PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jnaJournal of Nucleic Acids
 
J Nucleic Acids. 2010; 2010: 468017.
Published online 2010 May 31. doi:  10.4061/2010/468017
PMCID: PMC2915814

Structure and Stability of a Dimeric G-Quadruplex Formed by Cyclic Oligonucleotides

Abstract

We have studied the structure and stability of the cyclic dodecamer d<pGGGTTAGGGTTA>, containing two copies of the human telomeric repeat. In the presence of sodium, NMR data are consistent with a dimeric structure of the molecule in which two cycles self-associate forming a quadruplex with three guanine tetrads connected by edgewise loops. The two macrocycles are arranged in a parallel way, and the dimeric structure exhibits a high melting temperature. These results indicate that cyclization of the phosphodiester chain does not prevent quadruplex formation, although it affects the global topology of the quadruplex.

1. Introduction

One of the most studied noncanonical DNA motifs is the G-quadruplex, where four guanines are paired through their Watson-Crick and Hoogsteen sides [13]. These structures are receiving substantial attention in research areas ranging from molecular biology to structural and analytical chemistry [46]. It has been suggested that G-quadruplexes play a role in several biological processes, such as telomere integrity, genetic recombination, transcription, or replication. In addition, they are attractive targets for drug design, especially in cancer chemotherapy [711]. Clear evidence of quadruplex formation in vivo has been found recently [1214].

G-quadruplexes can fold in many ways that differ in their chain number and orientation. Whereas single Gn tracks arrange in parallel structures, multiple Gn repeats fold with different topologies that are influenced mainly by the nucleotide sequence between Gn repeats as well as by the kind of counterion. In occasions, different topologies have been found for the same oligonucleotide in solid and solution studies.

On the other hand, cyclic oligonucleotides have emerged as interesting molecules in research for diagnosis and as therapeutic agents due to their increased nuclease resistance relative to their linear analogues [15, 16]. These molecules are also interesting for structural studies since the conformational constraint induced by cyclization of the chain may increase the relative stability of the structure of interest [1721]. G-quadruplexes have been used as templates for enhancing the efficiency of the synthesis of cyclic oligonucleotides. This approach takes advantage of the proximity between the two oligonucleotide termini in some quadruplex topologies to improve phosphodiester ligation [2224].

G-quadruplex forming cyclic oligonucleotides may be interesting in a number of applications. For example, these nuclease resistant oligonucleotides can be very useful probes to study G-quadruplex interacting proteins. However, the conformational constraint induced by cyclization affects the range of structures that a G-quadruplex can adopt. For example, diagonal loops or double-chain-reversal loops are not possible in quadruplexes formed by cyclic oligonucleotides.

To gain insight on the effect of cyclization on the structure of G-quadruplexes, we have studied the structure and stability of the cyclic dodecamer d<pGGGTTAGGGTTA>, containing two copies of the human telomeric repeat. The analogous linear oligonucleotide d(TAGGGTTAGGGT) forms two interconverting dimeric structures in solution: a parallel quadruplex with double-chain-reversal loops, and an antiparallel quadruplex with edgewise loops [25]. On the other hand, the same sequence forms a parallel quadruplex with double-chain-reversal loops in the crystal (in presence of K+) [26]. A similar structural diversity has also been observed in an oligonucleotide containing four copies of the human telomeric repeat, which in K+ forms an intramolecular parallel quadruplex in the crystal [26] and an antiparallel quadruplex with a diagonal and two edgewise loops in Na+-containing solution [27]. Other quadruplex topologies have been observed in a variety of oligonucleotides containing different number of telomeric repeats [2831] (see [32] for a recent review on these studies).

2. Materials and Methods

The synthesis of d<pGGGTTAGGGTTA> was carried out following previously reported methods [33]. Samples for NMR experiments were prepared in 100 mM NaCl, 25 mM sodium phosphate buffer pH 7, with an oligonucleotide concentration ranging from 60 to 600 μM. NMR spectra were acquired in a Bruker AVANCE spectrometer operating at 600 MHz and equipped with a cryoprobe. Two-dimensional experiments (NOESY, TOCSY, and DQF-COSY) were carried out at 5°C in either D2O or in H2O/D2O 9:1. NOESY spectra were acquired with mixing times of 50, 100, and 200 ms, and TOCSY spectra were recorded with standard MLEV-17 spin-lock sequence, and 80 ms mixing time. NOESY spectra in H2O were acquired with 50 and 150 ms mixing times. In 2D experiments in H2O, water suppression was achieved by including a WATERGATE [34] module in the pulse sequence prior to acquisition. The spectra were processed with Topspin software and analyzed with the program Sparky [35].

