Plasmids and lentiviral production
Constructs used to generate lentivirus, including pSPAX2, pLVTHM, and pMD2G, were provided by D. Trono (Swiss Federal Institute of Technology, Lausanne, Switzerland;
Zufferey et al., 1997). pLV-Venus and pLV-mRFP lentivirus constructs were provided by I.G. Macara (University of Virginia, Charlottesville, VA;
McCaffrey and Macara, 2009). pCMV5HIS6-Ub was provided by D. Wotton (University of Virginia). pWPI was purchased from Addgene. Lentiviral production was performed as described previously (
McCaffrey and Macara, 2009) but titered using MCF-10A cells.
The short hairpin sequence including the ERK8-targeting shRNAs (in bold) are (ERK8-1) 5′-GATCCCC
ACATTTACCTGGTGTTTGATTCAAGAGA
TCAAACACCAGGTAAATGTTTTTTGGAAA-3′ and (ERK8-2) 5′-GATCCCC
GACAGATGCCCAGAGAACATTCAAGAGA
TGTTCTCTGGGCATCTGTCTTTTTGGAAA-3′. The short hairpin sequence including the luciferase-targeting shRNAs (in bold) is 5′-GATCCCC
CGTACGCGGAATACTTCGATTCAAGAGA
TCGAAGTATTCCGCGTACGTTTTTGGAA-3′ (
Malliri et al., 2004). GST-PIP and GST-PIPm were generated by subcloning into pGEX2T (GE Healthcare) the annealed oligonucleotides with the upper strand sequences 5′-GATCCCAGGCACTGCAGCACCCCTACGTGCAGAGGTTCCACTGCCCCTGAG-3′ and 5′-GATCCCAGGCACTGGCGCACCCCTACGTGCAGAGGTTCCACTGCCCCTGAG-3′. All shRNA, deletion, and mutant constructs were verified by sequencing (Biomolecular Research Core, University of Virginia).
Cell culture and treatment
MCF-10A, MCF-7, and T47D were cultured as indicated by the American Type Culture Collection. Primary HME cells were purified from tissue (
McCaffrey and Macara, 2009) and cultured (
Eisinger-Mathason et al., 2008). For irradiation, the cells were washed with PBS and exposed to 20 J/m
2 UVC. Comet assay was performed according to the manufacturer (Trevigen, Inc.) and electrophoresed under alkaline conditions (275 mA for 30 min at 4°C). Cell fractionation was performed as described previously (
Avkin et al., 2006). Transient transfection was performed with Lipofectamine 2000 (Invitrogen) reagent using nontargeting siRNA #1, human MDM2 SMARTpool siRNA, or human PCNA SMARTpool siRNA (Thermo Fisher Scientific). The following chemicals were used: nutlin-3 (EMD); hydroxyurea, etoposide, cisplatin, and MMS (methyl methane sulphonate; Sigma-Aldrich); and H
2O
2 (Thermo Fisher Scientific) and MNNG (
N-methyl-
N’-
N-nitrosoguanidine; TCI America).
Immunodetection and immunofluorescence
Primary antibodies used were monoclonal anti-p27, rabbit anti–RFC-1, monoclonal anti-GST, rabbit anti-HA, monoclonal anti-HDM2, monoclonal anti-p53, and monoclonal anti-PCNA (Santa Cruz Biotechnology, Inc.); monoclonal anti–cyclin D1, monoclonal anti-Rb, rabbit anti–phospho-Ser428 ATR, rabbit anti–phospho-Thr68 Chk2, and rabbit anti-Chk2 (Cell Signaling Technology); monoclonal anti–phospho-Tyr, rabbit anti–phospho-Ser, rabbit anti–cyclin E, and monoclonal anti–γ-H2AX (Millipore); rabbit anti–phospho-Thr (Invitrogen); monoclonal anti-Rad9 and rabbit anti–phospho-MAPK (pThr202/pTyr204; Thermo Fisher Scientific); rabbit anti-ERK8 (Abgent); monoclonal anti-PCNA (Dako); monoclonal anti-Ran (BD); monoclonal anti–cyclin A (Novocastra); goat anti-GFP and rabbit anti-GFP (Venus; Abcam); and monoclonal anti-HA (12CA5; Lymphocyte Culture Center, University of Virginia). Secondary antibodies used were goat anti–mouse, goat anti–rabbit, and donkey anti–goat (Jackson ImmunoResearch Laboratories, Inc.).
Detection of PCNA and Venus-tagged chromatin-binding proteins was adapted from
Sporbert et al. (2002). In brief, cells were plated on coverslips, washed twice with ice-cold PBS, and permeabilized for 30 s with ice-cold cytoskeleton buffer (10 mM Pipes, pH 6.8, 250 mM sucrose, 50 mM NaCl, 2 mM MgCl
2, 2 mM EGTA, and 0.1% Triton X-100). The permeabilized cells were washed with ice-cold wash buffer (4.3 mM Na
2HPO
4, 1.5 mM KH
2PO
4, 520 mM NaCl, and 2.66 mM KCl) and fixed in ice-cold methanol at −20°C for 5 min. PCNA was detected by indirect fluorescence with a mouse monoclonal anti-PCNA antibody (clone PC-10; Dako) and an anti–mouse IgG antibody conjugated with Alexa Fluor 546 (Invitrogen). Direct fluorescence was observed with Venus fusion proteins.
