PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of plosbiolPLoS BiologySubmit to PLoSGet E-mail AlertsContact UsPublic Library of Science (PLoS)View this Article
 
PLoS Biol. Aug 2010; 8(8): e1000462.
Published online Aug 24, 2010. doi:  10.1371/journal.pbio.1000462
PMCID: PMC2927514
TRIM5 Suppresses Cross-Species Transmission of a Primate Immunodeficiency Virus and Selects for Emergence of Resistant Variants in the New Species
Andrea Kirmaier,1,2 Fan Wu,3 Ruchi M. Newman,4 Laura R. Hall,1 Jennifer S. Morgan,1 Shelby O'Connor,5 Preston A. Marx,6 Mareike Meythaler,2,7 Simoy Goldstein,3 Alicia Buckler-White,3 Amitinder Kaur,7 Vanessa M. Hirsch,3 and Welkin E. Johnson1*
1New England Primate Research Center, Department of Microbiology and Molecular Genetics, Harvard Medical School, Southborough, Massachusetts, United States of America
2Institut für Klinische und Molekulare Virologie, Friedrich-Alexander-Universität Erlangen-Nürnberg, Germany
3Laboratory of Molecular Microbiology, National Institute of Allergy and Infectious Disease, National Institutes of Health, Bethesda, Maryland, United States of America
4Genome Sequencing and Analysis Program, Broad Institute of MIT and Harvard, Cambridge, Massachusetts, United States of America
5Department of Pathology and Laboratory Medicine, University of Wisconsin-Madison, Madison, Wisconsin, United States of America
6Tulane Regional Primate Research Center, Covington, Louisiana, United States of America
7New England Primate Research Center, Division of Immunology, Harvard Medical School, Southborough, Massachusetts, United States of America
Michael Emerman, Academic Editor
Fred Hutchinson Cancer Research Center, United States of America
* E-mail: wjohnson/at/hms.harvard.edu
The author(s) have made the following declarations about their contributions: Conceived and designed the experiments: A Kirmaier, A Kaur, VM Hirsch, WE Johnson. Performed the experiments: A Kirmaier, F Wu, LR Hall, JS Morgan, S O'Connor, M Maythaler, S Goldstein, A Buckler-White. Analyzed the data: A Kirmaier, A Kaur, WE Johnson. Contributed reagents/materials/analysis tools: F Wu, RM Newman, PA Marx, VM Hirsch. Wrote the paper: A Kermaier, WE Johnson.
Received May 4, 2010; Accepted July 14, 2010.
Simian immunodeficiency viruses of sooty mangabeys (SIVsm) are the source of multiple, successful cross-species transmissions, having given rise to HIV-2 in humans, SIVmac in rhesus macaques, and SIVstm in stump-tailed macaques. Cellular assays and phylogenetic comparisons indirectly support a role for TRIM5α, the product of the TRIM5 gene, in suppressing interspecies transmission and emergence of retroviruses in nature. Here, we investigate the in vivo role of TRIM5 directly, focusing on transmission of primate immunodeficiency viruses between outbred primate hosts. Specifically, we retrospectively analyzed experimental cross-species transmission of SIVsm in two cohorts of rhesus macaques and found a significant effect of TRIM5 genotype on viral replication levels. The effect was especially pronounced in a cohort of animals infected with SIVsmE543-3, where TRIM5 genotype correlated with approximately 100-fold to 1,000-fold differences in viral replication levels. Surprisingly, transmission occurred even in individuals bearing restrictive TRIM5 genotypes, resulting in attenuation of replication rather than an outright block to infection. In cell-culture assays, the same TRIM5 alleles associated with viral suppression in vivo blocked infectivity of two SIVsm strains, but not the macaque-adapted strain SIVmac239. Adaptations appeared in the viral capsid in animals with restrictive TRIM5 genotypes, and similar adaptations coincide with emergence of SIVmac in captive macaques in the 1970s. Thus, host TRIM5 can suppress viral replication in vivo, exerting selective pressure during the initial stages of cross-species transmission.
The human immunodeficiency viruses HIV-1 and HIV-2 originated from cross-species transmission of simian immunodeficiency viruses (SIVs) from chimpanzees (SIVcpz) and sooty mangabeys (SIVsm), respectively. A related virus, SIVmac, causes AIDS-like pathogenesis in rhesus macaques; like HIV-2, SIVmac is the product of a cross-species jump of SIVsm from sooty mangabeys. The primate TRIM5 gene encodes a factor with potent antiviral activity when tested in the laboratory, and TRIM5 proteins are thought to play a role in restricting the movement of viruses between species in nature. In this study, we show that genetic variation in the TRIM5 gene of rhesus macaques heavily influences the outcome of cross-species transmission of SIVsm and that emergence of SIVmac in rhesus macaques in the 1970s required adaptations to circumvent the genetic barrier imposed by the rhesus macaque TRIM5 gene. Our results confirm the hypothesis that TRIM5 can influence the process of cross-species transmission and emergence of viruses related to HIV-1 and HIV-2 and serve as a striking illustration of how host genes can influence virus evolution.
The Simian immunodeficiency viruses (SIVs) are widespread among African primates [1]. However, host and viral phylogenies are not completely congruent; such a pattern argues against co-divergence of virus and host lineages since the time of a common, infected primate ancestor and argues instead that the modern distribution of SIVs among extant primates resulted, at least in part, from cross-species transmission events followed by emergence of new virus/host combinations [2]. The most notable examples include cross-species transmission of SIV from apes to humans, which gave rise to HIV-1 and initiated the worldwide AIDS epidemic, and cross-species transmission of SIV from sooty mangabeys (SIVsm) to humans, which gave rise to the more limited HIV-2 epidemic [1],[3],[4]. In a striking parallel to the emergence of HIV-1 and HIV-2, SIVsm also jumped into captive Asian macaques in the United States, resulting in emergence of SIVmac and outbreaks of AIDS-like disease at several U.S. National Primate Research Centers in the 1970s [3],[5],[6]. The exact time and means by which SIVsm was transmitted to macaques are unknown, but since isolation of the first SIV strains from captive macaques in the 1980s, experimental infection of rhesus macaques with SIV has become the primary animal model for preclinical research on AIDS vaccines and pathogenesis. Variation in susceptibility to infection and disease progression in nonhuman primate models often confounds such studies, and identifying the sources of variation will lead to more efficient use of AIDS models. At the same time, genetic variation in nonhuman primate hosts of SIV provides unique and powerful opportunities to study the impact of host genetics on cross-species transmission, adaptation, and emergence of viruses. In the present study, we establish that allelic variation in the rhesus macaque TRIM5 gene results in differences in susceptibility to infection and viral replication in the early stages of cross-species transmission of SIVsm and that emergence of pathogenic SIVmac in rhesus macaques required adaptations in the viral capsid protein (CA) to overcome suppression by two distinct types of TRIM5 allele.
Viral inhibition by TRIM5α, a product of the TRIM5 gene, is initiated by an interaction between the protein's B30.2/SPRY domain and virion capsid-cores released into the target-cell cytoplasm after viral attachment and entry [7][13]. The target of TRIM5α involves the N-terminal domain (NTD) of the viral CA protein [14]. We previously discovered that rhesus macaque TRIM5 is highly polymorphic, including eight nonsynonymous polymorphisms tightly clustered in the B30.2/SPRY domain [15]. One of these, a six-nucleotide insertion/deletion, results in a TFP/Q length polymorphism. When tested against multiple lentiviruses, TFP339-341 and Q339 alleles (TRIM5TFP and TRIM5Q) give different patterns of restriction [16]. An unusual haplotype encoding a TRIM5-cyclophilin-A chimera (TRIM5CypA) is also found among rhesus macaques [17],[18]. The chimeric TRIM5CypA lacks a B30.2/SPRY domain and in its place encodes a CypA domain derived from a retrotransposed CypA reading frame inserted in the 3′UTR [17][21]. TRIM5CypA restriction of lentiviral infection involves specific binding to a peptide loop between helices 4 and 5 of the viral CA (also the binding site for cellular CypA) [22],[23].