CD spectra were obtained following the change of ellipticity from 220 nm to 320 nm at different temperatures on a Jasco spectropolarimeter equipped with a Peltier temperature control used to set the temperature between 5°C and 90°C. The changes in ellipticity versus temperatures were plotted and used to obtain the melting temperature. Melting experiments were recorded at 0.5°C/min at the maximum wavelength. CD spectra were recorded at oligonucleotide concentrations ranging from 5 to 50 μM. The spectra were normalized to facilitate comparisons.

3. Results and Discussion

NMR spectra change dramatically upon oligonucleotide concentration. At low concentration, only six H6/H8 aromatic signals are detected (as a logical consequence of the repetitive sequence), and the exchangeable proton spectrum is very broad (see Figure 1). However, at high oligonucleotide concentration the exchangeable proton spectra shows 12 narrow signals between 10.0 and 12.0 ppm, and 24 aromatic signals (corresponding to H6/H8 protons) are observed in the non-exchangeable proton spectrum (see Figure 2). These data indicate the formation of an asymmetric dimer. Two fragments of the NOESY spectra in D2O are shown in Figures Figures2 and2 and and3.3. The NMR spectrum in these conditions exhibits narrow and well dispersed signals, which indicates that the oligonucleotide adopt a well-defined structure. However, the NMR spectra of this molecule could not be unambiguously assigned due to its highly repetitive sequence. In spite of this, many structural features can be spotted from this spectrum. First, the cross-peaks of the imino and amino protons are consistent with the presence of three G-tetrads. Secondly, as shown in Figure 3, six strong H1′-H8 cross-peaks are observed, indicating that the glycosidic angle of the corresponding guanines is in a syn conformation (Gs). The six remaining guanines are in an anti conformation (Ga). Moreover, the occurrence of four steps Gs-Ga can be established from the sequential H1′→H8 NOEs steps. Finally, no Ga-Ga steps are present in this structure since no sequential NOEs are observed between guanines in anti.

Figure 1
One-dimensional NMR spectra of d<pGGGTTAGGGTTA> in H2O at 60 μM (bottom) and 600 μM (top) oligonucleotide concentrations (buffer conditions: 100 mM NaCl, 25 mM sodium phosphate pH 7, T = ...
Figure 2
NOESY spectra of d<pGGGTTAGGGTTA> in D2O (200 ms mixing time) at 600 μM oligonucleotide concentration (same buffer conditions as in Figure 1). The eight thymine signals are indicated together with some informative ...
Figure 3
NOESY spectra of d<pGGGTTAGGGTTA> in D2O (200 ms mixing time) at 600 μM oligonucleotide concentration (same buffer conditions as in Figure 1). Strong H1′-H8 cross-peaks, characteristic of syn guanines, ...

All these data, together with symmetry considerations, led us to suggest a model for this structure in which two cyclic dodecamers self-associate forming an antiparallel quadruplex with three G-tetrads (Figure 4). The two macrocycles are arranged in a parallel way. Overall, the structure is similar to antiparallel quadruplexes resulting from a head-to-head association of two hairpins with “edgewise” loops.

Figure 4
Schematic model of the dimeric structure of d<pGGGTTAGGGTTA>, consistent with the experimental data in Na+ buffer. Guanines syn and anti are indicated with open and solid rectangles, respectively.

It is interesting to compare these results with other structures of quadruplexes formed by linear oligonucleotides containing repeats of the human telomeric sequence. Different groups have shown that linear oligonucleotides containing two repeats tend to adopt antiparallel quadruplex structures in sodium buffer [25, 36]. In the case of d(UAGGGTBrUAGGGT) the structure is an asymmetric dimer [25], but the relative orientation of the two molecules is different than in the dimeric structure of d<pGGGTTAGGGTTA>. The distribution of syn and anti guanines is also different in both cases. In the presence of K+, linear oligonucleotides containing two repeats of the human telomere have the propensity to adopt parallel-stranded structures [25, 36], which are obviously impossible in the case of the cyclic analogues. We must conclude that the conformational constraint induced by cyclization of the phosphodiester chain affects the topology of the quadruplex. This result is not surprising since cyclization is formally equivalent to introducing an additional nonnative loop in the sequence. The effect of loop variations in the structure and topology of quadruplex has been extensively studied by several groups [3739].

