PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of glycobLink to Publisher's site
 
Glycobiology. 2010 August; 20(8): 976–981.
Published online 2010 March 31. doi:  10.1093/glycob/cwq054
PMCID: PMC2902283

Lysosome-associated membrane protein 1 is a major SSEA-1-carrier protein in mouse neural stem cells

Abstract

Stage-specific embryonic antigen-1 (SSEA-1) is a well-known carbohydrate antigenic epitope of undifferentiated cells, including neural stem cells (NSCs). However, the exact nature of the carrier proteins has not been fully characterized. Using proteomics analyses, we herein report that a lysosomal protein, LAMP-1, is a major carrier protein of SSEA-1 in NSCs, despite the common belief that SSEA-1 is mainly expressed on the cell surface and constitutes a component of the extracellular matrix. Furthermore, we found that SSEA-1 on LAMP-1 is completely ablated in differentiated cells derived from NSCs. Our finding raises the possibility that the expression of SSEA-1-positive LAMP-1 is associated with the “stemness” of NSCs.

Keywords: development, LAMP-1, N-glycosylation, neural stem cell, SSEA-1

Introduction

Neural stem cells (NSCs) are undifferentiated neural cells characterized by their high proliferative potential and the capacity for self-renewal with retention of multipotency to differentiate into neurons and glial cells. NSCs have been isolated from basal forebrain (Temple 1989), cerebral cortex (Davis and Temple 1994), hippocampus (Johe et al. 1996) and spinal cord (Kalyani et al. 1997) in embryos as well as in the subventricular zone of lateral ventricles (Doetsch et al. 1999; Nakatani et al. 2010) and hippocampal dentate gyrus (Seri et al. 2001) in adult brains. To identify and isolate NSCs in these regions, certain marker molecules, such as nestin (Lendahl et al. 1990), Sox2 (Zappone et al. 2000), CD133 (prominin-1) (Uchida et al. 2000), stage-specific embryonic antigen-1 (SSEA-1) (Klassen et al. 2001; Capela and Temple 2002), CD24a, peanut agglutinin ligand (Rietze et al. 2001), Musashi-1 (Sakakibara et al. 2002), syndecan-1, Notch-1, β1 integrin (Nagato et al. 2005), biantennary complex-type N-glycans recognized by Phaseolus vulgaris erythroagglutinating lectin (Hamanoue et al. 2009) and GD3 ganglioside (Nakatani et al. 2010), have been utilized. Most of these NSC marker molecules are glycoconjugates, including glycoproteins, glycolipids and proteoglycans, that are expressed on the cell surface. In NSCs, glycoconjugates serve as excellent biomarkers at various stages of cellular differentiation and also play important functional roles in determining cell fate such as self-renewal, proliferation and differentiation (Yanagisawa and Yu 2007).

The carbohydrate antigen, SSEA-1 [Galβ1-4(Fucα1-3)GlcNAcβ-], is a well-known stage-specific marker of undifferentiated cells, including mouse embryonic stem cells (Muramatsu T and Muramatsu H 2004). SSEA-1 is also expressed in human embryonic NSCs (Klassen et al. 2001) and mouse embryonic, postnatal and adult NSCs (Klassen et al. 2001; Capela and Temple 2002; Kim and Morshead 2003; Yanagisawa et al. 2005). Because of its expression pattern and cell-surface localization, SSEA-1 has been widely used as a marker molecule to isolate NSC populations from mouse brains by fluorescence-activated cell sorting (Capela and Temple 2002; Kim and Morshead 2003; Corti et al. 2005). So far, the SSEA-1 epitope in NSCs has been found to be associated with a glycosphingolipid (Yanagisawa et al. 2005), chondroitin sulfate proteoglycans (Kabos et al. 2004) and glycoproteins including β1 integrin (Yanagisawa et al. 2005) and Wnt-1 (Capela et al. 2006). However, since the identification of these molecules was performed by immunocytochemical analysis using specific antibodies, bona fide carrier molecules of SSEA-1 in NSCs have not yet been biochemically identified. Herein, we identified a major SSEA-1-carrier protein in NSCs by proteomic analysis based on mass spectrometry (MS). Unexpectedly this SSEA-1-positive protein was a lysosomal protein, although it had been considered that SSEA-1 is expressed primarily as a cell-surface marker molecule. This is the first study to positively identify an SSEA-1-carrier protein expressed in stem cells.