Common variants of rhesus TRIM5 can be grouped into three allelic classes: TRIM5CypA, TRIM5TFP, and TRIM5Q (Figure 1) [16],[24]. We established the existence of all six possible genotypes in a large colony of captive rhesus macaques, using archived genomic DNA samples from the Genetics Core of the New England Primate Research Center. In this colony, we observed frequencies of 46% (TRIM5TFP/TFP), 36% (TRIM5TFP/Q), 5% (TRIM5TFP/CypA), 10% (TRIM5Q/Q), 1% (TRIM5Q/CypA), and 2% (TRIM5CypA/CypA). These values indicate allele frequencies in one particular colony of rhesus macaques; because of differences in animal husbandry practices and potential founder effects, these values do not necessarily reflect the distribution of genotype frequencies within other captive colonies or in wild rhesus monkey populations. Nonetheless, the presence of allelic variation in the rhesus TRIM5 gene can be exploited to study the impact of TRIM5 expression in vivo.
Figure 1
Figure 1
The rhesus macaque TRIM5 coding sequence is highly polymorphic.
To ask whether TRIM5-mediated restriction plays a role in cross-species transmission and emergence of primate lentiviruses, we tested six representative alleles of rhesus macaque TRIM5 for restriction activity against four closely related viruses of old-world monkeys, SIVmac239, SIVsmE543, SIVsmE041, and SIVstm/37.16 (Table 1). SIVmac239 is a molecular clone of a highly adapted, emergent virus of rhesus macaques [25], generated in the 1980s by experimental passage of SIV-positive plasma through a series of five monkeys [26]. In all likelihood, SIVmac239 is descended from a cross-species transmission event that took place in the 1960s in captive colonies of rhesus macaques [5], probably as the unintended consequence of experiments involving transfer of biological material from SIVsm-positive sooty mangabeys to rhesus macaques [27]. Regardless of origin, as a result of this long association with macaques, experimental infection with SIVmac239 reproducibly results in high levels of persistent viral replication [28]. In contrast, SIVsmE543-3 is a molecular clone derived by intentional inoculation of a rhesus macaque with plasma from an SIVsm-infected sooty mangabey, followed by passage through one additional rhesus macaque [29]; thus, opportunity for SIVsmE543-3 to adapt to macaques was limited to only two animals. As a result, SIVsmE543-3 replication in macaques is highly variable, with acute viral loads ranging from 103 to 108 viral RNA copies/ml plasma, and set-point values from <100 to 108. Variation in SIVsmE543-3 infected animals is consistent with an influence of genetic variation in a host gene or genes [30]. SIVsmE041 is a biological isolate cultured directly from an SIV-positive sooty mangabey [31] and has therefore not experienced any prior adaption to rhesus macaques. SIVstm/37.16 is an SIV isolate from a different species, the stump-tailed macaque (M. arctoides), and represents an independent cross-species transmission event involving transmission of SIVsm directly to M. arctoides animals [3],[27],[32],[33]. The relevant properties of these four viruses are summarized in Table 1.
Table 1
Table 1
Overview of SIV strains used in this study.
Infectivity of all four viruses was measured on cell lines stably expressing six common alleles of rhesus macaque TRIM5, including three TRIM5TFP alleles, two TRIM5Q alleles, and the TRIM5CypA allele (Figure 2). SIVmac239 was resistant to all six. SIVsmE041, SIVsmE543, and SIVstm were also resistant to TRIM5Q but unlike SIVmac239 were sensitive to both TRIM5CypA alleles and TRIM5TFP alleles (Figure 2B,C,D). Of the four SIV strains tested, only SIVmac239 is the product of decades of replication and spread in rhesus macaques. Thus, the comparison suggests that sensitivity to TRIM5TFP and TRIM5CypA alleles represents the ancestral phenotype and that emergence of SIVsm (as SIVmac) in rhesus macaques required acquisition of adaptive changes to overcome those particular types of alleles. In contrast, the SIVsm variants that first invaded rhesus macaques were probably inherently resistant to TRIM5Q alleles.
Figure 2
Figure 2
Differential restriction of SIVmac and SIVsm strains by multiple alleles of rhesus macaque TRIM5.
To analyze the impact of TRIM5 variation on cross-species transmission directly, we acquired samples from two independent SIVsm/macaque cohorts. The smaller cohort consisted of four sooty mangabeys and four rhesus macaques that had been experimentally inoculated with SIVsmE041 [34]. Infection of sooty mangabeys (natural hosts of SIVsm) resulted in ready take of virus and persistent infection (unpublished data), whereas infection of macaques resulted in a transient infection followed by a decrease in viral replication to a point near or below the detection limit (Figure 3). Using archived DNA, we determined that the four macaques included three TRIM5TFP/TFP homozygotes and one TRIM5TFP/CypA heterozygote. Thus, the alleles present in these four animals were all of the same types that restricted SIVsmE041 in tissue culture (Figure 2B). In one animal, replication resurged during the first year, reaching ~104 RNA copies/ml plasma (Figure 3). Capsid sequences recovered from this animal revealed the appearance of two fixed changes, R97S and V108A (SIVmac239 numbering) at the late time point (Figure 3C). In contrast, amplification and sequencing from acute infection, from the SIVsmE041 inoculum, and from an infected sooty mangabey, revealed only the ancestral states at both positions (R97 and V108) (Figure 3B).
Figure 3
Figure 3
Attenuated replication of the sooty mangabey virus SIVsmE041 upon experimental cross-species transmission to rhesus macaques.
The second and larger cohort consisted of historical samples from 44 SIVsmE543-3-infected rhesus macaques. Genotype frequencies in this cohort were 30% TRIM5TFP/TFP, 23% TRIM5TFP/Q, 26% TRIM5TFP/CypA, 12% TRIM5Q/Q, 9% TRIM5Q/CypA, and 0% TRIM5CypA/CypA. Animals with two restrictive alleles (TRIM5TFP/TFP and TRIM5TFP/CypA) had dramatically diminished viral replication compared to TRIM5Q/Q homozygotes, with mean (geometric) differences of 830-fold and 1,728-fold, respectively, by 8 wk post-infection (Figure 4). Animals with one restrictive allele (TRIM5TFP/Q and TRIM5CypA/Q heterozygotes) displayed intermediate levels of viral replication. Taken in conjunction with the clear differences in restriction of SIVsmE543-3 by TRIM5TFP, TRIM5CypA, and TRIM5Q in vitro (Figure 2C), these results are consistent with allelic variation in TRIM5 having a significant impact on SIVsmE543 replication kinetics in rhesus macaques. We also obtained archived DNA from animal #E543, the source of the original SIVsmE543-3 clone [29], and determined that this animal had been a TRIM5Q/Q homozygote. The fact that E543 bore a non-restrictive genotype may well have facilitated isolation of the original SIVsmE543-3 clone.
Figure 4
Figure 4
TRIM5 genotype and replication of SIVsmE543-3 in rhesus macaques.
