PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Cancer Res. Author manuscript; available in PMC 2010 August 10.
Published in final edited form as:
PMCID: PMC2919317
NIHMSID: NIHMS106332

Achaete-Scute Complex Homolog 1 Regulates Tumor-Initiating Capacity in Human Small Cell Lung Cancer

Abstract

The basic helix-loop-helix transcription factor ASCL1 (Achaete-scute complex homolog-1) is essential for the development of normal lung neuroendocrine (NE) cells as well as other endocrine and neural tissues. SCLC and NSCLC with NE features express ASCL1, where the factor may play a role in the virulence and primitive NE phenotype of these tumors. In this study, RNA interference knockdown of ASCL1 in cultured SCLC resulted in inhibition of soft agar clonogenic capacity and induction of apoptosis. cDNA microarray analyses bolstered by expression studies, flow cytometry, and chromatin immunoprecipitation identified two candidate stem cell marker genes, CD133 and ALDH1A1 (aldehyde dehydrogenase 1A1), to be directly regulated by ASCL1 in SCLC. In SCLC direct xenograft tumors, we detected a relatively abundant CD133high-ASCL1high-Aldh1high sub-population with markedly enhanced tumorigenicity compared to cells with weak CD133 expression. Tumorigenicity in the CD133high sub-population depended on continued ASCL1 expression. Whereas CD133high cells readily reconstituted the range of CD133 expression seen in the original xenograft tumor, CD133low cells could not. Our findings suggest that a broad range of SCLC cells have tumorigenic capacity, rather than a small discrete population. Intrinsic tumor cell heterogeneity, including variation in key regulatory factors such as ASCL1, can modulate tumorigenicity in SCLC.

Keywords: ASCL1, small cell lung cancer, CD133, Aldehyde dehydrogenase

Introduction

Despite the success of anti-smoking campaigns and extensive efforts to develop new therapeutic approaches, lung cancer remains the leading cause of cancer death in the United States, with SCLC accounting for approximately 13% of lung cancer cases (1). Up to 90% of SCLC tumors exhibit characteristic molecular abnormalities including mutation of Rb and p53, and allelic losses on chromosome 3p (2). A striking feature of SCLC tumors is the expression of a poorly-differentiated neuroendocrine (NE) phenotype. ASCL1 (Achaete-scute complex homolog 1, Mash1), a proneural basic helix-loop-helix (bHLH) transcription factor, was initially identified as a key regulator of early development of mitotically-active precursors for both neurons and oligodendrocytes (3). ASCL1 is essential in the development of basal ganglia (4), olfactory and retinal neurons (5, 6), peripheral sympathoadrenal tissues (7), enteric neurons, and several types of NE cells (8). ASCL1 is highly expressed in classic SCLC and in NSCLC with NE features (9). In the context of the developing mouse lung, knockout of ASCL1 specifically ablates lung NE cells (10). In contrast, knockout of Hes1, a key effector of the Notch signaling pathway, results in premature and promiscuous NE differentiation associated with ASCL1 over-expression (11). Our previous work also showed that transgenic ectopic over-expression of ASCL1 in lung Clara cells is sufficient to induce airway epithelial cell proliferation and adenomas, focused at the bronchoalveolar junction. Combined over-expression of ASCL1 with SV40- Large T antigen promotes the development of aggressive adenocarcinoma with NE features, implying that ASCL1 can synergize with inhibition of Rb and p53 in promoting lung tumorigenesis (12). Consistent with these findings, a murine SCLC model employing airway-specific deletion of Rb and p53 exhibits extensive ASCL1 expression (13). A recent publication by Osada, et. al. demonstrated that knockdown of ASCL1 causes growth inhibition and apoptosis in SCLC cell lines (14). Taken together, these data suggest that ASCL1 may play a crucial role in the tumorigenesis of lung cancer with NE features. However, the relevant actions of ASCL1 in lung cancer development remain largely unknown.

To further investigate the role of ASCL1 in SCLC, we used an RNA interference approach in SCLC cultures and subsequently in direct tumor xenografts. ASCL1 down-regulation in cultured SCLC resulted in inhibition of soft agar clonogenic growth and induction of apoptosis. The progenitor/stem cell markers CD133 and ALDH1A1 (aldehyde dehydrogenase 1) were first identified as potential targets for ASCL1 transcriptional up-regulation in SCLC by cDNA microarray, and then confirmed by RNA and protein expression analysis, flow cytometry, and chromatin immunoprecipitation. To better capture the diversity of tumor initiating capacity cells in SCLC tumors, we utilized a set of SCLC tumors implanted directly as subcutaneous xenografts in nu/nu mice. Using these direct xenograft tumors, we isolated a CD133high-ALDH high -ASCL1 high sub-population which was much more tumorigenic than CD133low-ALDHlow-ASCL1low cells from the same tumor. Knockdown of ASCL1 impaired the tumor initiating capacity of CD133high-ALDH high -ASCL1 high sub-population. Therefore, high ASCL1 expression correlates with high tumorigenicity among SCLC sub-populations. ASCL1 appears to play a critical role in maintaining the ability to initiate new tumors.

MATERIALS AND METHODS

Cell Culture and Transfection

Classic SCLC cell lines NCI-H1618, H345, H209, H889, variant SCLC lines NCI-H82, H417 and H2106, and NSCLC lines NCI-H1299, and H460 (all obtained from ATCC) were maintained in RPMI 1640 medium supplemented with 5% fetal bovine serum. NCI-H1618 cells were transfected with either 25 nmol/L of non-targeting control (Dharmacon D-001210-01-20) or one of three ASCL1 targeting siRNA using Lipofectamine 2000 (Invitrogen). The ASCL1-targeting sequences were: 5′-ACCGCGTCAAGTTGGTCAA-3′ (ASCL1-1), 5′-GAAGATGAGTAAGGTGGAG-3′ (ASCL1-2) and 5′-CGACTTGAACTCCATGGCC-3′ (ASCL1-3).