Results

Detection of a glycoprotein carrying SSEA-1 in NSCs

NSCs were isolated from the striata of mouse embryos (embryonic day 14.5) via neurospheres, floating aggregates formed by NSCs in vitro (Reynolds and Weiss 1992; Nakatani et al. 2010). To detect glycoproteins carrying SSEA-1 in NSCs, we performed western blot analysis using AK97 mouse monoclonal antibody (Yanagisawa et al. 1999). AK97 was originally established for a spirometo-series parasitic glycosphingolipid having a characteristic trisaccharide structure [Galβ1-4(Fucα1-3)Glcβ-] (Kawakami et al. 1993) but strongly reacts also with SSEA-1 (Yanagisawa et al. 1999). Because this parasitic trisaccharide structure is not expressed in mammals, AK97 can specifically detect glycoproteins carrying SSEA-1 in mouse NSCs. In addition to a few minor bands, one major protein band reactive with AK97 anti-SSEA-1 antibody, corresponding to an apparent molecular mass 80 kDa (Figure 1), was detected in the lysates of NSCs (lanes 1, 3, 5 of Figure 1). However, this band completely disappeared in the lysates of cells differentiated from NSCs (lanes 2, 4, 6 of Figure 1). This major SSEA-1-carrier protein, with the molecular mass 80 kDa, expressed in NSCs, was further analyzed.

Fig. 1
Detection of SSEA-1-carrier proteins in NSCs and differentiated cells. Proteins from primary (lane 1), secondary (lane 3) and tertiary (lane 5) neurospheres and cells differentiated from primary (lane 2), secondary (lane 4) and tertiary (lane 6) neurospheres ...

Identification of a glycoprotein carrying SSEA-1 in NSCs

To isolate this SSEA-1-carrier protein, SSEA-1-positive immunoprecipitates prepared from secondary neurospheres with an anti-SSEA-1 monoclonal antibody, AK97, were subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and followed by staining with Coomassie Brilliant Blue G-250. A piece of the polyacrylamide gel containing the 80 kDa protein was excised, digested with trypsin and then subjected to liquid chromatography (LC)-MS/MS analysis. The data indicated that the 80 kDa protein positive for SSEA-1 is lysosome-associated membrane protein 1 (LAMP-1) (Figure 2A). For confirmation, SSEA-1-carrier proteins in NSCs were immunoprecipitated with AK97 and analyzed by western blot with an anti-LAMP-1 antibody. As shown in Figure 2B (left panel), LAMP-1 was clearly detected in SSEA-1-positive immunoprecipitates. These SSEA-1-positive LAMP-1 (Figure 2B, left panel) and control LAMP-1 in lysates detected by the anti-LAMP-1 antibody (Figure 2B, right panel) had a molecular mass of 80 kDa, identical to that of the major SSEA-1-carrier protein in Figure 1. Furthermore, to determine whether the SSEA-1 epitope on LAMP-1 is carried by N- or O-glycans, the cell lysates from NSCs were treated with peptide N-glycanase F (PNGase F) and then analyzed by western blot with AK97 and anti-LAMP-1 antibodies. After PNGase F treatments, the 80 kDa protein band reactive with AK97 disappeared (Figure 2C, left panel). Likewise, the protein band reactive with anti-LAMP-1 antibody corresponding to the 80 kDa protein disappeared and a new band with a molecular mass of 40 kDa appeared (Figure 2C, center panel). These data clearly indicate that LAMP-1 is highly N-glycosylated with the SSEA-1 epitope.

Fig. 2
LAMP-1 as an SSEA-1-carrier protein. LAMP-1 was identified as a major SSEA-1-carrier protein by LC-MS/MS analysis after enrichment by immunoprecipitation with AK97 antibody. (A) Amino acid sequence of LAMP-1. The sequences of observed peptides are underlined. ...

Localization of SSEA-1 in NSCs

To evaluate the localization of SSEA-1 in NSCs, we stained NSCs prepared from neurospheres with the AK97 anti-SSEA-1 antibody. As shown in Figure 3, SSEA-1 signals were found in intact NSCs treated without 0.1% Triton X-100. The result indicates that SSEA-1 is localized on the cell surface. However, in NSCs permeabilized with 0.1% Triton X-100, SSEA-1 signals were intensely detected. This result suggests that SSEA-1 is localized not only on the cell surface but also in the intracellular regions of NSCs. This result is consistent with the lysosomal localization of LAMP-1.