Several reports describe a correlation between specific alleles of class I MHC and enhanced control of SIVmac239/SIVmac251 infection in rhesus macaques [35][37]. Specifically, MHC class-I Mamu-B*08 and Mamu-B*17 alleles have been associated with lower levels of chronic phase viral replication in SIVmac239-infected animals [35],[37]. Several observations argue against the dramatic differences in viral replication of SIVsmE543-3 in rhesus macaques being due to Mhc class I rather than TRIM5. First, the TRIM5 and class I MHC loci are on different chromosomes, reducing the probability of a chance association between suppressive alleles of TRIM5 and a specific allele or alleles of class I MHC with activity against SIVsmE543-3. More importantly, the effects of class I Mhc on SIVmac239 replication do not manifest during the acute stage of infection [38], whereas the correlation with TRIM5 genotype is already apparent during acute infection (Figure 4D). Finally, Goldstein et al. demonstrated that variation in susceptibility of cells taken from naïve animals (prior to infection) and tested ex vivo correlated with viral replication levels in vivo, when the same animals were subsequently infected with SIVsmE543; such results argue in favor of an inherent, genetic cause of variation in susceptibility and against an effect of virus-specific adaptive immune responses induced by infection [30]. Finally, we typed all 43 animals in the SIVsm543-3 cohort for the presence of the Mamu-B*08 and Mamu-B*17 alleles and found no association between these alleles and the observed differences in Figure 4. Most importantly, none of the infected animals with TRIM5Q/Q or TRIM5TFP/CypA genotypes were Mamu-B*08 or Mamu-B*17 positive, so the statistically significant differences between those two groups cannot be attributed to Mamu-B*08 or Mamu-B*17 associated control of SIVsmE543. Thus, the observed correlation between TRIM5 genotype and SIVsmE543-3 replication levels is not due to a spurious association between suppressive alleles of TRIM5 and class I MHC alleles previously associated with control of SIVmac239. It is important to note, however, that this result does not rule out a general influence of class I Mhc on viral replication levels in rhesus macaques, only that MHC genotype does not explain the correlation depicted in Figure 4. Among other things, allelic variation in MHC class I may well contribute to the significant variation observed within groups (Figure 4C,D,E).
Three macaques in the SIVsmE543-3 cohort also had patterns of resurgent viral replication consistent with escape from suppression (Figure 5A). All three animals had two restrictive alleles and included one TRIM5TFP/TFP homozygote and two TRIM5TFP/CypA heterozygotes. We amplified gag sequences encoding the NTD of CA from all three animals, and from a TRIM5Q/Q animal, and compared these to the original SIVsmE543-3 clone (Figure 5B). Strikingly, an R97S change was present in every clone from all three animals, typically due to an AGA->AGC substitution, although 3/15 clones in one animal were AGA->AGT. No changes were found in the corresponding region of virus from the non-restrictive TRIM5Q/Q animal. Thus, an identical R97S change appeared independently in four animals with suppressive TRIM5 genotypes, including three SIVsmE543-infected animals (Figure 5B) and one SIVsmE041-infected animal (Figure 3).
Figure 5
Figure 5
Emergence of Trim5-resistant SIV in vivo.
Phylogenetic analyses are consistent with a minimum of two historical transmissions of SIVsm into macaques, one into stump-tailed macaques (SIVstm), and the other into rhesus macaques (SIVmac); both transmissions are thought to have occurred in captive macaques sometime prior to the 1970s [3]. If TRIM5-mediated restriction influences cross-species transmission of primate lentiviruses, we predict the existence of adaptive changes in SIV isolates corresponding to such events. Indeed, alignment of the NTD of several lentiviruses in the SIVsm/SIVmac/HIV-2 lineage revealed multiple potential adaptations in SIVmac (Figure 6). Most striking is an inferred R97S change, identical to the change that appeared in the SIVsmE041 and SIVsmE543 experimental cohorts described above (Figures 3 and and5B).5B). Based on phylogeny of the SIVsm/SIVmac/HIV-2 lineage [3], the R97S change was probably selected twice, once coinciding with emergence of SIVmac in rhesus macaques and once coinciding with emergence of SIVstm in stump-tailed macaques. Consistent with this interpretation, the underlying nucleotide substitutions are different in the two viruses (AGA->AGC in SIVstm, and AGA->TCA in SIVmac). However, S97 is also found in a small percentage of HIV-2 and SIVsm isolates; thus, it is possible that one or both historical transmissions were initiated by an SIVsm with serine at position 97, rather than de novo mutation as seen in the experimental cohorts. In either case, these combined observations strongly suggest that S97 is selectively advantageous in macaques.
Figure 6
Figure 6
Adaptations in the CA of SIVmac strains confer resistance to a subset of rhesus TRIM5 alleles.
The second putative adaptation is a highly unusual LPA/QQ substitution at the tip of the CA 4–5 loop (QQ89,90 in SIVmac239). How this change was generated is unclear but must have involved multiple point mutations and a net loss of three nucleotides. While QQ89,90 is very common among SIVmac isolates, P90 (the proline in LPA89–91) is extremely well conserved in SIVsm and HIV-2 isolates (Figure 6). The highly unusual nature of the LPA->QQ substitution, together with its location in a stretch of residues known to affect TRIM5-mediated restriction [14],[39], mark it as a potential adaptation that arose to circumvent restriction by rhesus macaque TRIM5 proteins.
To ask whether the R97S and LPA/QQ changes in SIVmac strains arose as adaptations to overcome rhesus TRIM5, we reverted these sites to the ancestral sequence in the context of the macaque-adapted strain SIVmac239. We then tested SIVmac239S97R and SIVmac239QQ->LPA for gain-of-sensitivity to different rhesus TRIM5 alleles. Indeed, the S97R reversion resulted in increased sensitivity to all three TRIM5TFP alleles but had no effect on resistance to the TRIM5Q or TRIM5CypA alleles. In contrast, the QQ89,90-to-LPA89-91 reversion resulted in sensitivity to both TRIM5TFP and TRIM5CypA alleles. This closely resembles the pattern displayed by SIVsm isolates (see Figure 2B and C), confirming that these represent bona fide adaptations to overcome restriction by rhesus TRIM5 alleles. Because QQ89,90 is in the 4–5 loop of capsid, the adaptation probably functions by altering the TRIM5CypA binding site. The structural basis for the interaction between the TRIM5 B30.2/SPRY domain and viral CA is not yet well defined, and it is not clear why QQ89,90 also affects resistance to TRIM5TFP alleles. However, this result is consistent with studies showing that site-directed mutations in the HIV-1 CypA-binding domain influence binding and restriction by TRIM5α proteins [39]. A better understanding of the influence of CA positions 89–91 on restriction awaits more detailed, structural understanding of the interaction between CA and TRIM5α.
Neither reversion affected resistance of SIVmac239 to TRIM5Q, consistent with our observation that SIVsmE041 and SIVsmE543, which retain ancestral states at these sites, were also resistant to TRIM5Q (Figure 2). We conclude that TRIM5Q alleles did not significantly hamper SIVsm colonization of rhesus macaques or its emergence as SIVmac in the 1970s. In fact, TRIM5Q/Q animals may have facilitated initial transmission of SIVsm among macaques, permitting higher levels of replication and increasing the probability of adaptation and spread.