Since many oligonucleotides containing human telomeric repeats tend to adopt different structures in presence of K+ or Na+ cations, we tackled the study of the effect of these two cations on the structure of d<pGGGTTAGGGTTA>. The profile of the CD spectra in Na+ buffer was consistent with an antiparallel G-quartet architecture characterized by a positive band at 248 nm, a positive maximum at 295 nm, and a negative maximum at 265 nm (Figure 5(a)). However, in presence of K+ the CD spectra of d<pGGGTTAGGGTTA> changes dramatically (Figure 5(b)). The negative band at 265 nm disappears, and the minimum around 235 nm is more pronounced. In these experimental conditions the CD spectrum is not consistent with a pure antiparallel or parallel G-quadruplex, the latter presenting a characteristic positive maximum at 265 nm [36]. The experimental CD spectrum suggests the presence of several conformations in equilibrium. NMR spectra conducted at 500 μM oligonucleotide concentration in K+ buffer exhibit very broad signals (data not shown), in agreement with the occurrence of multiple conformations or aggregation. This result is not unexpected since it is well documented that K+ cations favour the parallel-stranded structures, which in this case are impeded by the cyclization of the phosphodiester chain.

Figure 5
CD spectra of d<pGGGTTAGGGTTA> in media containing Na+ (a) or K+ (b). Converted to molar ellipticity CD spectra (c) and normalized melting curves (d) at different oligonucleotide concentrations in the same buffer conditions as NMR experiments. ...

The thermal stability of this structure has been studied by NMR and CD experiments. CD spectra of d<pGGGTTAGGGTTA> in Na+ are characteristic of antiparallel quadruplexes (see Figure 5). Melting curves were recorded at different oligonucleotide concentrations, and thermodynamic parameters were obtained from the variation of the melting temperature with the concentration [40]. Thermodynamic parameters for dimer formation in 100 mM NaCl buffer solution are ΔH0 = −35 kcal/mol, ΔS0 = −92 cal/mol, and ΔG2980 = −8 kcal/mol. It is interesting to compare these parameters with the values for the unimolecular quadruplex formed by analogous linear oligonucleotides containing four repeats of the human telomere. For example, the thermodynamic parameters for d(AGGGTTAGGGTTAGGGTTAGGG), under the same buffer conditions, are ΔH0 = −54 kcal/mol, ΔS0 = −163 cal/mol, and ΔG0298 = −5.4 kcal/mol [41]. Interestingly, formation-free energy is lower for the quadruplex formed by two cyclic oligonucleotides than for the quadruplex formed by the “native” sequence with four telomeric repeats. The larger stability of the former is entropic in nature. The lower formation enthalpy in the dimer is probably a consequence of the constraint in the loops induced by the cyclization. We can conclude that “native” loops are enthalpically more stable. However, the entropic cost of forming the quadruplex through the self-association of two cyclic oligonucleotides with two repeats is lower than in the case of the folding of a linear oligonucleotide with four telomere repeats.

4. Conclusions

In summary, we have shown that guanine-rich cyclic oligonucleotides can form dimeric quadruplex structures. The conformational constraint induced by cyclization of the chain does not prevent quadruplex formation but has a profound influence in the global topology and stability of the structure. Such effect must be taken into account in the potential application of cyclic G-quadruplex as molecular probes.

Acknowledgments

This work was supported by the Spanish Ministry of Science and Innovation Grant CTQ2007-68014-C02-01/02, COST project (G4-net, MP0802) and Generalitat de Catalunya grants 2009 SGR 208 and XRB.

