mRNA expression of Tβ10 in pancreatic cancer tissues and surrounding normal tissues by real time RT PCR, and we found that 70% of the cancer tissues overexpressed Tβ10 compared with the surrounding normal tissues. The overall fold increase of Tβ10 mRNA expression in pancreatic cancer tissue was 8.9 times greater than that in the surrounding normal tissues (Fig. 2A).

Fig. 1
Immunostaining of Tβ10 in pancreatic adenocarcinoma tissues. Normal pancreatic tissue composed of acinar cells and ductal epithelial cells with negative immunostaining of Tβ10. Representative pancreatic ductal adenocarcinoma showed positive ...
Fig. 2Fig. 2
Expression of Tβ10 mRNA in human pancreatic cancer tissues and cell lines. The Tβ10 mRNA expression in ten pairs of human pancreatic cancer specimens and surrounding normal tissues (A), and in seven human pancreatic cancer cells, and control ...
Table 1
Immunohistochemistry staining of Tβ10 in human pancreatic adenocarcinoma tissues.

We examined the expression of Tβ10 in seven human pancreatic cancer cell lines and a control cell line, HPDE cells. Tβ10 was differentially increased in five cell lines (Panc-1, ASPC-1, Capan-2, HPAF-II, and PL45) compared with that in HPDE cells (Fig. 2B).

Tβ10 activates the phosphorylation of JNK

To investigate the signaling molecules involved in the Tβ10 pathway in pancreatic cancer, we examined the phosphorylation of JNK in BxPC-3 cells treated by exogenous Tβ10. BxPC-3 cells were incubated with synthetic Tβ10 for 0, 5, 15, 30, or 60 min. The amount of phosphorylated JNK was compared to the total JNK protein levels at each time point to evaluate whether exposure to Tβ10 stimulated the phosphorylation of JNK. As shown in Fig. 3, Tβ10 significantly increased the amount of phosphorylated JNK in as little as 5 min, peaking at the 15 min mark before decreasing towards the baseline. Similar results were also observed in another pancreatic cancer cell line Panc-1 cells. These results indicate a possible involvement of JNK in the Tβ10 pathway during pancreatic cancer progression.

Fig. 3
Effect of Tβ10 on phosphorylation of JNK. BxPC-3 cells were treated with 200 ng/mL Tβ10 for 5, 15, 30, or 60 min. BxPC-3 cells without Tβ10 served as controls. Proteins extracted from samples collected at the indicated time points ...

Tβ10 increases secretion of multiple cytokines in pancreatic cancer cells

Cytokines, especially proinflammatory cytokines, are critical in pancreatic cancer pathogenesis and plan important roles in connecting tumor cells and the tumor microenvironment. We examined the effect of exogenous Tβ10 treatment on cytokine production in BxPC-3 cells, a pancreatic cancer cell line which has lower endogenous expression of Tβ10 as compared to other pancreatic cancer cells. As shown in Fig. 4, treatment with Tβ10 caused an increase of interleukin-7 (IL-7), and interleukin-8 (IL-8) in BxPC-3 cells by 12% and 37%, respectively. These data indicate that Tβ10 stimulates secretion of proinflammatory cytokines from pancreatic cancer cells, which may promote pancreatic cancer development.

Fig. 4
Effect of Tβ10 on cytokine secretion in pancreatic cancer cells. Supernatants from Tβ10-treated BxPC-3 cells were collected after 24 h. Cytokine levels were determined by Bio-plex cytokine assay. The values plotted are the percentage increase ...

Discussion

Our data demonstrated that the expression of Tβ10 is markedly and specifically increased in human pancreatic cancer cell lines and a series of primary tumor samples as compared to HPDE cells and the matching surrounding benign tissues. Exogenous synthetic Tβ10 treatment activated the JNK signaling in pancreatic cancer cells with significant increased phosphorylation of JNK observed in pancreatic cancer cell BxPC-3 cells treated by Tβ10. Furthermore, we have found that Tβ10 caused increased secretion of cytokines such as IL-7 and IL-8 in BxPC-3 cells. These results correlate well with previous studies showing aberrant expression of Tβ10 mRNA in several pancreatic cancer cell lines 16. The results also support the hypothesis that differential expression of Tβ10 may be a general feature of human cancer 2. The clear disparity in its expression between normal and cancer tissues suggests that Tβ10 could be a potential prognostic marker and therapeutic target for pancreatic cancer.