Fig. 3
Localization of SSEA-1 in NSCs. NSCs prepared from neurospheres were treated with PBS containing 3% fetal bovine serum and 0% or 0.1% Triton X-100 (Trx100) and then stained with AK97 and Alexa Fluor 488-conjugated antimouse IgM antibody (green). Nuclei ...

LAMP-1 expression in differentiated cells

Given that SSEA-1-carrying LAMP-1 was not expressed in cells differentiated from NSCs (Figure 1), we next examined the expression of LAMP-1 before and after differentiation. As shown in Figure 4A, LAMP-1 is similarly expressed in NSCs and cells differentiated from NSCs. This is consistent with the result of reverse transcription-polymerase chain reaction (RT-PCR) analysis indicating that the LAMP-1 mRNA level exhibited no changes during differentiation (Figure 4B). It has been reported that α1,3-fucosyltransferase IX (FUT9) is involved in the expression of SSEA-1 in rodent brains (Shimoda et al. 2002; Kudo et al. 2007). In the cells differentiated from NSCs, FUT9 was found to be downregulated; there was no significant difference in the expression levels of other fucosyltransferases, FUT4, FUT10 and FUT11, before and after differentiation (Figure 4B). Pax6 (paired box gene 6), a transcription factor which has been reported to regulate the expression of FUT9 in rat embryonic forebrain (Shimoda et al. 2002), was also decreased in the differentiated cells (Figure 4B). These results suggest that that the lack of SSEA-1-positive LAMP-1 molecules in the differentiated cells (Figure 1) is responsible for the downregulation of SSEA-1, but not of LAMP-1, probably via change of the glycosyltransferase expression level.

Fig. 4
LAMP-1 expressed in NSCs and differentiated cells. (A) Cell lysates from primary (lane 1), secondary (lane 3) and tertiary (lane 5) neurospheres and cells differentiated from primary (lane 2), secondary (lane 4) and tertiary (lane 6) neurospheres were ...

Discussion

In this study, we identified LAMP-1, a lysosomal membrane protein, as a major carrier protein of SSEA-1 in NSCs using LC-MS/MS and western blot analyses. LAMP-1 is known as a lysosomal marker. It is a highly N-glycosylated lysosomal membrane protein (Chen et al. 1985; Lewis et al. 1985) and has been suggested to involve in lysosome biogenesis and autophagy (Eskelinen 2006). LAMP-1 possesses 17 to 20 N-glycosylation sites as well as 5 O-glycosylation sites (Carlsson et al. 1993; Eskelinen et al. 2003). By PNGase F treatment, we demonstrated that SSEA-1 is carried by N-glycans (Figure 2C). N-glycans of LAMP-1 have been suggested to protect LAMP-1 from proteolytic digestion, because deglycosylation of LAMP-1 by endoglycosidase H led to its rapid degradation (Kundra and Kornfeld 1999). There is a possibility that SSEA-1 is also involved in this process.

SSEA-1 is also known as Lewis X, which plays important roles in cell–cell communication such as carbohydrate–protein and carbohydrate–carbohydrate interactions. It is generally considered that SSEA-1 is expressed on the cell surface or extracellular matrix in NSCs. Indeed, NSCs in brain tissues have been reported to be sorted by fluorescence-activated cell sorting using anti-SSEA-1 antibody (Capela and Temple 2002; Kim and Morshead 2003; Corti et al. 2005; Koso et al. 2006). Our proteomics data, however, revealed that SSEA-1 is mainly carried by a lysosomal protein, LAMP-1, in NSCs. This is the first identification of an intracellular molecule that serves as an SSEA-1-carrier in stem cells, including NSCs. In addition to mouse embryonic stem cells, LAMP-1 may also be a carrier protein of SSEA-1 in other SSEA-1-positive stem cells. In support of our contention, Brito et al. recently suspected that SSEA-1 might be attached to LAMP-1 in hippocampus cell cultures resulting from colocalization of SSEA-1 with LAMP-1 by immunofluorescence staining (Brito et al. 2009). Although it is necessary to perform further studies including elucidation of the function of SSEA-1 on LAMP-1 molecules, our finding has raised the possibility that expression of SSEA-1-positive LAMP-1 in NSCs is associated with the “stemness” of stem cells.