Western Blot

Cells were lysed with SDS sample buffer supplemented with a protease inhibitor cocktail (Sigma, P8340) and sonicated to shear the genomic DNA. 20 μg protein samples (BCA, Pierce) were resolved by SDS-polyacrylamide gel electrophoresis and immunoblotted as described previously (9). The monoclonal anti-MASH1 antibody was from BD Pharmingen. CD133, antibody was purchased from Miltenyi Biotec. GAPDH antibody was from Trevigen.

Cell proliferation, cell cycle and apoptosis assays

Cell proliferation was assayed by measurement of the conversion of MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] to colored formazan compounds by living cells. 10,000 cells seeded on 24 well plates were transfected with siRNA at day 0, 3, and 6. MTT was added on days 1 and 4–9 and the cells were incubated for 4 hours. Experiments were performed in triplicate. Cell cycle analysis was performed with Hoechst33258 as previously described (15), and using the BrdU Flow kit (BD-Pharmingen). Apoptosis was assessed using FITC-Annexin V (BD-Pharmingen) following the manufacturer’s protocol.

RNA extraction and Microarray analysis

Total RNA from triplicate samples from NCI-H1618 cells treated with control non-targeting siRNA or with one of three individual ASCL1-targeting siRNA was extracted using Trizol reagent and purified with RNeasy columns (Qiagen). cDNA Microarray analysis was performed using Affymetrix U133 plus 2.0 chips at the Johns Hopkins Microarray Core facility, analyzed with Affymetrix Microarray Suite software. Fold changes are reported as a range of the mean fold reduction of hybridization signal following treatment with each of the ASCL1-targeting siRNAs, performed in triplicate. A cut-off mean fold reduction of 2.0 for all three of the targeting siRNA’s was used.

Real-time reverse transcription-RCR

RNA was isolated and treated with DNase I to avoid genomic DNA contamination. Random hexamer-primed cDNA was synthesized using the Superscript II RNase H-Reverse Transcriptase kit (Invitrogen). Real time PCR reactions were performed and analyzed on a Bio Rad iCycler using SYBR Green I super-mixture. The abundance of target gene was normalized to GAPDH according to the formula: 2−ΔCt, where ΔCt = CtTARGET − CtGAPDH. Relative expression level of a given gene was compared with control as 2−ΔΔCt, where ΔΔCt = ΔCtTREATED − ΔCtCONTROL. Validation of microarray data was performed in at least two independent samples. The range of fold reduction values is reported.

Preparation of Lentivirus

A modified lentiviral vector Lenti-Lox3.7 (pLL3.7) vector was used to express a shRNA under the U6 promoter (16). Two sequences targeted at 3′ UTR of ASCL1 mRNA were selected using the Whitehead Institute siRNA selection program (17). The target sequences for ASCL1 are: 5′-TGCTATTACCTCTGCATAT-3′ (shRNA1) and 5′-GAGAGACATGGCTTTCAGA-3′ (shRNA2). pLL3.7 vector expressing a shRNA for Luciferase were used as a control. The lentiviruses were prepared as described previously (16).

Soft agar clonogenicity assay

NCI-H1618 cells were infected with control virus or ASCL1 shRNA virus for 4 days. 20,000 cells were seeded in 0.4% agar and incubated at 37 °C for 21 days. Viable colonies were visualized by 0.005% crystal violet staining and counted.

Flow cytometry

Cells were washed once with PBS containing 0.1% FBS, and resuspended in the same solution at concentration of 106 per 100 μL. Antibodies were added and incubated at 4 °C for 20 min. The cells were washed twice with PBS/0.1% FBS and resuspended with PBS containing 4%PFA. Antibodies used were APC (allophycocyanin) or PE (phycoerythrin) conjugated αCD133/1 and αCD133/2 (Miltenyi Biotec), αCD59-FITC (BD Pharmingen, Franklin Lakes, NJ) and αCD31 (BD Pharmingen, Franklin Lakes, NJ), each at a dilution of 1:50. Flow cytometry used a FACSCaliber (BD Immunocytometry Systems, Franklin Lakes, NJ), with side scatter and forward scatter profiles to eliminate dead cells and doublets.

Aldefluor assay

Aldefluor assay was performed according to the manufacturer’s protocol (StemCell technologies, Vancouver, BC). Briefly, the cells were suspended in Aldefluor assay buffer containing efflux inhibitor and the ALDH substrate BAAA (BODIPY-aminoacetaldehyde). The samples were incubated at 37 °C for 45 minutes. Cellular ALDH1A1 or ALDH3A1 converts BAAA to the fluorescent product BAA (BODIPY-aminoacetate), which is detectable by flow cytometry. An aliquot from each sample was transferred to a tube containing DEAB, a specific ALDH inhibitor, to define background fluorescence. After incubation, the cells were washed twice with the Aldefluor assay buffer and analyzed using a FACSCaliber flow cytometer.