Detection of γ-H2AX was adapted from
Jørgensen et al. (2007). Cells were plated on coverslips, washed twice in ice-cold PBS, followed by extraction for 10 min on ice with Triton buffer (20 mM Hepes, pH 7.4, 300 mM sucrose, 50 mM NaCl, 3 mM MgCl
2, and 0.5% Triton X-100), and fixed with 4% paraformaldehyde for 10 min. γ-H2AX was detected by indirect fluorescence with phospho-Ser139 histone H2A.X (clone JBW301; Millipore) primary antibody and an anti–mouse IgG antibody conjugated with Alexa Fluor 546. DNA was stained with Hoechst (Sigma-Aldrich) or DRAQ5 (Axxora).
Densitometry analysis for immunodetection was performed using ImageJ (National Institutes of Health) or ImageQuant (GE Healthcare) software. Indirect and direct fluorescent images were obtained at room temperature with a laser-scanning microscope (510/Meta/FCS; Carl Zeiss, Inc.) using a 40× NA 1.3 oil immersion lens. Images were acquired using LSM-FCS software (Carl Zeiss, Inc.) and quantitated using Openlab 3.1.4 (PerkinElmer) and ImageJ software. Images were processed in Photoshop version CS3 (Adobe).
Proliferation and cell cycle assays
Cells were analyzed for proliferation using a Luminescent Cell Viability Assay (Promega). Fixed cells (2% paraformaldehyde, pH 7.4, and 0.05% Triton X-100) were incubated with 40 µM DRAQ5, washed, and analyzed on a FACSCalibur (BD) using FlowJo 6.4.2 software (Tree Star, Inc.; Flow Cytometry Core Facility, University of Virginia).
Immunoprecipitation
Cells were washed twice with ice-cold PBS. The soluble fraction was obtained by incubating the cells (5 min at 4°C) with cytoskeleton buffer with 1 µM microcystin and phosphatase inhibitor cocktail (Sigma-Aldrich). The insoluble fraction was treated with sonication buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 0.1% deoxycholate, 1 µM microcystin, and phosphatase inhibitor cocktail). The insoluble fraction was sonicated (15 pulses of 5 s with 15-s cool down on setting 5) with a cup horn sonicator (Misonix). The sonicated insoluble fraction was incubated with 3 mM MgCl2 and 400 U RNase-free DNase I/10 µg DNA (New England Biolabs, Inc.) for 1 h at 4°C. Soluble and insoluble fractions were incubated with 2 µg HA, PCNA, or IgG antibodies for 3 h at 4°C in thermomixer (900 rpm). In some experiments 1 µg GST, GST-PIP, or GST-PIPm was incubated with the soluble fraction. Approximately 140 µl of Dynabeads sheep anti–mouse secondary antibody (Invitrogen) was washed with immunoprecipitation buffer and incubated with lysate for 1 h at 4°C in a thermomixer (900 rpm). The immunoprecipitates were washed five times in the appropriate immunoprecipitation buffer, three times high salt buffer (10 mM Hepes, pH 7.4, 300 mM NaCl, 10 mM KCl, and 1 mM EDTA), and three times with the immunoprecipitation buffer. The beads were boiled in 2× SDS lysis buffer (0.12 M Tris-Cl, pH 6.8, 4% SDS, 20% glycerol, 0.2 M DTT, and 0.008% bromophenol blue), heated to 100°C for 5 min
Pulse-chase labeling
Cells were washed and preincubated for 4 h with cold labeling media (Met-free DMEM/F12 [Sigma-Aldrich], 5% dialyzed horse serum, 0.5 µg/ml hydrocortisone, 100 ng/ml cholera toxin, 10 µg/ml insulin, and 5.75 µM cold Met). l-[35S]Met (200 µCi/ml; 800 Ci/mmol; PerkinElmer) was added and incubated for 4 h. After washing with labeling media plus 2 mM cold Met, the cells were replaced in their normal growth media and harvested for immunoprecipitation.
Statistical analysis
Data are presented as mean ± SEM; Student’s two-tailed t test was used for comparisons, with P < 0.05 considered significant.
Online supplemental material
Fig. S1 shows that ERK8 regulates the cell cycle. Fig. S2 shows that loss of ERK8 increases DNA damage. Fig. S3 shows that ERK8 regulates PCNA turnover. Fig. S4 shows that inhibition of p53 degradation does not alter PCNA protein levels. Fig. S5 examines the activation, levels, and subcellular distribution of ERK8 in response to DNA-damaging agents. Online supplemental material is available at
http://www.jcb.org/cgi/content/full/jcb.201002124/DC1.