Materials and methods

NSC culture

NSCs were prepared from ICR mouse embryos (embryonic day 14.5) in the form of neurospheres according to previously described methods with slight modifications (Reynolds and Weiss 1992; Nakatani et al. 2010). To induce differentiation, the NSCs were cultured in Neurobasal-A medium containing B27, l-glutamine (Invitrogen, Carlsbad, CA) and 1% fetal bovine serum for 10 days. The ICR mice (Harlan, Indianapolis, IN) used in this study were treated in accordance with the guidelines of the Institutional Animal Care and Use Committee of the Medical College of Georgia.

Western blot analysis and immunoprecipitation

The lysates prepared from NSCs and cells differentiated from NSCs using lysate buffer (20 mM Tris–HCl, pH 7.6, 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid and 1% Triton X-100) were subjected to western blot analysis with AK97 (Yanagisawa et al. 1999), anti-LAMP-1 antibody (Cell Signaling Technology, Boston, MA) or anti-β-actin antibody (Sigma-Aldrich, St. Louis, MO) and horseradish peroxidase-conjugated antimouse IgM antibody (Jackson ImmunoResearch, West Grove, PA), antirabbit IgG antibody (GE Healthcare Life Sciences, Piscataway, NJ) or antimouse IgG antibody (GE Healthcare Life Sciences). The protein bands were visualized by Western Lightning Chemiluminescence Reagent (Perkin Elmer Life and Analytical Sciences, Waltham, MA). To remove N-glycans on glycoproteins, lysates containing 20 μg of proteins were incubated with PNGase F (50 units; New England BioLabs, Beverly, MA) at 37°C for 3 h before being subjected to SDS–PAGE.

For immunoprecipitation, the cell lysates were gently agitated in the presence of control antimouse IgM (BD Biosciences Pharmingen, San Diego, CA) or AK97 antibody for 1 h, followed by incubation with protein L-Sepharose (Pierce, Rockford, IL) at 4°C for 3 h. After washing three times with lysate buffer, immunoprecipitates were subjected to SDS–PAGE and then western blot analysis. AK97 or anti-LAMP-1 antibody was used as primary antibody.

Identification of glycoprotein by LC/MS/MS analyses

For LC-MS/MS analyses, glycoproteins were digested as described previously (Yagi et al. 2008). The resultant digested peptides were reconstituted in 0.1% formic acid and analyzed by a Thermo LTQ linear ion-trap mass spectrometer equipped with a nano-electrospray ionization (ESI) source and a Finnigan Surveyor LC system (Thermo Fisher Scientific, Waltham, MA). The peptides were directly infused into the ESI source through a reverse phase-C18 trap column equilibrated in 0.1% formic acid at a flow rate of 100 nL/min and were sequentially eluted with an acetonitrile gradient from 5 to 40% over 60 min. The spectrometer was operated in data-dependent mode using normalized collision energy of 35%. The temperature of the ion transfer tube was set at 200°C and the spray voltage was at 1.8 kV. MS analysis was performed with one full MS scan followed by five MS/MS scans on the five most intense ions from the MS spectrum. The resultant MS and MS/MS data were searched against NCBI mouse database using the TurboSequest algorithm in the Bioworks software 3.2.

Immunocytochemistry

NSCs prepared from neurospheres were plated onto chamber slides (Nalge Nunc International, Naperville, IL) coated with poly-l-ornithine (Sigma-Aldrich) and fibronectin (Sigma-Aldrich) and fixed in phosphate-buffered saline (PBS) containing 4% paraformaldehyde. The NSCs were treated with PBS containing 3% fetal bovine serum and 0% or 0.1% Triton X-100 for 2 h and then stained with AK97 and Alexa Fluor 488-conjugated antimouse IgM antibodies (Invitrogen). Nuclei were stained with 2 μg/mL of Hoechst 33258 (Sigma-Aldrich). The stained NSCs were photographed under a Nikon Eclipse TE300 fluorescent microscope (Nikon Instruments, Melville, NY) equipped with a Magnafire digital charge-coupled device camera (Optronics, Goleta, CA).