Chromatin immunoprecipitation

ChIP was performed using an EZ-ChIP kit (Millipore, Danvers MA) on cells treated 72 h in the presence of control or ASCL1-3 siRNA. Cross-linking was performed with a 10 minute incubation with 1% formaldehyde. After lysis, sonication yielded an average fragment size of 500 bp. Solublized chromatin was pre-cleared with salmon sperm DNA/Protein A agarose and immunoprecipitated with normal mouse IgG or Mash1 antibody (BD-Pharmingen). PCR was performed using primers directed at conserved regions containing the ASCL1-binding E-box motif G/C-C-A-G-G/C-T-G-G/C (18) identified in the proximal promoter regions of the prom1/CD133, aldh1A1 and dll3 genes: CD133 forward TGGGATTAGGCAACAGAAGG, reverse ACCTGGACAGCATCCATTTC; aldh1a1 forward AGCCTTGTCCTGAAGACACC, reverse TTACAAAGCCGAAACCTGTG; dll3 forward GTCCCTGTATGTGAAGACGG, reverse AGGAGCTCGGCCTCAAGAGG. Human nis (sodium-iodide symporter) promoter region primers were used as a negative control: nis forward CTAGGTCTGGAGGCGGAGTC; nis reverse CCTGCTGTCTGTCTGTCCTG. Input represents a 10-fold dilution of un-precipitated genomic DNA.

Isolation of direct tumor xenograft cells

LX33 and LX36 direct xenograft lines were derived from bronchoscopic biopsy specimens of treatment-naïve SCLC patients, as previously described (19), expanded briefly in nu/nu mice, and stored in liquid nitrogen. To isolate xenograft tumor cells, careful dissection and then mechanical disaggregation were used to avoid the possible damage of cell surface markers by enzymatic digestion and to minimize contamination by stromal cells. Tumor tissues were put into 100 mm sterile Petri dishes with ice-cold serum free medium, finely minced, triturated and filtered. The cells were washed with serum free medium and then treated with erythrocyte lysis buffer. For CD133 FACS sorting of live cells, cells were incubated with anti-CD133/1-PE at 4 °C for 20 minutes. Sorting was performed using a FACSVantage cell sorter (BD Immunocytometry Systems, Franklin Lakes, NJ).

Implantation of tumor cells in nude mice

Animal studies were approved by the Johns Hopkins Animal Care and Use Committee. Viable cells were counted with trypan blue dye exclusion, resuspended in sterile matrigel, and injected s.c. into the flanks of 4- to 6-week-old female athymic nu/nu mice (Harlan Laboratories, Indianapolis, IN). using a 25 gauge needle. Tumor growth was assessed by caliper measurement. Animals were sacrificed at 32 days after implantation or when the tumor volume reached 0.3 to 0.5 ml. Some of the tumor tissues were fixed in formaldehyde and stained with H&E for histological analysis.

Results

ASCL1 maintains growth, apoptosis resistance and soft agar clonogenicity in cultured SCLC

To study the role of ASCL1 in SCLC growth and tumorigenicity, we used RNA interference to repress endogenous ASCL1 expression, first in cultured SCLC cell lines and subsequently in SCLC direct xenograft tumors. In order to minimize the chance of off-target effects induced by the siRNA, we separately transfected samples of the SCLC cell line NCI-H1618 with 3 individual siRNA duplexes targeting ASCL1. As shown in fig. 1A, each of the siRNA duplexes reduced endogenous ASCL1 expression both at the mRNA and the protein level. We compared the proliferation rate of ASCL1 knockdown cells with that of control cells using an MTT assay. To maintain effective knockdown throughout the experiment, we repeated the siRNA transfection at day 3, and day 6. All three siRNA duplexes moderately inhibited proliferation (fig. 1B). Cell cycle analysis with Hoechst 33258 showed that the sub-G0-G1 population increased from about 2% in control siRNA treated cells to 5.5%, 7.6 and 12.6% in ASCL1 siRNA treated cells (fig. 1C). Cell surface Annexin-V reactivity increased from 7.9% in control cells, to 17.7%, 19%, and 27.5% in SCLC cells 72 hours after ASCL1 siRNA treatment, confirming increased apoptosis (not shown). The S-phase fraction decreased very modestly from 21.5% to 16.6% – 20%, with no significant changes in the distribution of G1 or G2-M. Repeat cell cycle analysis after BrdU incorporation similarly showed unchanged G1 and G2-M populations and minimal reduction in S-phase (28.5% to 22.8 – 28%). These data indicate that knockdown of ASCL1 in cultured SCLC can cause induction of apoptotic cell death and modest repression of cell proliferation, largely consistent with earlier findings of Osada, et al (16).

Fig. 1
Knockdown of ASCL1 results in induction of apoptosis and reduced clonogenicity in cultured SCLC. A. NCI-H1618 cells were transfected with a control siRNA (Dharmacon) or one of three individual siRNA duplexes against ASCL1. Quantitative RT-PCR and immunoblotting ...

To study the effect of long term knockdown of ASCL1 on SCLC, we developed lentiviruses expressing shRNAs directed against two different target sequences of ASCL1 using pLL3.7, which also expresses GFP as a marker for infection efficiency. Luciferase shRNA in the same vector was used as a negative control. Fluorescence microscopy indicated that about 80% of NCI-H1618 cells were infected (data not shown). ASCL1 knockdown was effective, as shown in fig. 1D. Either of the ASCL1-targeting shRNA lentiviruses caused approximately 80% reduction in soft agar cloning efficiency.