Unlike the R97S change, we did not see the LPA89–91/QQ89,90 change appear in either experimental cohort (Figures 3 and and5B),5B), possibly because the multiple mutations involved make it a low probability occurrence. Once virus with the QQ89,90 motif in CA appeared, however, it probably contributed to emergence of SIVmac by facilitating spread among animals bearing restrictive TRIM5CypA alleles. Consistent with this hypothesis, experimental introduction of the QQ89,90 sequence at the homologous positions in the sooty mangabey strain SIVsmE041 by site-directed mutagenesis rendered the virus resistant to TRIM5CypA (Figure 6). The mutation did not affect sensitivity to TRIM5TFP alleles or resistance to TRIM5Q alleles. Thus, reversion to the ancestral state in SIVmac239 (changing QQ89,90 to LPA89–91) resulted in sensitivity to restriction by TRIM5CypA, and the reciprocal substitution to recreate the evolutionarily derived state in SIVsmE041 (IPA to QQ) resulted in resistance to TRIM5CypA. These results are consistent with the hypothesis that the QQ89,90 sequence is an adaptation to overcome rhesus TRIM5CypA that arose during emergence of the SIVmac lineage. In the case of SIVmac239QQ/LPA, the reversion also affected resistance to TRIM5TFP alleles, suggesting that the effects of the adaptation may be influenced by additional differences between the SIVsm and SIVmac capsids. Finally, note that two mutants, SIVsmE041IPA->QQ and SIVmac239S97R, have similar patterns of restriction (compare Figure 6B and 6D), consistent with the fact that these two viruses are identical at the two sites in question (i.e., both viruses are QQ89,90 and R97).
Host-encoded, dominant-acting blocks to retroviral infection, or restriction factors (RF), were first defined genetically for murine and avian retroviruses more than 40 years ago [40]. Over the last decade, experiments seeking the causes of defined cellular blocks to HIV-1 infection uncovered three new RF genes, APOBEC3G (now considered to be the prototype of a cluster of ~8 APOBEC3 genes), TRIM5, and Tetherin [11],[41],[42]. Consistent with the notion that these genes played a role in protecting host organisms from retroviral infections during the course of mammalian evolution, Tetherin, APOBEC3G, and TRIM5 display signs of long-term positive selection, including high levels of amino-acid diversification between closely related species [9],[43][46]. It is generally assumed that RF genes such as TRIM5, APOBEC3G, and Tetherin influence the distribution and spread of viruses between hosts, with viral epidemics resulting in selective sweeps of these loci, and successful viruses in turn adapting to the spectrum of restriction encoded by each host species [47]. Our results provide direct evidence that expression of one of these factors (TRIM5) can indeed suppress viral replication during the early stages of cross-species transmission and that under such conditions, viral emergence and pathogenesis in the new host species requires adaptation to overcome restriction. Given overall similarities in evolutionary patterns and biological function, it seems very likely that the APOBEC3 enzymes and Tetherin/BST2 will also be found to influence patterns of cross-species transmission and viral emergence among extant species.
In this study, we specifically demonstrated that the RF gene TRIM5 can suppress replication of a primate immunodeficiency virus in vivo at the time of cross-species transmission, and that TRIM5-mediated suppression of viral replication selects for acquisition of adaptive changes in the viral capsid protein. The data included retrospective genotyping of two independent, cross-species transmission cohorts, identification of at least two adaptations selected for resistance to TRIM5 during emergence of the SIVmac lineage, and functional assessment of allele-specific restriction in cell-culture. While the adaptations in SIVmac239 capsid identified here (R97S and LPA89–91/QQ89,90) have a direct effect on restriction sensitivity, the modification of the otherwise highly conserved residues R97 and P90 may well have required additional adaptive adjustments elsewhere in the CA or the Gag polyprotein. Identifying such changes, if they exist, will require systematic testing of combinations of residues that vary between the SIVmac and SIVsm lineages for impact on relative infectivity in the presence and absence of TRIM5 expression.
The transmission event(s) leading to spread and emergence of SIVsm in the U.S. macaque colonies have not been identified, although there is indirect evidence suggesting that transmission may have resulted from experimental procedures involving the transfusion of material from one species into another [27]. Regardless of the mechanism(s) of initial transmission, our data strongly suggest that adaptation to overcome restriction by a specific subset of rhesus macaque TRIM5 alleles played a key role in spread of SIVsm and its emergence as SIVmac in captive colonies of rhesus macaques. Based on cell-culture assays, analysis of experimental cohorts, and functional identification of adaptive changes in the SIVmac239 capsid, we propose a simple but likely scenario for the influence of variation in the rhesus macaque TRIM5 gene on emergence of SIVmac in the U.S. National Primate Research Center macaque colonies (Figure 7). Briefly, at the time of initial cross-species exposure, we believe that the SIVsm source was likely to be sensitive to restriction by a subset of rhesus macaque TRIM5 alleles, including those with a TFP sequence at residues 339–341 in the B30.2/SPRY domain (TRIM5TFP) and those that produce a TRIM5CypA chimera by alternative splicing (TRIM5CypA). In contrast, we have yet to identify an SIV strain that is sensitive to alleles with a Q at position 339 (TRIM5Q); thus, it seems likely that animals bearing TRIM5Q alleles (particularly TRIM5Q/Q homozygotes) permitted initial spread and adaptation of SIVsm to rhesus macaques, potentially facilitating acquisition of adaptations to overcome other, as yet unidentified genetic barriers encountered in the newly invaded host species. The appearance of the R-to-S and the LPA-to-QQ changes in CA would have opened the way for the virus to spread to a larger percentage of the macaque population, ultimately leading to emergence of pathogenic SIVmac.
Figure 7
Figure 7
Scenario depicting the inferred role of rhesus macaque TRIM5 in emergence of SIV in captive Asian macaque colonies in the late 20th century.
None of the viruses tested in this study except HIV-1 were sensitive to the rhesus macaque TRIM5Q alleles. It is noteworthy that all known human alleles of TRIM5 have a Q at the homologous position, suggesting that human TRIM5 may not pose a critical barrier to transmission of SIVsm into human populations; in this regard, it would be interesting to assess the ability of human TRIM5 variants to restrict divergent primary isolates of SIVsm found in regions of endemic infection among African nonhuman primates and to look for correlations between TRIM5 and susceptibility to HIV-2 in human AIDS cohorts.
An unexpected finding from analysis of the experimental transmission cohorts was the establishment of infection even in animals with restrictive genotypes. In many cases, we found that once animals with restrictive genotypes were infected, viral replication often continued to be suppressed to low levels for many weeks (Figure 4). In nature, lower viremia could reduce the probability that the infected individual will pass the virus on to additional individuals in the new host population, thus extending the role of TRIM5 in preventing emergence beyond the initial cross-species transmission event(s). However, the retrospective analysis of SIVmac emergence does not necessarily address the impact of TRIM5 during natural exposure and transmission, and it is possible that the observed pattern is, at least in part, the consequence of experimental routes of transmission. For example, in many SIV/macaque studies, including the cohorts analyzed here, high titer stocks of virus (TCID50 in the range of 1 to 1,000) are used to initiate infections by intravenous injection. Since the effect of restriction by TRIM5α is known to be saturable, it is possible that a large bolus of localized infection manages to initially swamp out restriction and permits virus to seed a large number of virus producing-cells and initiate a transient acute infection. In this regard, experimental intravenous infection of macaques may more closely resemble accidental human exposure to HIV-1 via blood-transfusion or contaminated, hypodermic syringes. It is possible that the effect of TRIM5 could be greater under conditions of natural exposure to virus, such as through sexual contact or fighting; however, we are currently unaware of any studies that address this issue. In recent years, many SIV/AIDS vaccine studies have incorporated low-dose mucosal challenges, to more closely mimic the conditions of sexual transmission. Under such conditions, it is possible that the effect of TRIM5 genotype on infection will be even more pronounced. Just as historical samples were used for this study, genotyping of appropriate archived samples from completed or ongoing SIV/vaccine studies may also prove useful for evaluating the interactions between TRIM5 genotype, viral dose, and route of transmission.