RT-PCR

RT-PCR was performed as previously described (Ngamukote et al. 2007; Nakatani et al. 2010). Total RNAs were isolated from cells using TRIzol reagent (Invitrogen). cDNAs were synthesized from the total RNAs as templates using SuperScript III reverse transcriptase (Invitrogen). PCR was performed with the following settings: 30 (for Pax6 and β-actin), 33 (for LAMP-1, FUT9, FUT10, FUT11 and Sox2) or 38 (for FUT4) cycles of 94°C for 10 s, 52–55°C for 30 s and 72°C for 30 s. The sequences of primers were as follows (5′–3′): TCTTCAGTGTGCAGGTCCAG and TGGACCAGAGATTCCCTTTG for LAMP-1; TTGACCACCTTCATCTGCTG and GTTGGATCGCTCCTGGAATA for FUT4; TTCGCCCATTTCTAATCGTC and TTGTGCTCACCGTCAAGAAG for FUT9; CATGAAGAGTCCCCCAAAAA and CCGCTGGTTAGAGATCTTGC for FUT10; AGGCATCACCAACCAGTTTC and TTCCCAATACAGGGCAAGAG for FUT11; CTGTACCAACGATAACATACCC and AGGAGTGTTGCTGGCCTGTC for Pax6; AACGCCTTCATGGTATGGTC and CCGGGAAGCGTGTACTTATC for Sox2; AGCCAT GTACGTAGCCATCC and TCTCAGCTGTGGTGGTGAAG for β-actin. The PCR products were analyzed by agarose gel electrophoresis using 2% agarose gels containing SYBR safe DNA Gel Stain (Invitrogen).

Acknowledgments

The authors are grateful to Drs. Kazuo Nakamura, Hisako Kojima (Kitasato University) and Yoichi Tamai (Tamai Kokoro Clinic and Kitasato University) for kindly providing the AK97 hybridoma cell line, Dr. Yoshihiko Nakatani for assisting in neural stem cell culture, Dr. Wenbo Zhi, MCG Proteomics and Mass Spectrometry Core Laboratory and Drs. Toshio Ariga and Chandramohan Wakade for technical assistance.

Conflict of interest statement

None declared.

Funding

This study was supported by United States Public Health Service grants (NS11853, NS26994), a grant from the Childrens' Medical Research Foundation, Chicago, IL to R.K.Y. and a start-up fund awarded to M.Y. from the Medical College of Georgia. H.Y. was supported by the Japan–US Brain Research Cooperative Program.

Abbreviations

ESI
electrospray ionization
FUT
fucosyltransferase
LAMP-1
lysosome-associated membrane protein 1
LC
liquid chromatography
MS
mass spectrometry
NSCs
neural stem cells
pax6
paired box gene 6
PNGase F
peptide N-glycanase F
RT-PCR
reverse transcription-polymerase chain reaction
SDS–PAGE
sodium dodecyl sulfate–polyacrylamide gel electrophoresis
SSEA-1
stage-specific embryonic antigen-1
SVZ
subventricular zone

