PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of glycobLink to Publisher's site
 
Glycobiology. Jul 2010; 20(7): 824–832.
Published online Mar 22, 2010. doi:  10.1093/glycob/cwq036
PMCID: PMC2900897
Molecular characterization of the cis-prenyltransferase of Giardia lamblia
Kariona A Grabińska,2 Jike Cui,2 Aparajita Chatterjee,2 Ziqiang Guan,3 Christian R H Raetz,3 Phillips W Robbins,2 and John Samuelson1,2
2Department of Molecular and Cell Biology, Boston University Goldman School of Dental Medicine, Boston, MA 02118, USA
3Department of Biochemistry, Duke University Medical Center, Durham, NC 27710, USA
1To whom correspondence should be addressed: Tel: +-1-617-414-1054; email: jsamuels/at/bu.edu
Received January 5, 2010; Revised March 5, 2010; Accepted March 7, 2010.
Giardia lamblia, the protist that causes diarrhea, makes an Asn-linked-glycan (N-glycan) precursor that contains just two sugars (GlcNAc2) attached by a pyrophosphate linkage to a polyprenol lipid. Because the candidate cis-prenyltransferase of Giardia appears to be more similar to bacterial enzymes than to those of most eukaryotes and because Giardia is missing a candidate dolichol kinase (ortholog to Saccharomyces cerevisiae SEC59 gene product), we wondered how Giardia synthesizes dolichol phosphate (Dol-P), which is used to make N-glycans and glycosylphosphatidylinositol (GPI) anchors. Here we show that cultured Giardia makes an unsaturated polyprenyl pyrophosphate (dehydrodolichol), which contains 11 and 12 isoprene units and is reduced to dolichol. The Giardia cis-prenyltransferase that we have named Gl-UPPS because the enzyme primarily synthesizes undecaprenol pyrophosphate is phylogenetically related to those of bacteria and Trypanosoma rather than to those of other protists, metazoans and fungi. In transformed Saccharomyces, the Giardia cis-prenyltransferase also makes a polyprenol containing 11 and 12 isoprene units and supports normal growth, N-glycosylation and GPI anchor synthesis of a rer2Δ, srt1Δ double-deletion mutant. Finally, despite the absence of an ortholog to SEC59, Giardia has cytidine triphosphate-dependent dolichol kinase activity. These results suggest that the synthetic pathway for Dol-P is conserved in Giardia, even if some of the important enzymes are different from those of higher eukaryotes or remain unidentified.
Keywords: cis-prenyltransferase, dolichol, Giardia, recombinant expression, Saccharomyces
Giardia lamblia, which is spread by the fecal–oral route, is an important parasitic cause of diarrhea in developing and developed countries (Adam 2001; Savioli et al. 2006). Giardia is remarkable for the presence of two similar nuclei and a genome that contains a large number of genes obtained from bacteria by lateral gene transfer (LGT) (Andersson et al. 2003; Franzén et al. 2009; Morrison et al. 2007).
In this report, we describe Giardia enzymes that synthesize dolichol phosphate (Dol-P), which is used to make an unusually short N-glycan precursor (dolichol pyrophosphate-GlcNAc2) and to make dolichol phosphate mannose (Dol-P-Man) (Helenius and Aebi 2004; Samuelson et al. 2005). While many eukaryotes use Dol-P-Man to make N-glycan precursors, O-linked glycans and glycosylphosphatidylinositol (GPI) anchors, Giardia only uses Dol-P-Man to make GPI anchors (Das et al. 1991; Orlean 1990; Samuelson et al. 2005).