Alternatively, there are published reports indicating that TRIM5 gene expression is interferon-regulated [48],[49]; thus, it is also possible that the full impact of TRIM5 on viral replication in vivo is not manifest until after the first round of infection is well underway. Such a pattern is consistent with the observation that the impact of TRIM5 genotype in the SIVsmE543-3 infected animals appeared to persist during the weeks following acute infection (Figure 4). The TRIM5 gene is also known to encode multiple splice-isoforms [50], including mRNA molecules lacking viral specificity encoded by a B30.2/SPRY or CypA domain; however, it is not known whether these are differentially expressed in vivo in response to infection or whether patterns of isoform expression differ between tissues. In vivo studies will be required to determine how TRIM5 is regulated, whether regulation changes in response to viral infection, and to identify the patterns of TRIM5 expression in cell types responsible for initial infection and spread in vivo.
The impact of variation in rhesus macaque TRIM5 has practical implications for preclinical AIDS vaccine research. SIVsmE543 and the related SIVsmE660 serve as heterologous challenge strains for widely used SIVmac239-derived vaccine immunogens in rhesus macaques [38],[51][54]. The pronounced effect of TRIM5 variation on SIVsmE543 infection is likely to confound comparison of vaccinated and control groups, particularly if they are not balanced for restrictive and permissive alleles; this may be especially true for studies with typically small numbers of animals (n = 4–6) in each group. This may also be true of SIV strains not examined here, and possibly extends to other SIV/AIDS model organisms including Chinese-origin rhesus macaques and other commonly studied Macaca species, such as M. nemestrina and M. fascicularis. Moreover, vaccines expressing Gag, the target of TRIM5, may be affected by TRIM5 genotype. This is potentially the case for live-attenuated SIV, where vaccine efficacy is influenced by the degree to which the vaccine strain replicates in the inoculated animal [55]. Finally, as discussed above, the potential effects of viral dose or route of transmission on restriction by TRIM5 remain to be determined.
TRIM5 variation and susceptibility to infection has been explored in candidate gene studies in HIV/AIDS cohorts, although reported associations were weak [56][59]. Recently, a modest but significant association between TRIM5 genotype and infection in a cohort of SIVmac251-infected macaques was described [24]. While the SIV study did not correlate individual TRIM5 polymorphisms with viral replication levels, we note that all haplotypes associated with lower viremia in that report were of the TRIM5TFP class (TRIM5CypA was excluded from their analysis) [24]. The magnitude of the effect on SIVmac251 (1.3 log) was smaller than we observed with SIVsmE543 or SIVsmE041 (~2.0 to 3.0 log). This is consistent with the fact that SIVmac251, like its derivative SIVmac239, is the product of years of adaptation in rhesus macaques, while SIVsmE543 and SIVsmE041 have had little or no opportunity, respectively, to adapt to this species [25],[29],[31]. Similarly, lack of a strong association between TRIM5 variation and infection in HIV/AIDS cohorts may be due to limited variation in human TRIM5 and the fact that HIV-1 has been spreading in human populations for decades [60],[61]. Our results, particularly when taken in light of the results from HIV/AIDS cohorts and the SIVmac251 cohort, support the conclusion that TRIM5 primarily governs the transmission of viruses between genetically distinct populations or species and further suggest that the impact of restriction can diminish as a virus spreads and adapts to a new host population.
Ethics Statement
All analyses were performed using archived material, and none of the analyses described involved new animal experiments. Animals at the New England Primate Research Center (NEPRC) were maintained in accordance with standards of the Association for Assessment and Accreditation of Laboratory Animal Care and the Harvard Medical School Animal Care and Use Committee. Animal experiments were approved by the Harvard Medical Area Standing Committee on Animals and conducted according to the principles described in the Guide for the Care and Use of Laboratory Animals. All animals at the NIH were housed in accordance with American Association for Accreditation of Laboratory Animal Care standards, and the NIH investigators adhered to the Guide for the Care and Use of Laboratory Animals prepared by the Committee on Care and Use of Laboratory Animals of the Institute of Laboratory Resources, National Resource Council, and the NIAID Animal Care and Use Committee-approved protocols.
Plasmids
The SIVmac239-based retroviral vector V1EGFP (gift from Hung Fan, University of California, Irvine, CA) was modified to contain a functional gag-pol ORF. The NarI and SphI sites were used to replace SIVmac239 sequence with that of SIVsmE543 (pGEM-E543 was a gift from Vanessa Hirsch, NIAID, Bethesda, MD). For this purpose the SphI site was introduced by PCR (forward: 5′-CCTAGCAGGTTGGCGCCTGAACAGG-3′, reverse: 5′-GTTATAGCATGCCTCTAGAGGGCGG-3′). A 5′ half of SIVsmE041 was synthesized by GENEART (Regensburg, Germany) with the sequence based on a consensus of sequences obtained by A.K. and S.O. The fragment was engineered to contain NarI and SphI sites for subcloning into V1EGFP. SIVstm/37.16 (gift from Frank Novembre, Emory University, Atlanta, GA) was used for subcloning the SIVstm gag into V1EGFP using the NarI and SbfI sites.
Primary Cells and Cell Lines
Primary Blood Mononucleated Cells (PBMC) were isolated from heparin- or EDTA-treated rhesus macaque blood samples by density centrifugation with Lymphocyte Separation Medium. PBMC were activated with RPMI/10% FBS containing 50 IU/ml phytohaemagglutinin or 5 mg/ml Concanavalin A for 2 d; afterwards cells were maintained in R10 supplemented with 50 IU/ml interleukin-2.
Crandell-Rees Feline Kidney (CRFK) cells as well as Human Embryonic Kidney 293T/17 (HEK293T/17) cells were obtained from American Type Culture Collection (Manassas, VA) and grown in DMEM/10% FBS. Generation of stable CRFK cell lines was done as previously described in Newman et al., PNAS 103(50), 2006 [15]. For the experiments performed here, new stable CRFK cell lines were made to express N-terminally HA-tagged rhesus TRIM5 alleles. For this purpose an HA tag was added by PCR (forward: 5′-GCGGCCGCATGGCTTCTGGAATC-3′; reverse: 5′-CCACCGGTGGCTCAAGCGTAGTCTGGGACGTCGTATGGGTAGCCGCCAGAGCTTGGTGAGCACAGAG-3′) and the NotI and AgeI sites were used for subcloning into pQCXIN (BD Biosciences, Franklin Lakes, NJ). Stable cell lines were maintained in DMEM/10% FBS supplemented with 0.5 mg/ml G418. All cultured cells were maintained at 37°C with 5% CO2.
Viruses
All single-cycle SIV viruses were produced in HEK293T/17 cells by cotransfection of the appropriate V1EGFP-SIV plasmid and pVSV-G (Clontech Laboratories, Mountain View, CA), using the GenJet transfection system (SignaGen; Ijamsville, MD). The single-cycle HIV-1 virus stock was made by cotransfection of pNL43DenvGFP and pVSV-G. Single-cycle HIV-2 was made by cotransfection of pHIV-2(ROD)GFP and pVSV-G. Culture supernatants containing the single-cycle, GFP/EGFP expressing, VSV-G-pseudotyped virions were titered on untransfected CRFK cells; supernatant volumes resulting in approximately 30% GFP/EGFP+ CRFK cells were used for infectivity assays on the stably transfected cell lines expressing the various rhesus TRIM5 alleles.