References

1. Burge S, Parkinson GN, Hazel P, Todd AK, Neidle S. Quadruplex DNA: sequence, topology and structure. Nucleic Acids Research. 2006;34(19):5402–5415. [PMC free article] [PubMed]
2. Bates P, Mergny J-L, Yang D. Quartets in G-major. The first international meeting on quadruplex DNA. EMBO Journal. 2007;8(11):1003–1010. [PubMed]
3. Huppert JL. Four-stranded nucleic acids: structure, function and targeting of G-quadruplexes. Chemical Society Reviews. 2008;37(7):1375–1384. [PubMed]
4. Davis JT. G-quartets 40 years later: from 5′-GMP to molecular biology and supramolecular chemistry. Angewandte Chemie International Edition. 2004;43(6):668–698. [PubMed]
5. Margulies D, Hamilton AD. Protein recognition by an ensemble of fluorescent DNA G-quadruplexes. Angewandte Chemie International Edition. 2009;48(10):1771–1774. [PubMed]
6. Alberti P, Bourdoncle A, Saccà B, Lacroix L, Mergny J-L. DNA nanomachines and nanostructures involving quadruplexes. Organic and Biomolecular Chemistry. 2006;4(18):3383–3391. [PubMed]
7. Balasubramanian S, Neidle S. G-quadruplex nucleic acids as therapeutic targets. Current Opinion in Chemical Biology. 2009;13(3):345–353. [PMC free article] [PubMed]
8. Blasco MA. Telomeres and human disease: ageing, cancer and beyond. Nature Reviews Genetics. 2005;6(8):611–622. [PubMed]
9. Patel DJ, Phan AT, Kuryavyi V. Human telomere, oncogenic promoter and 5′-UTR G-quadruplexes: diverse higher order DNA and RNA targets for cancer therapeutics. Nucleic Acids Research. 2007;35(22):7429–7455. [PMC free article] [PubMed]
10. Monchaud D, Teulade-Fichou M-P. A hitchhiker’s guide to G-quadruplex ligands. Organic and Biomolecular Chemistry. 2008;6(4):627–636. [PubMed]
11. Gatto B, Palumbo M, Sissi C. Nucleic acid aptamers based on the G-quadruplex structure: therapeutic and diagnostic potential. Current Medicinal Chemistry. 2009;16(10):1248–1265. [PubMed]
12. Paeschke K, Simonsson T, Postberg J, Rhodes D, Lipps HJ. Telomere end-binding proteins control the formation of G-quadruplex DNA structures in vivo. Nature Structural and Molecular Biology. 2005;12(10):847–854. [PubMed]
13. Duquette ML, Handa P, Vincent JA, Taylor AF, Maizels N. Intracellular transcription of G-rich DNAs induces formation of G-loops, novel structures containing G4 DNA. Genes and Development. 2004;18(13):1618–1629. [PubMed]
14. Maizels N. Dynamic roles for G4 DNA in the biology of eukaryotic cells. Nature Structural and Molecular Biology. 2006;13(12):1055–1059. [PubMed]
15. Kool ET. Circular oligonucleotides: new concepts in oligonucleotide design. Annual Review of Biophysics and Biomolecular Structure. 1996;25:1–28. [PubMed]
16. Kool ET. Recognition of DNA, RNA, and proteins by circular oligonucleotides. Accounts of Chemical Research. 1998;31(8):502–510. [PMC free article] [PubMed]
17. Ashley GW, Kushlan DM. Chemical synthesis of oligonucleotide dumbbells. Biochemistry. 1991;30:2927–2933. [PubMed]
18. Ippel JH, Lanzotti V, Galeone A, et al. Conformation of the circular dumbbell d<pCGC-TT-GCG-TT>: structure determination and molecular dynamics. Journal of Biomolecular NMR. 1995;6(4):403–422. [PubMed]
19. Lin C-T, Lyu YL, Liu LF. A cruciform-dumbbell model for inverted dimer formation mediated by inverted repeats. Nucleic Acids Research. 1997;25(15):3009–3016. [PMC free article] [PubMed]
20. Escaja N, Pedroso E, Rico M, González C. Dimeric solution structure of two cyclic octamers: four-stranded DNA structures stabilized by A:T:A:T and G:C:G:C tetrads. Journal of the American Chemical Society. 2000;122(51):12732–12742.
21. Viladoms J, Escaja N, Frieden M, Gomez-Pinto I, Pedroso E, González C. Self-association of short DNA loops through minor groove C:G:G:C tetrads. Nucleic Acids Research. 2009;37(10):3264–3275. [PMC free article] [PubMed]