Genes induced by ASCL1 in SCLC include CD133 and ALDH1A1

To identify possible regulatory targets for ASCL1 in SCLC, we compared mRNA expression profiles between control and ASCL1 siRNA treated cells using Affymetrix U133 Plus 2.0 arrays. Table 1 shows genes selected according to a threshold of a 2-fold reduction by all the three individual siRNAs, following 72 or 120 hours treatment. Genes regulated to that extent by fewer than three of the effective siRNAs were excluded as possible off-target effects. For the purpose of this study, we focused on genes whose expression decreased with ASCL1 knockdown, based on the primary role of this transcription factor as a transcriptional activator. The regulation of expression of these genes by ASCL1 was validated by real-time RT-PCR (Table 1). One of these genes is dll3 (delta-like 3), encoding a Notch ligand, which has been identified as an ASCL1 transcriptional target in mammalian nervous system development (4, 20). To further understand the mechanisms by which ASCL1 regulates the expression of these genes, we compared the rate of decay of ASCL1 and candidate target gene mRNA’s following siRNA treatment. Fig. 2B shows that expression of Prom1/CD133, MMP10 and Dll3 mRNA decreased by about 40–70% at 24 h, approximately 8 hours after effective suppression of ASCL1 protein by siRNA treatment. These findings suggest that these genes could be either direct or rapidly activated indirect targets of ASCL1.

Fig. 2
ASCL1 regulates expression of CD133 and ALDH1A1. A. Effective ASCL1 protein knockdown emerges approximately 16 h after siRNA transfection in NCI-H1618 cells. Putative transcriptional targets DLL3, CD133 and MMP10 are significantly down-regulated 24 h ...
Table 1
Selected ASCL1 regulated genes identified by Affymetrix U133 microarray and validated by qRT-PCR

To understand ASCL1 regulation of the prominin 1/CD133 gene, we first analyzed expression levels of the four adjacent prom1/CD133 alternative initiating exons (21). Alternate exon 1A was most abundantly expressed by qRT-PCR in NCI-H1618 cells; expression of this exon decreased by approximately 5–7-fold following ASCL1 knockdown (data not shown). A candidate ASCL1-binding E-box motif (4) was identified 104 bp 5′ of Exon1A. ChIP analysis (fig. 2C) confirmed association of endogenous ASCL1 protein to the CD133 promoter region that was eliminated by ASCL1 siRNA. Comparable specific ASCL1 association with the aldh1a1 proximal promoter region was also detected (fig. 2C center panel). A dll3 promoter region, orthologous to a mouse dll3 region reported to bind ASCL1 (20), also showed specific association with ASCL1 in human SCLC cells. As expected, no ASCL1 binding was seen to an irrelevant promoter, human NIS (not shown). Together with expression data, these findings are consistent with ASCL1 as a likely direct regulator of cd133, aldh1a1, and dll3 gene expression in SCLC cells.

The effect of ASCL1 knockdown on CD133 and ALDH1A1 mRNA expression raised the possibility that ASCL1 could regulate the tumor initiating capacity of SCLC tumor cells. CD133 and ALDH1A1 have been characterized as progenitor/stem cell markers in normal development, and they are also expressed in tumor-initiating populations in several different tumor types (2226). To explore this potentially important function of ASCL1, we first confirmed significant regulation of these markers at the protein level. CD133 protein levels significantly decreased by immunoblot following ASCL1 siRNA treatment in cultured NCI-H1618 and NCI-H209 cells (Supplemental figure S1). By FACS analysis, an impressive fraction of control NCI-H1618 cells, 65%, was positive for CD133, normalized to an IgG control (fig. 2C). This fraction dropped to 36% after 3 days of treatment with ASCL1 siRNA. It is noteworthy that the distribution of CD133 followed a Gaussian rather than a bimodal pattern, indicating a continuous range of CD133 expression rather than discrete populations of positive and negative cells. Treatment with ASCL1 siRNA resulted in skewing of the CD133 distribution leftwards (fig. 2C). Aldefluor assays were performed to measure the activity of aldehyde dehydrogenase which converts substrate BAAA to the fluorescent product BAA. The distribution of Aldefluor activity was also continuous; knockdown of ASCL1 caused its leftward movement with a dramatic decrease of Aldefluor bright cells from 58.9% to 21.4% after 5 days of ASCL1 siRNA treatment (fig. 2C).

We further tested 10 SCLC lines (seven classic, three variant) for the concordance of ASCL1, CD133 and ALDH. The seven classic SCLC lines all expressed abundant ASCL1, six of seven had abundant CD133 expression by FACS, and six of seven significant ADLH activity. In contrast, the variant SCLC lines, which lack significant NE marker expression, also lacked detectable ASCL1 and ALDH activity, and one of three expressed CD133 (Supplemental table 1). In two NSCLC cell lines which lack ASCL1 expression (NCI-H1299 and NCI-H460), only a small sub-population (under 5%) expressed CD133 and had ALDH activity. (Supplemental figure S2) Therefore, ASCL1 and CD133 expression, and ALDH activity appear to be generally concordant across a broad range of lung cancer cell lines.