Infectivity Assays
Stable CRFK cells were seeded at a concentration of 5×104 cells per well in 12-well-plates and infected with the appropriate amount of VSV-G pseudotyped, single-cycle, GFP/EGFP expressing viruses. All infections were done in triplicate. After 3 d, expression of GFP/EGFP was analyzed by fluorescence-activated cell sorting (FACS) performed on a FACSCalibur™ flow cytometer (BD, Franklin Lakes, NJ), and data were analyzed using FlowJo (Tree Star, Inc., Ashland, OR).
PCR (Site-Directed Mutagenesis, Genotyping, Sequencing)
The Q89Q90 to LPA and S97R mutants of SIVmac239 capsid were made by site-directed mutagenesis on a SIVmac239 5′ plasmid (Q89Q90 to LPA: forward: 5′-GCAGATTGGGACTTGCAGCACCCAATACCAGGCCCCTTACCAGCGGGACAACTTAGGGAGCCGTCAGG-3′; reverse: 5′CCTGACGGCTCCCTAAGTTCTCCCGCTGGTAAGGGGCCTGGTATTGGGTGCTGCAAGTCCCAATCTGC-3′) (S97R: forward: 5′-CCCACAACCAGCTCCACAACAAGGACAACTTAGGGAGCCGAGGGGATCAGATATTGCAGGAAC-3′; reverse: 5′-GTTCCTGCAATATCTGATCCCCTCGGCTCCCTAAGTTCTCCTTCTTCTGGAGCTGGTTGTGGG-3′).
The IPA-to-Q89Q90 mutants of SIVsmE041 were made by site-directed mutagenesis on a SIVsmE041 5′ plasmid (IPA-to-QQ: forward: 5′-CCACAGCCAGGTCCACAACAAGGACAACTTAGAGACCCGAGAGG-3′; reverse: 5′-CCTCTCGGGTCTCTAAGTTGTCCTTGTTGTGGACCTGGCTGTGG-3′). For all mutants, NarI and SphI sites were used for subcloning into V1EGFP.
TRIM5 genotypes of rhesus macaques were determined by isolation of genomic DNA from PBMC using the QIAamp DNA Blood Mini kit (QIAGEN, Valencia, CA) and direct sequencing of a PCR fragment (forward: 5′-CAGTGCTGACTCCTTTGCTTG-3′; reverse: 5′-GCTTCCCTGATGTGATAC-3′) of the C-terminal B30.2/SPRY domain of TRIM5. The following PCR protocol was implemented: 1 min at 94°C initial denaturation, 15 s at 94°C denaturation, 30 s at 55°C annealing, 1 min at 68°C extension, 10 min at 68°C final extension; steps 2 through 4 were repeated for 30 cycles. PCR fragments were sequenced by Retrogen (San Diego, CA) and data were analyzed with the Codoncode software (Codoncode Corporation, Dedham, MA).
Viral RNA was extracted from blood plasma with the High Pure Viral RNA kit (Roche Diagnostics Corporation, Indianapolis, IN) and partial capsid sequence was determined by direct sequencing of an RT-PCR fragment (forward: 5′-GAAGCTTGCCACCATGGGCGCGAGAAACTC-3′; reverse: 5′-CCTCTCTGTTGGACTGCTGC-3′).
Immunoblotting
Stable CRFK cells expressing the various HA-tagged TRIM5 alleles were seeded at a density of 5×104 cells per well in a 6-well-plate. After 48 h, cells were lysed in M-PER reagent (Pierce Biotechnology, Rockford, IL), and total protein concentration of each lysate was determined by measurement of A280 with a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA). Equal amounts of total protein were separated by SDS/PAGE and HA-tagged TRIM5 proteins were detected with rat monoclonal Anti-HA-Peroxidase High Affinity antibody (Roche Diagnostics Corporation, Indianapolis, IN). b-actin was detected with mouse monoclonal beta Actin-HRP antibody (Abcam Inc., Cambridge, MA).
Experimental Infections
Forty-four rhesus macaques of Indian origin were infected with SIVsmE543-3 either intravenously (n = 35) or intrarectally (n = 9) with a TCID 50% ranging from 1 to 1,000. There was no statistically significant difference in viral RNA levels relative to route of inoculation (unpublished data). None of the animals were treated or vaccinated prior to infection. The majority of the animals (n = 41) were inoculated with a cell-free virus stock generated by infection of pigtailed macaque PBMC with virus produced by transfection of CEMx174 cells with the SIVsmE543-3 molecular clone.
Blood Plasma Viral Loads
The quantification of plasma viral loads was described previously in Hirsch et al. [29]. Briefly, viral RNA loads were determined by real-time reverse transcriptase-PCR (RT-PCR). For this purpose, viral RNA from plasma was serially diluted and used as a template in a RT-PCR reaction, together with known amounts of pSG83 as an internal control template. Results were normalized to the volume of plasma extracted and expressed as SIV RNA copies per milliliter of plasma.
Figure S1
Production of VSV-G pseudotyped, single-cycle SIV for restriction assays. (A) The modified V1EGFP vector, as described in Methods. (B) pVSV-G vector. (C) Single cycle SIVmac239 titration on parental CRFK cells (TRIM5-null). (D) Single-cycle SIVmac239QQ->LPA. (E) Single cycle SIVmac239S->R. (F) Single cycle SIVsmE543-3. (G) Single-cycle SIVsmE041. Virions were produced by transient co-transfection of a vector expressing viral proteins (A) and a second vector expressing the Vesicular Stomatitis Virus G-protein (B). The viral vector also produces messenger RNA containing a transducible enhanced Green Fluroescent Protein (eGFP) ORF in place of the viral nef gene (green box); in the subsequent round of infection, the reporter RNA is reverse transcribed and integrated into the infected cell. Infection is then monitored by flow-cytometry to count eGFP-positive cells as a percent of total live cells (C–G).
(8.33 MB TIF)
Acknowledgments
We thank K. McCarthy (Harvard University) for helpful comments, F. Novembre (Emory University) for the SIVstm/37.16 clone, H. Fan (U.C. Irvine) for the V1EGFP single-cycle plasmids, A. Detmer (Wisconsin NPRC) for help sequencing the SIVsmE041 stock, and E. Vallender, G. Miller, and the NEPRC Genetics Core for sample procurement.
Abbreviations
CAcapsid protein
CypAcyclophilin-A
NTDN-terminal domain
RFrestriction factor
SIVsSimian immunodeficiency viruses
SIVmacSimian immunodeficiency viruses of rhesus macaques
SIVsmSimian immunodeficiency viruses of sooty mangabeys
SIVstmSimian immunodeficiency viruses of stump-tailed macaques

Footnotes
The authors have declared that no competing interests exist.