Tβ10 has been shown t o b e aberrantly expressed in many cancer types 712. Immunohistochemistry staining performed on melanoma, breast, and lung cancer tissue showed strong positive staining of Tβ10 specifically in neoplastic cells compared with weak staining in the surrounding benign tissues. Further examination of the ultrastructure of the malignant cells revealed a disorganized and loose cytoskeleton with few actin stress fibers 7. Previous study in 30 human breast tissue specimens indicated that Tβ10 was mostly detected in the tumor tissues, while the normal surrounding tissues showed very weak staining. Furthermore, the intensity of Tβ10 staining in the cancerous cells was increased in the higher grade of the lesions 9. Tβ10 was also identified in screening of a library for genes which were specifically expressed in highly metastatic human melanoma cell lines. The expression of Tβ10 mRNA correlated with metastatic behavior of various human melanoma cell lines in nude mice, which indicates that Tβ10 might be a new progression marker for human cutaneous melanoma 11. Alldinger et al recently found in a microarray analysis that 122 genes were upregulated in pancreatic tumor cell lines, but not in benign cells. Some of the upregulated genes have been shown to be related to pancreatic cancer, but many of them, including Tβ10, have not been indicated to play any functional roles in the development of pancreatic carcinoma 16. In this study, we found that Tβ10 was aberrantly expressed in established human pancreatic cancer cell lines and clinical specimens of pancreatic adenocarcinoma, which indicates that Tβ10 might be a promising diagnostic marker and play critical roles in pancreatic cancer.

We also found that Tβ10 can activate JNK in BxPC-3 cells. JNK is part of the mitogen activated protein kinase (MAPK) pathway, a cellular signaling cascade that regulates cell growth and survival. Therefore, our results indicate that Tβ10 might play an essential role in pancreatic cancer growth and invasion. A similar pattern of JNK activation was also observed in another pancreatic cancer cell line (Panc-1 cells), but no other signaling pathways such as ERK1/2, and p38MAPK were activated in those cells, indicating that the JNK pathway may be specifically activated by exogenous Tβ10 treatment in pancreatic cancer cells. How exactly the JNK pathway is activated by Tβ10 is not completely understood. Further studies are warranted to elucidate the connection between Tβ10 and downstream signaling pathways such as JNK in pancreatic cancer cells.

Cytokines, especially proinflammatory cytokines, are characteristic in pancreatic cancer pathogenesis, and play important roles in establishing a microenvironment around tumor cells and surrounding stroma cells. In this study, we found that in pancreatic cancer BxPC-3 cells, exogenous Tβ10 treatment increased the expression of cytokines IL-7 and IL-8. IL-7 is a critical component in human T-cell development, and its absence often leads to severe combined immune deficiency (SCID) syndrome 22. Overexpression of IL-7 in transgenic mice caused poor antigen response in T-cells, and specifically inhibited the cytotoxic activity against several tumor cell lines 23. Therefore, increased IL-7 may result in ineffective T cell response which favors tumor growth, and may help the tumor escape from host immune surveillance. IL-7 levels were also found to be tightly associated with ovarian cancer in a serum cytokine profiling study, which indicates that IL-7 could be used as a diagnostic marker to distinguish between malignant and benign ovarian tumors 24. IL-8 is a major inflammatory cytokine which has been shown to be upregulated in both cancer and chronic inflammatory diseases of the pancreas 25. IL-8 is thought to be involved in pancreatic cancer tumorigenesis primarily through its regulation of angiogenesis and metastasis 26. Several other studies also indicate that expression of IL-8 correlates with the progression of several cancers, including melanoma, ovarian, and pancreatic cancer 2733. The increase of cytokines in pancreatic cancer cells treated by Tβ10 may suggest an important mechanism in which Tβ10 promotes pancreatic cancer pathogenesis and progression through the upregulation of proinflammatory cytokines.

In summary, our results have shown that Tβ10 is upregulated in human pancreatic cancer. Initial studies imply that it may have a positive impact in cytokine secretion and JNK activation, therefore promotes pancreatic cancer progression. Further studies are needed to determine its prospective value as a diagnostic marker or possible therapeutic target in pancreatic cancer.