ASCL1 is co-regulated with CD133 and ALDH1A1 in SCLC tumor sub-populations

To better model the range and diversity of tumor-initiating capacities in native human SCLC tumors, we performed further studies using direct SCLC tumor xenografts developed by two of the co-authors (DNW and MB). These direct tumor xenografts were generated by collecting tumor cells from bronchoscopic biopsies of extensive-stage SCLC patients, and directly implanting them s.c. in athymic nu/nu mice. These xenograft lines, LX33 and LX36, have been frozen and expanded briefly in mice. LX33 and LX36 xenograft tumors exhibited typical SCLC morphology by H+E staining, expressed classic NE markers and ASCL1, and lacked detectable Rb protein by immunoblot, similar to many classic SCLC lines and tumors (fig. 3A and data not shown). We detected abundant CD133 positive and Aldefluor bright cells in both of these SCLC xenografts (fig. 3B and data not shown). Also similar to the SCLC cell lines, the distribution of CD133 followed a Gaussian rather than a bimodal distribution. We selected the highest and the lowest 5% of cells by FACS sorting and defined them CD133high and CD133low cells respectively. The purity, as assessed by CD133 antibody against a second epitope, was about 90% for CD133high and 98% for CD133low cells, indicating considerable enrichment of both sub-populations (fig. 3B, lower panel). The fraction of human cells was estimated at approximately 93% using FACS for human-specific CD59 for both CD133high and CD133low sub-populations (Supplemental figure S3). To test for contamination by mouse endothelial cells and progenitors that could be reactive for CD133, we performed control FACS using anti-mouse CD31. Both CD133high and CD133low sub-populations had < 3% CD31-reactive cells (data not shown).

Fig. 3
ASCL1, CD133 and ALDH1A1 co-segregate in SCLC direct xenograft tumors. A. H+E staining of direct xenograft tumor LX33 and LX36 showed typical SCLC morphology. B. freshly isolated cells from direct xenograft tumors were labeled with CD133 antibody conjugated ...

Since both CD133 and ALDH1A1 are apparent targets of ASCL1, we compared mRNA expression levels of ASCL1, ALDH1A1, and CD133 in CD133high and CD133low sub-populations to determine whether expression of these genes normally co-segregates in SCLC. Quantitative real-time PCR of two different direct xenograft lines revealed that CD133high cells expressed much higher levels of ASCL1 and ALDH1A1 than did CD133low cells (fig. 3C). Immunoblotting also confirmed the co-expression of CD133 and ASCL1. These data indicate that ASCL1 is jointly regulated with CD133 and ALDH1A1 in these SCLC xenograft tumor sub-populations.

ASCL1 is critical for enhanced tumor-initiating capacity in the CD133high SCLC sub-population

CD133 has been identified as a marker for tumor cells with high tumor-initiating capacity in brain, colon, prostate and pancreatic cancer (24, 2729). We evaluated the tumor-initiating capacity of CD133high and CD133low fractions in SCLC direct xenograft tumors by subcutaneous injection into athymic nu/nu mice. Comparable viability, by trypan blue dye exclusion, was observed in CD133high and CD133low cells following isolation (79% and 74%) and equal numbers of viable cells were injected. As shown in fig. 4A, as few as 1000 CD133high cells reliably generated subcutaneous tumors after 4 weeks. In contrast, although 100,000 and 25,000 CD133low cells showed similar tumor formation capacity as CD133high cells, 5000 and 1000 CD133low cells were much less efficient in initiating tumors. Moreover, the tumors generated by CD133low cells were significantly smaller than those generated by the CD133high xenograft fraction. Tumor growth curves showed that it took longer for CD133low cells to form palpable tumors (fig. 5D). The tumors generated by transplantation of CD133high cells showed a similar distribution of CD133 expression compared to parental tumors derived from unsorted cells (fig. 4B), suggesting that CD133high cells are able to give rise to CD133low cells and reconstitute the whole tumor population. In contrast, tumors arising from CD133low cells had a consistently smaller fraction of CD133high cells than did unselected parental tumors. These data indicate that cells with tumor initiating capacities are enriched in the CD133high sub-population. Low CD133 expression did not exclude tumor-initiating cells, but this capacity was expressed at a lower rate, and CD133low cells were unable to fully and rapidly reconstitute cells with high CD133 expression.

Fig. 4
CD133 high sub-population is enriched for tumor-initiating capacity. A. Freshly isolated CD133high or CD133low cells were injected s.c. into nude mice (n=8 for each cell number). Only CD133high cells (clear bars) could effectively form tumors at inocula ...
Fig. 5
ASCL1 regulates tumor-initiating capacity. A. Freshly isolated CD133high cells from direct xenograft line LX-36 were infected with lentivirus expressing control luceriferase shRNA or ASCL1 shRNA for 4 days. Immunoblotting shows effective knockdown of ...

In order to study whether ASCL1 plays a critical role in tumorigenicity of CD133high cells, we infected the freshly-isolated CD133high cells with ASCL1 shRNA or a control luciferase shRNA lentivirus. We observed effective knockdown of ASCL1 protein in CD133high cells. As shown in fig. 5A, ASCL1 knockdown resulted in ASCL1 levels comparable to those seen in CD133low cells from the same tumor. While 8 of 8 mice injected with 5000 CD133high cells infected with control virus developed tumors, only 4 of 8 mice injected with CD133high cells infected with ASCL1 shRNA lentivirus developed tumors. Three of 8 mice injected with 5000 CD133low cells developed tumors (fig. 5B). Similar proportions were observed when 1000 cells were used. Tumor growth curves demonstrated that the tumors derived from CD133high cells grew much faster than those from CD133low cells of the same direct xenograft line (figs. 5C and D). Treatment of CD133high cells with ASCL1 shRNA lentivirus dramatically decreased the tumor proliferation rate compared to control CD133high cells. Thus, the CD133low fraction showed much lower tumor initiating capacity, and ASCL1 knockdown effectively reduced the tumorigenicity of the CD133high fraction to the level seen in CD133low cells. Similar results were obtained in a second xenograft tumor line LX33 (supplementary figure S4).