This work was supported by grants from the National Institutes of Health (NIH), including grants AI057039 and AI083118 (WEJ), NIH ARRA award AI077423 (WEJ), AI049809 and AI084810 (A Kaur), and by NIH/NCRR grant RR00168 (NEPRC). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
1. Hahn B. H, Shaw G. M, De Cock K. M, Sharp P. M. AIDS as a zoonosis: scientific and public health implications. Science. 2000;287:607–614. [PubMed]
2. Charleston M. A, Robertson D. L. Preferential host switching by primate lentiviruses can account for phylogenetic similarity with the primate phylogeny. Syst Biol. 2002;51:528–535. [PubMed]
3. Apetrei C, Robertson D. L, Marx P. A. The history of SIVS and AIDS: epidemiology, phylogeny and biology of isolates from naturally SIV infected non-human primates (NHP) in Africa. Front Biosci. 2004;9:225–254. [PubMed]
4. Keele B. F, Van Heuverswyn F, Li Y, Bailes E, Takehisa J, et al. Chimpanzee reservoirs of pandemic and nonpandemic HIV-1. Science. 2006;313:523–526. [PMC free article] [PubMed]
5. Gardner M. B. Simian AIDS: an historical perspective. J Med Primatol. 2003;32:180–186. [PubMed]
6. Mansfield K. G, Lerch N. W, Gardner M. B, Lackner A. A. Origins of simian immunodeficiency virus infection in macaques at the New England Regional Primate Research Center. J Med Primatol. 1995;24:116–122. [PubMed]
7. Langelier C. R, Sandrin V, Eckert D. M, Christensen D. E, Chandrasekaran V, et al. Biochemical characterization of a recombinant TRIM5alpha protein that restricts human immunodeficiency virus type 1 replication. J Virol. 2008;82:11682–11694. [PMC free article] [PubMed]
8. Perez-Caballero D, Hatziioannou T, Yang A, Cowan S, Bieniasz P. D. Human tripartite motif 5alpha domains responsible for retrovirus restriction activity and specificity. J Virol. 2005;79:8969–8978. [PMC free article] [PubMed]
9. Sawyer S. L, Wu L. I, Emerman M, Malik H. S. Positive selection of primate TRIM5alpha identifies a critical species-specific retroviral restriction domain. Proc Natl Acad Sci U S A. 2005;102:2832–2837. [PubMed]
10. Sebastian S, Luban J. TRIM5alpha selectively binds a restriction-sensitive retroviral capsid. Retrovirology. 2005;2:40. [PMC free article] [PubMed]
11. Stremlau M, Owens C. M, Perron M. J, Kiessling M, Autissier P, et al. The cytoplasmic body component TRIM5alpha restricts HIV-1 infection in Old World monkeys. Nature. 2004;427:848–853. [PubMed]
12. Stremlau M, Perron M, Lee M, Li Y, Song B, et al. Specific recognition and accelerated uncoating of retroviral capsids by the TRIM5alpha restriction factor. Proc Natl Acad Sci U S A. 2006;103:5514–5519. [PubMed]
13. Yap M. W, Nisole S, Stoye J. P. A single amino acid change in the SPRY domain of human Trim5alpha leads to HIV-1 restriction. Curr Biol. 2005;15:73–78. [PubMed]
14. Hatziioannou T, Cowan S, Von Schwedler U. K, Sundquist W. I, Bieniasz P. D. Species-specific tropism determinants in the human immunodeficiency virus type 1 capsid. J Virol. 2004;78:6005–6012. [PMC free article] [PubMed]
15. Newman R. M, Hall L, Connole M, Chen G. L, Sato S, et al. Balancing selection and the evolution of functional polymorphism in Old World monkey TRIM5{alpha}. Proc Natl Acad Sci U S A. 2006;103:19134–19139. [PubMed]
16. Wilson S. J, Webb B. L, Maplanka C, Newman R. M, Verschoor E. J, et al. Rhesus macaque TRIM5 alleles have divergent antiretroviral specificities. J Virol. 2008;82:7243–7247. [PMC free article] [PubMed]
17. Newman R. M, Hall L, Kirmaier A, Pozzi L. A, Pery E, et al. Evolution of a TRIM5-CypA splice isoform in old world monkeys. PLoS Pathog. 2008;4:e1000003. doi: 10.1371/journal.ppat.1000003. [PMC free article] [PubMed]
18. Wilson S. J, Webb B. L, Ylinen L. M, Verschoor E, Heeney J. L, et al. Independent evolution of an antiviral TRIMCyp in rhesus macaques. Proc Natl Acad Sci U S A. 2008;105:3557–3562. [PubMed]
19. Brennan G, Kozyrev Y, Hu S. L. TRIMCyp expression in Old World primates Macaca nemestrina and Macaca fascicularis. Proc Natl Acad Sci U S A. 2008;105:3569–3574. [PubMed]
20. Liao C. H, Kuang Y. Q, Liu H. L, Zheng Y. T, Su B. A novel fusion gene, TRIM5-Cyclophilin A in the pig-tailed macaque determines its susceptibility to HIV-1 infection. AIDS. 2007;21(Suppl 8):S19–S26. [PubMed]
21. Virgen C. A, Kratovac Z, Bieniasz P. D, Hatziioannou T. Independent genesis of chimeric TRIM5-cyclophilin proteins in two primate species. Proc Natl Acad Sci U S A. 2008;105:3563–3568. [PubMed]
22. Gamble T. R, Vajdos F. F, Yoo S, Worthylake D. K, Houseweart M, et al. Crystal structure of human cyclophilin A bound to the amino-terminal domain of HIV-1 capsid. Cell. 1996;87:1285–1294. [PubMed]
23. Price A. J, Marzetta F, Lammers M, Ylinen L. M, Schaller T, et al. Active site remodeling switches HIV specificity of antiretroviral TRIMCyp. Nat Struct Mol Biol. 2009;16:1036–1042. [PMC free article] [PubMed]
24. Lim S. Y, Rogers T, Chan T, Whitney J. B, Kim J, et al. TRIM5alpha modulates immunodeficiency virus control in rhesus monkeys. PloS Pathog 6: doi:10.1371/journal.ppat.1000738. [PMC free article] [PubMed]
25. Daniel M. D, Letvin N. L, King N. W, Kannagi M, Sehgal P. K, et al. Isolation of T-cell tropic HTLV-III-like retrovirus from macaques. Science. 1985;228:1201–1204. [PubMed]