References

  • Brito C, Danglot L, Galli T, Costa J. Subcellular localization of the carbohydrate Lewisx adhesion structure in hippocampus cell cultures. Brain Res. 2009;1287:39–46. [PubMed]
  • Capela A, Temple S. LeX/ssea-1 is expressed by adult mouse CNS stem cells, identifying them as nonependymal. Neuron. 2002;35:865–875. [PubMed]
  • Capela JP, Meisel A, Abreu AR, Branco PS, Ferreira LM, Lobo AM, Remiao F, Bastos ML, Carvalho F. Neurotoxicity of Ecstasy metabolites in rat cortical neurons, and influence of hyperthermia. J Pharmacol Exp Ther. 2006;316:53–61. [PubMed]
  • Carlsson SR, Lycksell PO, Fukuda M. Assignment of O-glycan attachment sites to the hinge-like regions of human lysosomal membrane glycoproteins lamp-1 and lamp-2. Arch Biochem Biophys. 1993;304:65–73. [PubMed]
  • Chen JW, Murphy TL, Willingham MC, Pastan I, August JT. Identification of two lysosomal membrane glycoproteins. J Cell Biol. 1985;101:85–95. [PMC free article] [PubMed]
  • Corti S, Locatelli F, Papadimitriou D, Donadoni C, Del Bo R, Fortunato F, Strazzer S, Salani S, Bresolin N, Comi GP. Multipotentiality, homing properties, and pyramidal neurogenesis of CNS-derived LeX(ssea-1)+/CXCR//9 stem cells. FASEB J. 2005;19:1860–1862. [PubMed]
  • Davis AA, Temple S. A self-renewing multipotential stem cell in embryonic rat cerebral cortex. Nature. 1994;372:263–266. [PubMed]
  • Doetsch F, Caille I, Lim DA, Garcia-Verdugo JM, Alvarez-Buylla A. Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell. 1999;97:703–716. [PubMed]
  • Eskelinen EL. Roles of LAMP-1 and LAMP-2 in lysosome biogenesis and autophagy. Mol Aspects Med. 2006;27:495–502. [PubMed]
  • Eskelinen EL, Tanaka Y, Saftig P. At the acidic edge: Emerging functions for lysosomal membrane proteins. Trends Cell Biol. 2003;13:137–145. [PubMed]
  • Hamanoue M, Matsuzaki Y, Sato K, Okano HJ, Shibata S, Sato I, Suzuki S, Ogawara M, Takamatsu K, Okano H. Cell surface N-glycans mediated isolation of mouse neural stem cells. J Neurochem. 2009;110:1575–1584. [PubMed]
  • Johe KK, Hazel TG, Muller T, Dugich-Djordjevic MM, McKay RD. Single factors direct the differentiation of stem cells from the fetal and adult central nervous system. Genes Dev. 1996;10:3129–3140. [PubMed]
  • Kabos P, Matundan H, Zandian M, Bertolotto C, Robinson ML, Davy BE, Yu JS, Krueger RC., Jr Neural precursors express multiple chondroitin sulfate proteoglycans, including the lectican family. Biochem Biophys Res Commun. 2004;318:955–963. [PubMed]
  • Kalyani A, Hobson K, Rao MS. Neuroepithelial stem cells from the embryonic spinal cord: Isolation, characterization, and clonal analysis. Dev Biol. 1997;186:202–223. [PubMed]
  • Kawakami Y, Nakamura K, Kojima H, Suzuki M, Inagaki F, Suzuki A, Sonoki S, Uchida A, Murata Y, Tamai Y. A novel fucosylated glycosphingolipid with a Galβ1-4Glcβ1-3Gal sequence in plerocercoids of the parasite, Spirometra erinacei. J Biochem. 1993;114:677–683. [PubMed]
  • Kim M, Morshead CM. Distinct populations of forebrain neural stem and progenitor cells can be isolated using side-population analysis. J Neurosci. 2003;23:10703–10709. [PubMed]
  • Klassen H, Schwartz MR, Bailey AH, Young MJ. Surface markers expressed by multipotent human and mouse neural progenitor cells include tetraspanins and non-protein epitopes. Neurosci Lett. 2001;312:180–182. [PubMed]
  • Koso H, Ouchi Y, Tabata Y, Aoki Y, Satoh S, Arai K, Watanabe S. SSEA-1 marks regionally restricted immature subpopulations of embryonic retinal progenitor cells that are regulated by the Wnt signaling pathway. Dev Biol. 2006;292:265–276. [PubMed]
  • Kudo T, Fujii T, Ikegami S, Inokuchi K, Takayama Y, Ikehara Y, Nishihara S, Togayachi A, Takahashi S, Tachibana K, et al. Mice lacking α1, 3-fucosyltransferase IX demonstrate disappearance of Lewis x structure in brain and increased anxiety-like behaviors. Glycobiology. 2007;17:1–9. [PubMed]