To exclude the chance that tumor-initiating cells could be relatively more or less susceptible to lentiviral infection than other tumor cells, we infected freshly-isolated cells with a lentivirus expressing the control luciferase shRNA plus GFP, sorted for GFP fluorescence, and then performed tumorigenicity assays with 5000 GFP-positive and GFP-negative cells. We found that there was no difference in the tumorigenicity of the readily infected (GFP-positive) and hard to infect (GFP-negative) cells (data not shown). In summary, these data suggest that a naturally-existing SCLC tumor sub-population jointly enriched for CD133, ASCL1 and Aldehyde dehydrogenase has an enhanced tumor-initiating capacity, which is at least partially dependent on ASCL1 regulation.

Discussion

The bHLH transcription factor ASCL1/Mash1 was initially discovered as an early regulator of mammalian neural development, promoting lineage commitment of neural and oligodendroglial progenitors in the CNS, as well as sympathoadrenal and enteric precursors in the peripheral nervous system (3, 7, 8). In addition to its role in neural development, ASCL1 is essential for the appearance of lung neuroendocrine (NE) cells as well as several other NE tissues including calcitonin-producing thyroid C cells and adrenomedullary chromaffin cells (10, 30). Several lines of evidence suggested that ASCL1 could promote NE tumorigenesis in the lung, including a transgenic over-expression model, and cell culture-based RNA interference models (12, 14). In this study, we show that knockdown of ASCL1 induces apoptosis and moderate growth inhibition in cultured SCLC cells, consistent with a previous report (16). We demonstrate that repression of ASCL1 causes a more dramatic reduction of soft agar clonogenicity and tumorigenicity in nude mice. Furthermore, variations in ASCL1 expression levels within SCLC tumors appear to correlate with the tumor-initiating capacity of these sub-populations.

Identification of transcriptional targets of ASCL1 in SCLC that are relevant to the initiation of new tumors has been inconclusive, to date. By cDNA microarray analysis following ASCL1 knockdown, we identified two previously-identified target genes of ASCL1, dll3 and rab3b, involved in Notch signaling in the developing nervous system and neurotransmitter vesicle trafficking, respectively (4, 31, 32). We confirmed that ASCL1 associates with human dll3 gene promoter, similar to findings in the developing mouse CNS. Interestingly, we have not observed down-regulation of any classic NE differentiation markers such as chromogranins, synaptophysin, SCG2 and others. Possible explanations include persistence of sufficient threshold levels of ASCL1, redundant transcriptional activators, or less likely, prolonged stability of these NE mRNAs. The ASCL1 regulated genes in our study have been implicated in several critical signaling pathways in tumorigenesis, cell proliferation and tumor metastasis (Table 1), indicating that besides an impact on NE differentiation, ASCL1 may exert a more profound influence on classic SCLC. ASCL1 appears to play a less significant role in variant SCLC, which is typified by c-myc amplification and loss of NE phenotypic markers. How ASCL1 expression becomes down-regulated in variant SCLC is still unknown.

CD133, ALDH1A1, LIFR (Leukemia Inhibitory Factor Receptor) and EPHA4 are putative stem cell markers or involved in regulating stem/progenitor cell function or differentiation. We demonstrated association of endogenous ASCL1 with the CD133 and ALDH1A1 promoter regions. CD133 and ALDH were previously identified as markers for high tumor-initiating capacity in glioblastoma multiforme as well as colon, breast and pancreatic cancer (27, 28, 33, 34). Whether SCLC tumors have discrete populations with enhanced tumor-initiating capacity was not previously known. Thus, we investigated the possibility of using CD133 and ALDH1A1 as markers for tumor initiating capacity in SCLC. Since established SCLC cell lines could lose their heterogeneity of tumor initiation capacity after extensive passaging in serum-containing media, we used a direct xenograft model, in which the cancer cells collected from SCLC patients were injected subcutaneously and expanded briefly in mice. Presumably, these low-passage direct xenograft tumor cells have undergone some selective pressure for the ability to form subcutaneous tumors, rather than to grow in suspension culture. This model is of particular interest for studying a characteristic feature of tumor-initiating cells – the ability to generate non-tumorigenic end cells. We found that CD133high cells were highly tumorigenic, with only 1000 CD133high cells forming aggressive tumors in a short period of time. The similarity of CD133 distribution of the tumors generated by CD133high and unsorted parental cells suggested that CD133high cells are able to give rise to a CD133low sub-population. On the other hand, significantly more CD133low cells were required to initiate tumors and CD133low cells may not be able to effectively reconstitute the whole tumor population including CD133high cells. Interestingly, CD133 expression in secondary tumors from CD133low cells was somewhat more abundant than the original CD133low sub-fraction (compare figures 3B and and4B).4B). It is unknown whether this increase represents proliferation of remaining CD133high cells, conversion of CD133low cells, or a combination of both processes.

The co-segregated expression of CD133, ALDH1A1 and ASCL1 in a cellular sub-population with high tumorigenicity appears broadly consistent with the cancer stem cell hypothesis. However, we could not completely exclude tumorigenic cells by selecting CD133low cells. Furthermore, we observed Gaussian rather than discrete bimodal distributions of CD133 expression and aldehyde dehydrogenase activity. Also the very high tumorigenicity of CD133high cells could be modulated by ASCL1 knockdown. On balance, our data favor a stochastic variation model of tumorigenicity in SCLC, with a large fraction of cells able to initiate a new tumor (35). However, because our studies use xenograft lines selected for subcutaneous tumor survival, we may not have characterized some cells present in the original cancer with low tumor-initiating potential.