22. Qi J, Shafer RH. Covalent ligation studies on the human telomere quadruplex. Nucleic Acids Research. 2005;33(10):3185–3192. [PMC free article] [PubMed]
23. Zhou T, Chen G, Wang Y, Zhang Q, Yang M, Li T. Synthesis of unimolecularly circular G-quadruplexes as prospective molecular probes. Nucleic Acids Research. 2004;32(21, article e173) [PMC free article] [PubMed]
24. Chen J, Liu D, Lee AHF, Qi J, Chan ASC, Li T. Formation of circular oligodeoxyribonucleotides on the structural basis of G-quadruplex and product analysis. Chemical Communications. 2002:2686–2687. [PubMed]
25. Phan AT, Patel DJ. Two-repeat human telomeric d(TAGGGTTAGGGT) sequence forms interconverting parallel and antiparallel G-quadruplexes in solution: distinct topologies, thermodynamic properties, and folding/unfolding kinetics. Journal of the American Chemical Society. 2003;125(49):15021–15027. [PubMed]
26. Parkinson GN, Lee MPH, Neidle S. Crystal structure of parallel quadruplexes from human telomeric DNA. Nature. 2002;417(6891):876–880. [PubMed]
27. Wang Y, Patel DJ. Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex. Structure. 1993;1(4):263–282. [PubMed]
28. Zhang N, Phan AT, Patel DJ. (3 + 1) assembly of three human telomeric repeats into an asymmetric dimeric G-quadruplex. Journal of the American Chemical Society. 2005;127(49):17277–17285. [PubMed]
29. Phan AT, Kuryavyi V, Luu KN, Patel DJ. Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution. Nucleic Acids Research. 2007;35(19):6517–6525. [PMC free article] [PubMed]
30. Phan AT, Luu KN, Patel DJ. Different loop arrangements of intramolecular human telomeric (3+1) G-quadruplexes in K+ solution. Nucleic Acids Research. 2006;34(19):5715–5719. [PubMed]
31. Dai J, Carver M, Punchihewa C, Jones RA, Yang D. Structure of the hybrid-2 type intramolecular human telomeric G-quadruplex in K+ solution: insights into structure polymorphism of the human telomeric sequence. Nucleic Acids Research. 2007;35(15):4927–4940. [PMC free article] [PubMed]
32. Phan AT. Human telomeric G-quadruplex: structures of DNA and RNA sequences. FEBS Journal. 2010;277(5):1107–1117. [PubMed]
33. Alazzouzi E, Escaja N, Grandas A, Pedroso E. A straightforward solid-phase synthesis of cyclic oligodeoxyribonucleotides. Angewandte Chemie International Edition. 1997;36(13-14):1506–1508.
34. Piotto M, Saudek V, Sklenář V. Gradient-tailored excitation for single-quantum NMR spectroscopy of aqueous solutions. Journal of Biomolecular NMR. 1992;2(6):661–665. [PubMed]
35. Goddard DT, Kneller G. SPARKY 3. San Francisco, Calif, USA: University of California; 2003.
36. Rujan IN, Meleney JC, Bolton PH. Vertebrate telomere repeat DNAs favor external loop propeller quadruplex structures in the presence of high concentrations of potassium. Nucleic Acids Research. 2005;33(6):2022–2031. [PMC free article] [PubMed]
37. Webba da Silva M, Trajkovski M, Sannohe Y, Ma’ani Hessari N, Sugiyama H, Plavec J. Design of a G-quadruplex topology through glycosidic bond angles. Angewandte Chemie International Edition. 2009;48(48):9167–9170. [PubMed]
38. Hazel P, Parkinson GN, Neidle S. Predictive modelling of topology and loop variations in dimeric DNA quadruplex structures. Nucleic Acids Research. 2006;34(7):2117–2127. [PMC free article] [PubMed]
39. Smargiasso N, Rosu F, Hsia W, et al. G-quadruplex DNA assemblies: loop length, cation identity, and multimer formation. Journal of the American Chemical Society. 2008;130(31):10208–10216. [PubMed]
40. Breslauer KJ. Extracting thermodynamic data from equilibrium melting curves for oligonucleotide order-disorder transitions. Methods in Enzymology. 1995;259:221–242. [PubMed]
41. Mergny J-L, Phan A-T, Lacroix L. Following G-quartet formation by UV-spectroscopy. FEBS Letters. 1998;435(1):74–78. [PubMed]

Articles from Journal of Nucleic Acids are provided here courtesy of Hindawi Publishing Corporation