Eukaryotic cis-prenyltransferases, which are encoded by RER2 and SRT1 genes of Saccharomyces cerevisiae, use farnesyl pyrophosphate (FPP) and numerous isopentenyl pyrophosphates (IPP) to make dehydrodolichyl pyrophosphate (Dedol-PP) (Figure 1) (Grabińska and Palamarczyk 2002; Sato et al. 1999, 2001). Dominant Dedol-PPs contain 11 isoprene units (e.g. Plasmodium, Leishmania and Trypanosoma), 16 isoprene units (e.g. S. cerevisiae Rer2p product and Trichomonas) or 19 isoprene units (e.g. S. cerevisiae Srt1p product and human) (Arruda et al. 2005; D'Alexandri et al. 2006; Grabińska et al. 2008; Löw et al. 1991; Swiezewska and Danikiewicz 2005). Dedol-PPs are subsequently dephosphorylated and then reduced to dolichol by a saturase, which has not yet been molecularly characterized (Fujii et al. 1982; Sagami et al. 1993). A cytidine triphosphate (CTP)-dependent dolichol kinase, encoded by the SEC59 gene of S. cerevisiae, converts dolichol to Dol-P (Heller et al. 1992). In bacteria, undecaprenol kinase activity is adenosine triphosphate (ATP)-dependent (Kalin and Allen 1979; Lis and Kuramitsu 2003).
Fig. 1
Fig. 1
Mapping of predicted Giardia enzymes onto the eukaryotic synthetic pathway for dolichol phosphate (Dol-P). Orthologs to Saccharomyces enzymes, which are present in Giardia (e.g. Rer2/Srt1, Alg7 and Dpm1) are marked in red. Saccharomyces Sec59, which appears (more ...)
Eubacteria and archaea have a cis-prenyltransferase, which makes Dedol-PP that contains 11 isoprene units (Kato et al. 1999). Like eukaryotes, archaea have a saturase that converts dehydrodolichol (Dedol) to dolichol (Burda and Aebi 1999). In contrast, eubacterial Dedol, which is used to make precursors for peptidoglycans and lipopolysaccharides, remains unsaturated (Touzé et al. 2008).
Because the candidate cis-prenyltransferase of Giardia appears to be more similar to bacterial enzymes than to most eukaryotic enzymes (see Results) and because Giardia is missing a candidate dolichol kinase (Sec59p homolog), we wondered whether Giardia synthesizes Dol-P in a manner similar to the rest of eukaryotes (Figure 1). For example, does the Giardia cis-prenyltransferase make Dedols with 11 isoprene units like those of bacteria? Does Giardia have an alternative saturase (marked in green in Figure 1), which converts Dedol-P to dolichol-P? Or does Giardia, like eubacteria, use Dedol-P for synthesis of polyprenol-linked glycans (e.g. Dedol-P-Man and Dedol-PP-GlcNAc) (alternative DPM1 and ALG7 gene products marked in blue in Figure 1)? Do Giardia membranes have CTP-dependent dolichol kinase activity, even though the parasite appears to lack a SEC59 ortholog (orange in Figure 1)?
Giardia makes in vivo a saturated polyprenol (dolichol) containing 11 (major) and 12 (minor) isoprene units
The starting point for these studies was a characterization of the cis-prenyltransferase activity of membranes isolated from cultured Giardia. Giardia membranes make an unsaturated polyprenyl (Dedol-11), which contains 11 isoprene units when incubated with radiolabeled IPP and exogenous FPP (Figure 2). Dedol-PP phosphatase and Dedol-P phosphatase activities are inferred, because Dedol is produced by the Giardia membranes. These results are consistent with the presence of candidate cis-prenyltransferase in Giardia (see next section) (Marchler-Bauer et al. 2005).
Fig. 2
Fig. 2
Thin layer chromatography (TLC) shows the Giardia undecaprenyl pyrophosphate synthase (Gl-UPPS), which closely resembles the bacterial UPPS (Supplement Figure 1 and see Figure 4 below) that makes a dominant polyprenol pyrophosphate with (more ...)