Recently, Eramo et. al., focusing mainly on NSCLC, reported that a small fraction of CD133 positive cells in human lung cancer carry tumor-initiating capacity (36). In the present study, we further show that in SCLC, ASCL1 may actively maintain the high tumor-initiating phenotype of a relatively abundant, rather than discrete, sub-population of SCLC tumor cells. The detailed mechanisms by which ASCL1 modulates tumor initiating capacity remain unclear. We detected abundant expression of several additional stem cell related genes such as Musashi1, Bmi1, and EZH2 (37, 38), which were equivalent in both CD133 high and CD133low sub-populations and not regulated by ASCL1 in cultured SCLC. The bronchoalveolar progenitor marker CD34 (39) was low in both populations (data not shown). We could not exclude the possibility that ASCL1 may function as a transcription repressor for some critical targets. Most recently, Osada et. al. reported that ASCL1, when over-expressed in the adenocarcinoma line A549, repressed expression of DKK1, a negative regulator of Wnt/β-catenin pathway, potentially contributing to growth in that model system (31). We observed modest up-regulation of DKK3, but not DKK1, by ASCL1 siRNA in cultured SCLC cells (data not shown). Although an earlier study on cell lines and our own unpublished data did not favor a major role for the Wnt pathway in SCLC (40), we could not exclude the possibility that lower levels of Wnt pathway activity are significant.

A recent study systematically explored ASCL1 transcriptional targets in the normal developing brain (18). Among the 14 direct target genes identified in this study including the transcription factors Insm1, Isl1, Lhx8, and Pou3f1, none satisfied our criteria for greater than 2-fold regulation by all three target siRNA’s in SCLC cells. To account for the surprising lack of overlap in transcriptional targets of ASCL1 between normal developing brain and SCLC, we hypothesize that there are numerous powerful differences in transcriptional context. Potentially important influences in SCLC include the absence of Rb, known to associate with over 200 proteins including many transcription factors, alterations in key histone modulators including polycomb group regulators, as well as promoter hypermethylation. Collectively, these genetic and epigenetic alterations may account for the apparent paradox of how a proneural transcription factor plays a key role in NE tumor virulence.

Supplementary Material

Supplemental figure S1

Supplemental figure S2

Supplemental figure S3

Supplemental figure S4

Supplemental figure legend

Supplemental table 1

Acknowledgments

Supported in part by NCI RO1CA070244 (DWB) and FAMRI Clinician-Scientist Awards (DWB and DNW) and a generous charitable donation (AG to DWB). Vincent C. Daniel and Jared S. Hierman provided valuable assistance in procuring the xenografts.

Footnotes

Microarray data were deposited online at http://www.ebi.ac.uk/microarray/, accession number E-MEXP-1857.

