To confirm the genomic complexity of the β subunit of mouse CP, Southern blots of mouse genomic DNA were cleaved with several restriction enzymes and independently probed with mouse β1 and β2 cDNAs. The β1 and β2 probes each hybridized to one identical band. To obtain genomic clones that correspond to this pattern, a 129SV genomic library in the lambda FIXII vector (Stratagene) was screened using the complete β1 cDNA as probe. Positive plaques were purified according to standard procedures [
7] and the phage DNA isolated using DEAE-cellulose [
8]. Comparison of the hybridization pattern for the genomic clones with the mouse genomic DNA revealed that the patterns were identical, confirming the presence of a single β gene in the mouse genome.
In chicken, the β1 and β2 isoforms have been described as the differentially spliced products of a single gene, with the β1 cDNA containing a 113 bp exon that is absent in the β2 cDNA [
4]. To determine if the murine β2 isoform is spliced in a manner identical to that of chicken, the sequence of the β2 cDNA was compared to the corresponding genomic region. Sequence comparison revealed that alternative splicing of the β2 gene occurs in an identical manner in mice. The mouse intron is also 113 bp in length with the exon sequence and surrounding intron sequence containing the canonical splice donor (AGA) and acceptor (AGG) sites at either end of the intron. The human gene for CPβ has a similar structure, based on the sequence of clone HS657E11, located at Chr1 p35.1-p36.23, from the Sanger Centre (
http://www.sanger.ac.uk/HGP/Chr1/).
To determine the chromosomal location of marine
Cappb1, we identified interspecies variations of genomic sequences and mapped their chromosomal locations using an interspecies backcross panel from Jackson Laboratory [
9]. The mapping panel is anchored to maps from crosses by various known genes, retroviral loci, and the
D#Mit loci. The strain distribution pattern of each polymorphism in the interspecific backcross was determined and used to position the
Cappb1 gene on the map (Figure ).
A region corresponding to the 3' UTR of the Cappb1 gene was PCR-amplified using parental genomic DNA and gene-specific primers (5'TTTTCCCTCTTCCTTTCC3' and 5'ACTCCAAGCAACTCCCACAC3'). Direct sequencing of the PCR product identified two polymorphisms: 1) Nucleotides 1220-1224 (referring to Genbank Acc. No. U10406), C57BL/6J: CCCCC; M. spretus: CCCC, 2) Nucleotides 1336 1349: C57BL/6J: GGTGTGTGA-GAGAA and M. spretus: GGTGTGTGAAAGAGAA. Genomic DNA from the panel of 94 backcross animals was PCR-amplified using the aforementioned primers and then hybridized via dotblot analysis with four oligonucleotides: 5'AAGGAAGGGGGACAGG3', 5'AAGGAAGGGGACAGG3', 5'CTCTCACACA3', 5'CCACACACTTTCTCTT3', which specifically bound to each of the four polymorphic sequences, respectively. The resulting allele patterns were compared to those of other loci previously mapped in this cross to detect linkage.
The CPβ gene (Cappb1) mapped to Chromosome 4 between D4Mitl6 and D4Mit13. Additional linkage information is available at http://www.jax.org./resources/documents/cmdata. Mouse Genome Database accession numbers for the mapping data are J:55295 (Cappb1). The order of loci (with recombination distances in centimorgans, cM and standard error) and intergenic distances for the CPβ gene (Figure and ) is as follows: Cappb1: Nearby genes include Cdc42 and Afar. D4Mit339- (1.06 ± 1.06 cM) -D4Bwg0593e- (1.06 ± 1.06 cM) -Cdc42- (1.06 ± 1.06 cM) -Afar, Cappb1- (4.25 ± 2.08 cM)- D4Mit312.
To determine if the Cappb1 gene was equivalent to a locus that had previously been mapped thereby identifying a possible association with an existing mutant, the Jackson Laboratory Mouse Genome Database (MGD) and the Mouse Chromosome Committee Report (1999) were scanned for loci that lie within 10 cM of the map positions of Cappb1. snubnose (sn), curly tail (ct), and cribriform degeneration (cri) are candidate mutants for Cappb1.
The likelihood that
Cappb1 and
sno, ct and
cri map to the same position was evaluated by determining the confidence intervals associated with their map positions (Figure ).
Cappb1 (66.8 cM, MGD) was mapped relative to the well-established anchoring locus
D4Mitl3 (71 cM, MGD), with 5 recombinants in 94 backcross samples. At 95% confidence, the upper and lower limits are 2.5 and 12.5, respectively [
10].
sno (58.3 cM, MGD) was mapped relative to tyrosinase related protein,
Tyrp1, (39 cM, MGD) with 92 recombinants in 535 backcross animals providing confidence limits of 14 and 20.5 [
11].
cri (69 cM, MGD) was mapped relative to
Tyrp1, but raw mapping data were not reported, which precludes determination of the confidence limits [
12].
ct (69 cM) was mapped relative to
D4Mitl3 with 26 recombinants in 272 backcross animals providing confidence limits of 6.6 and 13.7. The confidence intervals of
ct and
Cappb1 overlap, indicating that equivalency of these loci are not ruled out by the mapping data. Because the confidence interval of the mapping of
cri could not be determined, the equivalency of
cri and
Cappb1 cannot be ruled out. The confidence intervals of
sno and
Cappb1 do not overlap, indicating that these loci are not equivalent.
Analysis of the mutant phenotype for
cri and
ct is a way to evaluate their potential roles. Mutations in
cri have a severe neurological defect that can be traced to vacuolar degeneration in white and gray matter of the spinal cord and brainstem [
13]. Mutations in
ct have some degree of spina bifida which results in a curly tail and occasionally, exencephaly [
14]. Mutations in
sno are recognized by their short noses and have spina bifida occulta in their lumbar, posterior thoracic and sacral vertebrae [
15]. Additional studies will be necessary to determine whether these loci encode or map to
Cappb1.
Comparative gene mapping between mouse and human has revealed numerous regions of homologous genome organization [
16]. The mapping of
Cappb1 supports the evolutionary conservation between the two species. The chromosomal assignment of the mouse CPβ gene to Chromosome 4 is consistent with the localization of the human CPβ gene to chromosome 1 position p36.1. These regions of the mouse and human chromosomes have conserved synteny.
2 Yulia O Korshunova,