Mass spectroscopy of polyprenols of cultured Giardia also demonstrated dolichols with 11 and 12 isoprene units (Dol-11 and Dol-12) (Figure 3A). Using the same methods, dolichols with 14 to 17 isoprene units (Dol-14 to Dol-17) were identified in Saccharomyces. The presence of Dedol-11 and Dol-11 within Giardia argues against alternative pathways for synthesis of Dol-P, which are marked in green and blue in Figure 1. Instead it appears that Giardia is synthesizing Dol-P in the same way as other eukaryotes, even though Giardia is missing a dolichol kinase candidate (SEC59 ortholog marked in orange in Figure 1) and the Giardia cis-prenyltransferase resembles those of bacteria (next section).
Fig. 3
Fig. 3
Mass spectroscopy of the products of the Giardia cis-prenyltransferase (Gl-UPPS) reveals dolichols containing 11 and 12 isoprene units. (A) Dolichols extracted from Giardia trophozoites growing in axenic culture (without bacteria) include Dol-11 and Dol-12. (more ...)
Giardia cis-prenyltransferase resembles those of eubacteria and Trypanosoma
The predicted Giardia cis-prenyltransferase (encoded by GiardiaDB 50803_15256) is 265-amino acids long and shows a 42% identity and a 58% similarity to the Escherichia coli undecaprenyl pyrophosphate synthase (Ec-UPPS), which has been crystallized (see Supplemental Figure 1) (Guo et al. 2005). The Giardia cis-prenyltransferase, which we will refer to as Gl-UPPS because the protist synthesizes Dedol-PP with 11 isoprene units (Figure 2), contains five conserved domains that have been identified in other cis-prenyltransferases.
Phylogenetic analysis of representative eukaryotic and prokaryotic cis-prenyltransferases revealed three important findings (Figure 4). First, the vast majority of eukaryotic enzymes are present in a group (Clade 1), which is distinct from the group (Clade 2) that includes eubacteria and archaea. Second, Giardia, Trypanosoma, Leishmania and the chloroplast enzyme are also present with bacteria in Clade 2. The presence of a small number of eukaryotes in the bacterial clade is suggestive of LGT, which is a major force in the evolution of Giardia (Andersson et al. 2003; Franzén et al. 2009; Morrison et al. 2007). However, the same results could also be explained by secondary loss of the Clade 2 cis-prenyltransferase from the majority of eukaryotes. Previously, the diversity in the length of sugars present in N-glycan precursors has been shown to be secondary to loss of ALG enzymes from a common ancestor, which had a complete set (Samuelson et al. 2005).
Fig. 4
Fig. 4
The Giardia undecaprenyl pyrophosphate synthase (Gl-UPPS) resembles cis-prenyltransferases of eubacteria, archaea, Trypanosoma and plant chloroplast. In the phylogenetic tree, which was constructed by maximum likelihood methods, the branch lengths are (more ...)
Third, Entamoeba is the only eukaryote examined, which is missing a cis-prenyltransferase ortholog. Because the whole genomes of three different Entamoeba species have been separately sequenced (E. histolytica, E. dispar and E. invadens), the absence of a cis-prenyltransferase ortholog cannot be an artifact of the library construction (Loftus et al. 2005). This result suggests that either Entamoeba is synthesizing polyprenyls using an as yet to be identified enzyme, or Entamoeba is scavenging polyprenyls from the host.