ACKNOWLEDGMENTS

This work was supported in part by the American Cancer Society Grant #IRG-93-034-09, the MacDonald Research Fund 06RDM013, (M. Li), and National Institutes of Health (NIH) Grants NIH EB002436, HL08347 (C. Chen), RO1 DE15543, and R21 AT003094 (Q. Yao).

References

1. Yu FX, Lin SC, Morrison-Bogorad M, Yin HL. Effects of thymosin beta 4 and thymosin beta 10 on actin structures in living cells. Cell Motil Cytoskeleton. 1994;27:13–25. [PubMed]
2. Santelli G, Califano D, Chiappetta G, Vento MT, Bartoli PC, Zullo F, et al. Thymosin beta-10 gene overexpression is a general event in human carcinogenesis. Am J Pathol. 1999;155:799–804. [PubMed]
3. Bodey B, Bodey B, Jr, Siegel SE, Kaiser HE. Review of thymic hormones in cancer diagnosis and treatment. Int J Immunopharmacol. 2000;22:261–273. [PubMed]
4. Erickson-Viitanen S, Ruggieri S, Natalini P, Horecker BL. Thymosin beta 10, a new analog of thymosin beta 4 in mammalian tissues. Arch Biochem Biophys. 1983;225:407–413. [PubMed]
5. Hall AK. Thymosin beta-10 accelerates apoptosis. Cell Mol Biol Res. 1995;41:167–180. [PubMed]
6. Yu FX, Lin SC, Morrison-Bogorad M, Atkinson MA, Yin HL. Thymosin beta 10 and thymosin beta 4 are both actin monomer sequestering proteins. J Biol Chem. 1993;268:502–509. [PubMed]
7. Liu CR, Ma CS, Ning JY, You JF, Liao SL, Zheng J. Differential thymosin beta 10 expression levels and actin filament organization in tumor cell lines with different metastatic potential. Chin Med J (Engl) 2004;117:213–218. [PubMed]
8. Oien KA, Vass JK, Downie I, Fullarton G, Keith WN. Profiling, comparison and validation of gene expression in gastric carcinoma and normal stomach. Oncogene. 2003;22:4287–4300. [PubMed]
9. Verghese-Nikolakaki S, Apostolikas N, Livaniou E, Ithakissios DS, Evangelatos GP. Preliminary findings on the expression of thymosin beta-10 in human breast cancer. Br J Cancer. 1996;74:1441–1444. [PMC free article] [PubMed]
10. Hall AK. Amplification-independent overexpression of thymosin beta-10 mRNA in human renal cell carcinoma. Ren Fail. 1994;16:243–254. [PubMed]
11. Weterman MA, van Muijen GN, Ruiter DJ, Bloemers HP. Thymosin beta-10 expression in melanoma cell lines and melanocytic lesions: a new progression marker for human cutaneous melanoma. Int J Cancer. 1993;53:278–284. [PubMed]
12. Hall AK. Differential expression of thymosin genes in human tumors and in the developing human kidney. Int J Cancer. 1991;48:672–677. [PubMed]
13. Takano T, Hasegawa Y, Miyauchi A, Matsuzuka F, Yoshida H, Kuma K, et al. Quantitative analysis of thymosin beta-10 messenger RNA in thyroid carcinomas. Jpn J Clin Oncol. 2002;32:229–232. [PubMed]
14. Califano D, Monaco C, Santelli G, Giuliano A, Veronese ML, Berlingieri MT, et al. Thymosin beta-10 gene overexpression correlated with the highly malignant neoplastic phenotype of transformed thyroid cells in vivo and in vitro. Cancer Res. 1998;58:823–828. [PubMed]
15. Santelli G, Bartoli PC, Giuliano A, Porcellini A, Mineo A, Barone MV, et al. Thymosin beta-10 protein synthesis suppression reduces the growth of human thyroid carcinoma cells in semisolid medium. Thyroid. 2002;12:765–772. [PubMed]
16. Alldinger I, Dittert D, Peiper M, Fusco A, Chiappetta G, Staub E, et al. Gene expression analysis of pancreatic cell lines reveals genes overexpressed in pancreatic cancer. Pancreatology. 2005;5:370–379. [PubMed]
17. Furukawa T, Duguid WP, Rosenberg L, Viallet J, Galloway DA, Tsao MS. Long-term culture and immortalization of epithelial cells from normal adult human pancreatic ducts transfected by the E6E7 gene of human papilloma virus 16. Am J Pathol. 1996;148:1763–1770. [PubMed]