26. Thakallapally R, Rose P, Vasil S, Pillai S, Kuiken C. Reagents for HIV/SIV Vaccine Studies. pp. 506–516.
27. Apetrei C, Lerche N. W, Pandrea I, Gormus B, Silvestri G, et al. Kuru experiments triggered the emergence of pathogenic SIVmac. Aids. 2006;20:317–321. [PubMed]
28. Naidu Y. M, Kestler HW, Li Y, Butler C. V, Silva D. P, et al. Characterization of infectious molecular clones of simian immunodeficiency virus (SIVmac) and human immunodeficiency virus type 2: persistent infection of rhesus monkeys with molecularly cloned SIVmac. J Virol. 1988;62:4691–4696. [PMC free article] [PubMed]
29. Hirsch V, Adger-Johnson D, Campbell B, Goldstein S, Brown C, et al. A molecularly cloned, pathogenic, neutralization-resistant simian immunodeficiency virus, SIVsmE543-3. J Virol. 1997;71:1608–1620. [PMC free article] [PubMed]
30. Goldstein S, Brown C. R, Dehghani H, Lifson J. D, Hirsch V. M. Intrinsic susceptibility of rhesus macaque peripheral CD4(+) T cells to simian immunodeficiency virus in vitro is predictive of in vivo viral replication. J Virol. 2000;74:9388–9395. [PMC free article] [PubMed]
31. Ling B, Apetrei C, Pandrea I, Veazey R. S, Lackner A. A, et al. Classic AIDS in a sooty mangabey after an 18-year natural infection. J Virol. 2004;78:8902–8908. [PMC free article] [PubMed]
32. Khan A. S, Galvin T. A, Lowenstine L. J, Jennings M. B, Gardner M. B, et al. A highly divergent simian immunodeficiency virus (SIVstm) recovered from stored stump-tailed macaque tissues. J Virol. 1991;65:7061–7065. [PMC free article] [PubMed]
33. Novembre F. J, Hirsch V. M, McClure H. M, Fultz P. N, Johnson P. R. SIV from stump-tailed macaques: molecular characterization of a highly transmissible primate lentivirus. Virology. 1992;186:783–787. [PubMed]
34. Meythaler M, Martinot A, Wang Z, Pryputniewicz S, Kasheta M, et al. Differential CD4+ T-lymphocyte apoptosis and bystander T-cell activation in rhesus macaques and sooty mangabeys during acute simian immunodeficiency virus infection. J Virol. 2009;83:572–583. [PMC free article] [PubMed]
35. Loffredo J. T, Maxwell J, Qi Y, Glidden C. E, Borchardt G. J, et al. Mamu-B*08-positive macaques control simian immunodeficiency virus replication. J Virol. 2007. [PMC free article] [PubMed]
36. Mothe B. R, Weinfurter J, Wang C, Rehrauer W, Wilson N, et al. Expression of the major histocompatibility complex class I molecule Mamu-A*01 is associated with control of simian immunodeficiency virus SIVmac239 replication. J Virol. 2003;77:2736–2740. [PMC free article] [PubMed]
37. Yant L. J, Friedrich T. C, Johnson R. C, May G. E, Maness N. J, et al. The high-frequency major histocompatibility complex class I allele Mamu-B*17 is associated with control of simian immunodeficiency virus SIVmac239 replication. J Virol. 2006;80:5074–5077. [PMC free article] [PubMed]
38. Reynolds M. R, Weiler A. M, Weisgrau K. L, Piaskowski S. M, Furlott J. R, et al. Macaques vaccinated with live-attenuated SIV control replication of heterologous virus. J Exp Med. 2008;205:2537–2550. [PMC free article] [PubMed]
39. Li Y, Li X, Stremlau M, Lee M, Sodroski J. Removal of arginine 332 allows human TRIM5alpha to bind human immunodeficiency virus capsids and to restrict infection. J Virol. 2006;80:6738–6744. [PMC free article] [PubMed]
40. Goff S. P. Retrovirus restriction factors. Mol Cell. 2004;16:849–859. [PubMed]
41. Neil S. J, Zang T, Bieniasz P. D. Tetherin inhibits retrovirus release and is antagonized by HIV-1 Vpu. Nature. 2008;451:425–430. [PubMed]
42. Sheehy A. M, Gaddis J. D, Choi J. D, Malim M. H. Isolation of a human gene that inhibits HIV-1 infection and is suppressed by the viral Vif protein. Nature. 2002;418:646–650. [PubMed]
43. McNatt M. W, Zang T, Hatziioannou T, Bartlett M, Fofana I. B, et al. Species-specific activity of HIV-1 Vpu and positive selection of tetherin transmembrane domain variants. PLoS Pathog. 2009;5:e1000300. doi: 10.1371/journal.ppat.1000300. [PMC free article] [PubMed]
44. Sawyer S. L, Emerman M, Malik H. S. Ancient adaptive evolution of the primate antiviral DNA-editing enzyme APOBEC3G. PLoS Biol. 2004;2:E275. doi: 10.1371/journal.pbio.0020275. [PMC free article] [PubMed]
45. Sawyer S. L, Emerman M, Malik H. S. Discordant evolution of the adjacent antiretroviral genes TRIM22 and TRIM5 in mammals. PLoS Pathog. 2007;3:e197. [PMC free article] [PubMed]
46. Song B, Gold B, O'Huigin C, Javanbakht H, Li X, et al. The B30.2(SPRY) domain of the retroviral restriction factor TRIM5alpha exhibits lineage-specific length and sequence variation in primates. J Virol. 2005;79:6111–6121. [PMC free article] [PubMed]
47. Emerman M, Malik H. S. Paleovirology—modern consequences of ancient viruses. PLoS Biol. 8:e1000301. doi: 10.1371/journal.pbio.1000301. [PMC free article] [PubMed]
48. Asaoka K, Ikeda K, Hishinuma T, Horie-Inoue K, Takeda S, et al. A retrovirus restriction factor TRIM5alpha is transcriptionally regulated by interferons. Biochem Biophys Res Commun. 2005;338:1950–1956. [PubMed]
49. Sakuma R, Mael A. A, Ikeda Y. Alpha interferon enhances TRIM5alpha-mediated antiviral activities in human and rhesus monkey cells. J Virol. 2007;81:10201–10206. [PMC free article] [PubMed]
50. Nisole S, Stoye J. P, Saib A. TRIM family proteins: retroviral restriction and antiviral defence. Nat Rev Microbiol. 2005;3:799–808. [PubMed]
51. Johnston R. E, Johnson P. R, Connell M. J, Montefiori D. C, West A, et al. Vaccination of macaques with SIV immunogens delivered by Venezuelan equine encephalitis virus replicon particle vectors followed by a mucosal challenge with SIVsmE660. Vaccine. 2005;23:4969–4979. [PubMed]
52. Lifson J. D, Rossio J. L, Piatak M, Jr, Bess J, Jr, Chertova E, et al. Evaluation of the safety, immunogenicity, and protective efficacy of whole inactivated simian immunodeficiency virus (SIV) vaccines with conformationally and functionally intact envelope glycoproteins. AIDS Res Hum Retroviruses. 2004;20:772–787. [PubMed]
53. Ourmanov I, Kuwata T, Goeken R, Goldstein S, Iyengar R, et al. Improved survival in rhesus macaques immunized with modified vaccinia virus Ankara recombinants expressing simian immunodeficiency virus envelope correlates with reduction in memory CD4+ T-cell loss and higher titers of neutralizing antibody. J Virol. 2009;83:5388–5400. [PMC free article] [PubMed]
54. Staprans S. I, Barry A. P, Silvestri G, Safrit J. T, Kozyr N, et al. Enhanced SIV replication and accelerated progression to AIDS in macaques primed to mount a CD4 T cell response to the SIV envelope protein. Proc Natl Acad Sci U S A. 2004;101:13026–13031. [PubMed]
55. Johnson R. P, Lifson J. D, Czajak S. C, Cole K. S, Manson K. H, et al. Highly attenuated vaccine strains of simian immunodeficiency virus protect against vaginal challenge: inverse relationship of degree of protection with level of attenuation. J Virol. 1999;73:4952–4961. [PMC free article] [PubMed]
56. Goldschmidt V, Bleiber G, May M, Martinez R, Ortiz M, et al. Role of common human TRIM5alpha variants in HIV-1 disease progression. Retrovirology. 2006;3:54. [PMC free article] [PubMed]
57. Javanbakht H, An P, Gold B, Petersen D. C, O'Huigin C, et al. Effects of human TRIM5alpha polymorphisms on antiretroviral function and susceptibility to human immunodeficiency virus infection. Virology. 2006;354:15–27. [PubMed]
58. Speelmon E. C, Livingston-Rosanoff D, Li S. S, Vu Q, Bui J, et al. Genetic association of the antiviral restriction factor TRIM5alpha with human immunodeficiency virus type 1 infection. J Virol. 2006;80:2463–2471. [PMC free article] [PubMed]
59. van Manen D, Rits M. A, Beugeling C, van Dort K, Schuitemaker H, et al. The effect of Trim5 polymorphisms on the clinical course of HIV-1 infection. PLoS Pathog. 2008;4:e18. doi: 10.1371/journal.ppat.0040018. [PMC free article] [PubMed]
60. Korber B, Muldoon M, Theiler J, Gao F, Gupta R, et al. Timing the ancestor of the HIV-1 pandemic strains. Science. 2000;288:1789–1796. [PubMed]
61. Sawyer S. L, Wu L. I, Akey J. M, Emerman M, Malik H. S. High-frequency persistence of an impaired allele of the retroviral defense gene TRIM5alpha in humans. Curr Biol. 2006;16:95–100. [PubMed]
Articles from PLoS Biology are provided here courtesy of
Public Library of Science