References

1. Govindan R, Page N, Morgensztern D, et al. Changing epidemiology of small-cell lung cancer in the United States over the last 30 years: analysis of the surveillance, epidemiologic, and end results database. J Clin Oncol. 2006;24:4539–44. [PubMed]
2. Sekido Y, Fong KM, Minna JD. Molecular genetics of lung cancer. Annu Rev Med. 2003;54:73–87. [PubMed]
3. Ball DW. Achaete-scute homolog-1 and Notch in lung neuroendocrine development and cancer. Cancer Lett. 2004;204:159–69. [PubMed]
4. Casarosa S, Fode C, Guillemot F. Mash1 regulates neurogenesis in the ventral telencephalon. Development. 1999;126:525–34. [PubMed]
5. Guillemot F, Lo LC, Johnson JE, Auerbach A, Anderson DJ, Joyner AL. Mammalian achaete-scute homolog 1 is required for the early development of olfactory and autonomic neurons. Cell. 1993;75:463–76. [PubMed]
6. Tomita K, Nakanishi S, Guillemot F, Kageyama R. Mash1 promotes neuronal differentiation in the retina. Genes Cells. 1996;1:765–74. [PubMed]
7. Huber K, Bruhl B, Guillemot F, Olson EN, Ernsberger U, Unsicker K. Development of chromaffin cells depends on MASH1 function. Development. 2002;129:4729–38. [PubMed]
8. Hirsch MR, Tiveron MC, Guillemot F, Brunet JF, Goridis C. Control of noradrenergic differentiation and Phox2a expression by MASH1 in the central and peripheral nervous system. Development. 1998;125:599–608. [PubMed]
9. Sriuranpong V, Borges MW, Strock CL, et al. Notch signaling induces rapid degradation of achaete-scute homolog 1. Mol Cell Biol. 2002;22:3129–39. [PMC free article] [PubMed]
10. Borges M, Linnoila RI, van de Velde HJ, et al. An achaete-scute homologue essential for neuroendocrine differentiation in the lung. Nature. 1997;386:852–5. [PubMed]
11. Ito T, Udaka N, Yazawa T, et al. Basic helix-loop-helix transcription factors regulate the neuroendocrine differentiation of fetal mouse pulmonary epithelium. Development. 2000;127:3913–21. [PubMed]
12. Linnoila RI, Zhao B, DeMayo JL, et al. Constitutive achaete-scute homologue-1 promotes airway dysplasia and lung neuroendocrine tumors in transgenic mice. Cancer Res. 2000;60:4005–9. [PubMed]
13. Meuwissen R, Linn SC, Linnoila RI, Zevenhoven J, Mooi WJ, Berns A. Induction of small cell lung cancer by somatic inactivation of both Trp53 and Rb1 in a conditional mouse model. Cancer Cell. 2003;4:181–9. [PubMed]
14. Osada H, Tatematsu Y, Yatabe Y, Horio Y, Takahashi T. ASH1 gene is a specific therapeutic target for lung cancers with neuroendocrine features. Cancer Res. 2005;65:10680–5. [PubMed]
15. Ball DW, Jin N, Rosen DM, et al. Selective growth inhibition in BRAF mutant thyroid cancer by the mitogen-activated protein kinase kinase 1/2 inhibitor AZD6244. J Clin Endocrinol Metab. 2007;92:4712–8. [PubMed]
16. Rubinson DA, Dillon CP, Kwiatkowski AV, et al. A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference. Nat Genet. 2003;33:401–6. [PubMed]
17. Yuan B, Latek R, Hossbach M, Tuschl T, Lewitter F. siRNA Selection Server: an automated siRNA oligonucleotide prediction server. Nucleic Acids Res. 2004;32:W130–4. [PMC free article] [PubMed]
18. Gohlke JM, Armant O, Parham FM, et al. Characterization of the proneural gene regulatory network during mouse telencephalon development. BMC Biol. 2008;6:15. [PMC free article] [PubMed]
19. Hann CL, Daniel VC, Sugar EA, et al. Therapeutic efficacy of ABT-737, a selective inhibitor of BCL-2, in small cell lung cancer. Cancer Res. 2008;68:2321–8. [PMC free article] [PubMed]
20. Castro DS, Skowronska-Krawczyk D, Armant O, et al. Proneural bHLH and Brn proteins coregulate a neurogenic program through cooperative binding to a conserved DNA motif. Dev Cell. 2006;11:831–44. [PubMed]
21. Shmelkov SV, Jun L, St Clair R, et al. Alternative promoters regulate transcription of the gene that encodes stem cell surface protein AC133. Blood. 2004;103:2055–61. [PubMed]
22. Yin AH, Miraglia S, Zanjani ED, et al. AC133, a novel marker for human hematopoietic stem and progenitor cells. Blood. 1997;90:5002–12. [PubMed]
23. Uchida N, Buck DW, He D, et al. Direct isolation of human central nervous system stem cells. Proc Natl Acad Sci U S A. 2000;97:14720–5. [PubMed]
24. Singh SK, Hawkins C, Clarke ID, et al. Identification of human brain tumour initiating cells. Nature. 2004;432:396–401. [PubMed]
25. Kastan MB, Schlaffer E, Russo JE, Colvin OM, Civin CI, Hilton J. Direct demonstration of elevated aldehyde dehydrogenase in human hematopoietic progenitor cells. Blood. 1990;75:1947–50. [PubMed]
26. Storms RW, Trujillo AP, Springer JB, et al. Isolation of primitive human hematopoietic progenitors on the basis of aldehyde dehydrogenase activity. Proc Natl Acad Sci U S A. 1999;96:9118–23. [PubMed]
27. Hermann PC, Huber SL, Herrler T, et al. Distinct populations of cancer stem cells determine tumor growth and metastatic activity in human pancreatic cancer. Cell Stem Cell. 2007;1:313–23. [PubMed]
28. O’Brien CA, Pollett A, Gallinger S, Dick JE. A human colon cancer cell capable of initiating tumour growth in immunodeficient mice. Nature. 2007;445:106–10. [PubMed]
29. Miki J, Furusato B, Li H, et al. Identification of putative stem cell markers, CD133 and CXCR4, in hTERT-immortalized primary nonmalignant and malignant tumor-derived human prostate epithelial cell lines and in prostate cancer specimens. Cancer Res. 2007;67:3153–61. [PubMed]
30. Kameda Y, Nishimaki T, Miura M, Jiang SX, Guillemot F. Mash1 regulates the development of C cells in mouse thyroid glands. Dev Dyn. 2007;236:262–70. [PubMed]
31. Osada H, Tomida S, Yatabe Y, et al. Roles of achaete-scute homologue 1 in DKK1 and E-cadherin repression and neuroendocrine differentiation in lung cancer. Cancer Res. 2008;68:1647–55. [PubMed]
32. Darchen F, Goud B. Multiple aspects of Rab protein action in the secretory pathway: focus on Rab3 and Rab6. Biochimie. 2000;82:375–84. [PubMed]
33. Ginestier C, Hur MH, Charafe-Jauffret E, et al. ALDH1 Is a Marker of Normal and Malignant Human Mammary Stem Cells and a Predictor of Poor Clinical Outcome. Cell Stem Cell. 2007;1:555–67. [PMC free article] [PubMed]
34. Singh SK, Clarke ID, Terasaki M, et al. Identification of a cancer stem cell in human brain tumors. Cancer Res. 2003;63:5821–8. [PubMed]
35. Adams JM, Strasser A. Is tumor growth sustained by rare cancer stem cells or dominant clones? Cancer Res. 2008;68:4018–21. [PubMed]
36. Eramo A, Lotti F, Sette G, et al. Identification and expansion of the tumorigenic lung cancer stem cell population. Cell Death Differ. 2008;15:504–14. [PubMed]
37. Sakakibara S, Imai T, Hamaguchi K, et al. Mouse-Musashi-1, a neural RNA-binding protein highly enriched in the mammalian CNS stem cell. Dev Biol. 1996;176:230–42. [PubMed]
38. Sparmann A, van Lohuizen M. Polycomb silencers control cell fate, development and cancer. Nat Rev Cancer. 2006;6:846–56. [PubMed]
39. Kim CF, Jackson EL, Woolfenden AE, et al. Identification of bronchioalveolar stem cells in normal lung and lung cancer. Cell. 2005;121:823–35. [PubMed]
40. Coe BP, Lockwood WW, Girard L, et al. Differential disruption of cell cycle pathways in small cell and non-small cell lung cancer. Br J Cancer. 2006;94:1927–35. [PMC free article] [PubMed]