18. Ouyang H, Mou L, Luk C, Liu N, Karaskova J, Squire J, et al. Immortal human pancreatic duct epithelial cell lines with near normal genotype and phenotype. Am J Pathol. 2000;157:1623–1631. [PubMed]
19. Li M, Yang H, Chai H, Fisher WE, Wang X, Brunicardi FC, et al. Pancreatic carcinoma cells express neuropilins and vascular endothelial growth factor, but not vascular endothelial growth factor receptors. Cancer. 2004;101:2341–2350. [PubMed]
20. Li M, Zhai Q, Bharadwaj U, Wang H, Li F, Fisher WE, et al. Cyclophilin A is overexpressed in human pancreatic cancer cells and stimulates cell proliferation through CD147. Cancer. 2006;106:2284–2294. [PubMed]
21. Li M, Zhang Y, Liu Z, Bharadwaj U, Wang H, Wang X, et al. Aberrant expression of zinc transporter ZIP4 (SLC39A4) significantly contributes to human pancreatic cancer pathogenesis and progression. Proc Natl Acad Sci U S A. 2007;104:18636–18641. [PubMed]
22. Macchi P, Villa A, Giliani S, Sacco MG, Frattini A, Porta F, et al. Mutations of Jak-3 gene in patients with autosomal severe combined immune deficiency (SCID) Nature. 1995;377:65–68. [PubMed]
23. Uehira M, Matsuda H, Nakamura A, Nishimoto H. Immunologic abnormalities exhibited in IL-7 transgenic mice with dermatitis. J Invest Dermatol. 1998;110:740–745. [PubMed]
24. Lambeck AJ, Crijns AP, Leffers N, Sluiter WJ, ten Hoor KA, Braid M, et al. Serum cytokine profiling as a diagnostic and prognostic tool in ovarian cancer: a potential role for interleukin 7. Clin Cancer Res. 2007;13:2385–2391. [PubMed]
25. Farrow B, Sugiyama Y, Chen A, Uffort E, Nealon W, Mark Evers B. Inflammatory mechanisms contributing to pancreatic cancer development. Ann Surg. 2004;239:763–769. discussion 769-71. [PubMed]
26. Xie K. Interleukin-8 and human cancer biology. Cytokine Growth Factor Rev. 2001;12:375–391. [PubMed]
27. Varney ML, Johansson SL, Singh RK. Distinct expression of CXCL8 and its receptors CXCR1 and CXCR2 and their association with vessel density and aggressiveness in malignant melanoma. Am J Clin Pathol. 2006;125:209–216. [PubMed]
28. Luca M, Huang S, Gershenwald JE, Singh RK, Reich R, Bar-Eli M. Expression of interleukin-8 by human melanoma cells up-regulates MMP-2 activity and increases tumor growth and metastasis. Am J Pathol. 1997;151:1105–1113. [PubMed]
29. Furuya M, Suyama T, Usui H, Kasuya Y, Nishiyama M, Tanaka N, et al. Up-regulation of CXC chemokines and their receptors: implications for proinflammatory microenvironments of ovarian carcinomas and endometriosis. Hum Pathol. 2007;38:1676–1687. [PubMed]
30. Gorelik E, Landsittel DP, Marrangoni AM, Modugno F, Velikokhatnaya L, Winans MT, et al. Multiplexed immunobead-based cytokine profiling for early detection of ovarian cancer. Cancer Epidemiol Biomarkers Prev. 2005;14:981–987. [PubMed]
31. Yurkovetsky ZR, Kirkwood JM, Edington HD, Marrangoni AM, Velikokhatnaya L, Winans MT, et al. Multiplex analysis of serum cytokines in melanoma patients treated with interferon-alpha2b. Clin Cancer Res. 2007;13:2422–2428. [PubMed]
32. Xie K, Wei D, Huang S. Transcriptional anti-angiogenesis therapy of human pancreatic cancer. Cytokine Growth Factor Rev. 2006;17:147–156. [PubMed]
33. Bellone G, Smirne C, Mauri FA, Tonel E, Carbone A, Buffolino A, et al. Cytokine expression profile in human pancreatic carcinoma cells and in surgical specimens: implications for survival. Cancer Immunol Immunother. 2006;55:684–698. [PubMed]