  • Kundra R, Kornfeld S. Asparagine-linked oligosaccharides protect Lamp-1 and Lamp-2 from intracellular proteolysis. J Biol Chem. 1999;274:31039–31046. [PubMed]
  • Lendahl U, Zimmerman LB, McKay RD. CNS stem cells express a new class of intermediate filament protein. Cell. 1990;60:585–595. [PubMed]
  • Lewis V, Green SA, Marsh M, Vihko P, Helenius A, Mellman I. Glycoproteins of the lysosomal membrane. J Cell Biol. 1985;100:1839–1847. [PMC free article] [PubMed]
  • Muramatsu T, Muramatsu H. Carbohydrate antigens expressed on stem cells and early embryonic cells. Glycoconj J. 2004;21:41–45. [PubMed]
  • Nagato M, Heike T, Kato T, Yamanaka Y, Yoshimoto M, Shimazaki T, Okano H, Nakahata T. Prospective characterization of neural stem cells by flow cytometry analysis using a combination of surface markers. J Neurosci Res. 2005;80:456–466. [PubMed]
  • Nakatani Y, Yanagisawa M, Suzuki Y, Yu RK. Characterization of GD3 ganglioside as a novel biomarker of mouse neural stem cells. Glycobiology. 2010;20:78–86. [PMC free article] [PubMed]
  • Ngamukote S, Yanagisawa M, Ariga T, Ando S, Yu RK. Developmental changes of glycosphingolipids and expression of glycogenes in mouse brains. J Neurochem. 2007;103:2327–2341. [PubMed]
  • Reynolds BA, Weiss S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science. 1992;255:1707–1710. [PubMed]
  • Rietze RL, Valcanis H, Brooker GF, Thomas T, Voss AK, Bartlett PF. Purification of a pluripotent neural stem cell from the adult mouse brain. Nature. 2001;412:736–739. [PubMed]
  • Sakakibara S, Nakamura Y, Yoshida T, Shibata S, Koike M, Takano H, Ueda S, Uchiyama Y, Noda T, Okano H. RNA-binding protein Musashi family: Roles for CNS stem cells and a subpopulation of ependymal cells revealed by targeted disruption and antisense ablation. Proc Natl Acad Sci U S A. 2002;99:15194–15199. [PubMed]
  • Seri B, Garcia-Verdugo JM, McEwen BS, Alvarez-Buylla A. Astrocytes give rise to new neurons in the adult mammalian hippocampus. J Neurosci. 2001;21:7153–7160. [PubMed]
  • Shimoda Y, Tajima Y, Osanai T, Katsume A, Kohara M, Kudo T, Narimatsu H, Takashima N, Ishii Y, Nakamura S, et al. Pax6 controls the expression of Lewis x epitope in the embryonic forebrain by regulating α1, 3-fucosyltransferase IX expression. J Biol Chem. 2002;277:2033–2039. [PubMed]
  • Temple S. Division and differentiation of isolated CNS blast cells in microculture. Nature. 1989;340:471–473. [PubMed]
  • Uchida N, Buck DW, He D, Reitsma MJ, Masek M, Phan TV, Tsukamoto AS, Gage FH, Weissman IL. Direct isolation of human central nervous system stem cells. Proc Natl Acad Sci U S A. 2000;97:14720–14725. [PubMed]
  • Yagi H, Nakagawa M, Takahashi N, Kondo S, Matsubara M, Kato K. Neural complex-specific expression of xylosyl N-glycan in Ciona intestinalis. Glycobiology. 2008;18:145–151. [PubMed]
  • Yanagisawa M, Kojima H, Kawakami Y, Iriko H, Nakamura T, Nakamura K, Uchida A, Murata Y, Tamai Y. A monoclonal antibody against a glycolipid SEGLx from Spirometra erinaceieuropaei plerocercoid. Mol Biochem Parasitol. 1999;102:225–235. [PubMed]
  • Yanagisawa M, Taga T, Nakamura K, Ariga T, Yu RK. Characterization of glycoconjugate antigens in mouse embryonic neural precursor cells. J Neurochem. 2005;95:1311–1320. [PubMed]
  • Yanagisawa M, Yu RK. The expression and functions of glycoconjugates in neural stem cells. Glycobiology. 2007;17:57–74. [PubMed]
  • Zappone MV, Galli R, Catena R, Meani N, De Biasi S, Mattei E, Tiveron C, Vescovi AL, Lovell-Badge R, Ottolenghi S, et al. Sox2 regulatory sequences direct expression of a β-geo transgene to telencephalic neural stem cells and precursors of the mouse embryo, revealing regionalization of gene expression in CNS stem cells. Development. 2000;127:2367–2382. [PubMed]

Articles from Glycobiology are provided here courtesy of Oxford University Press