In a Saccharomyces rer2Δ, srt1Δ double-deletion mutant,the Giardia cisprenyltransferase makes a polyprenol containing 11 and 12 isoprene units, and there is no defect in either N-glycan or GPI anchor synthesis
The Giardia cis-prenyltransferase (Gl-UPPS) complements a Saccharomyces rer2Δ, srt1Δ double-deletion mutant (Figure 5 and Table I). The necessity of the Gl-UPPS is shown by the absence of growth of rer2Δ, srt1Δ double-deletion mutant when the plasmid containing the Gl-UPPS gene is lost from yeast after treatment with 1% (w/v) 5-fluoroorotic acid (FOA). Gl-UPPS in the Saccharomyces rer2Δ, srt1Δ double-deletion mutant makes polyprenols and dolichols, which contain 11 and 12 isoprene units, as described for Giardia (Figures 2 and 3, respectively). We could detect no defect in N-glycosylation (using carboxypeptidase Y (CPY) as the reporter) (Supplemental Figure 2) or in GPI anchor synthesis (using glucanosyltransferase encoded by GAS1 (Gas1p) as the reporter) (Supplemental Figure 3). While there is induction of SRT1 mRNA in the Saccharomyces rer2Δ mutant, there is no induction of SRT1 mRNA when the Saccharomyces rer2Δ mutant is complemented by the Gl-UPPS gene (Supplemental Figure 4). There is, however, a mild increase in the synthesis of chitin (consistent with mild cell wall stress) in Saccharomyces rer2Δ, srt1Δ double-deletion mutant complemented with Gl-UPPS (Supplemental Figure 5).
Fig. 5
Fig. 5
Functional complementation of Saccharomyces rer2Δ, srt1Δ double-deletion mutant by the Giardia cis-prenyltransferase (Gl-UPPS). Wild-type yeast (BY4741), the rer2Δ deletion strain, the rer2Δ strain expressing Gl-UPPS or (more ...)
Table I
Table I
Yeast strains
When the Gl-UPPS with a histidine tag was expressed in E. coli, the recombinant protein, which was purified using a nickel column, made prenol-11-PP when incubated with radiolabeled IPP and exogenous FPP (Figure 2). This result suggests that the activity of the Gl-UPPS is not dependent upon accessory proteins.
Despite the absence of an ortholog to Saccharomyces SEC59, Giardia has a CTP-dependent dolichol kinase
Using the Saccharomyces Sec59p as a probe, we were able to identify candidate dolichol kinases from all eukaryotes examined with the exception of Giardia (Supplemental Figure 6). As whole genome sequences were examined from two different Giardia isolates (WB and GS), it is unlikely that the absence of a Giardia dolichol kinase ortholog is due to an artifact in library construction or sequencing (Franzén et al. 2009; Morrison et al. 2007). In addition, we were unable to find in Giardia orthologs to S. cerevisiae diacylglycerol kinase (Dgk1p) (Han et al. 2008), Arabidopsis thaliana phytol kinase (Valentin et al. 2006), Bacillus subtilis undecaprenol kinase or E. coli diacylglycerol kinase (Lis and Kuramitsu 2003). Indeed recent work clearly demonstrates that the purified E. coli bacA protein (homolog of B. subtilis undecaprenol kinase) exhibits undecaprenyl pyrophosphate phosphatase activity but not undecaprenol kinase activity (El Ghachi et al. 2004).
Nevertheless, Giardia membranes have CTP-dependent dolichol kinase activity, which is increased when exogenous dolichol is added (Figure 6). Giardia membranes have no ATP-dependent dolichol kinase activity, as has been described for the bacterial undecaprenol kinase (Kalin and Allen 1979; Lis and Kuramitsu 2003). Similarly, Giardia membranes have no uridine triphosphate (UTP)- or guanosine triphosphate (GTP)-dependent dolichol kinase activity in vitro. We conclude that Giardia either has a deeply divergent dolichol kinase, which was not detected using the Sec59p probe or Giardia has a unique dolichol kinase that does not share common ancestry with Sec59p. We cannot rule out the possibility that the Giardia dolichol kinase came from bacteria by LGT, but we have no evidence for this.
Fig. 6
Fig. 6
Despite the absence of an ortholog to Saccharomyces SEC59, Giardia has a CTP-dependent dolichol kinase. Membranes isolated from Giardia and Saccharomyces were incubated and radiolabeled with [γ32P]CTP +-//0− exogenous dolichol containing (more ...)
Discussion
Major conclusions include the following:
  • The synthetic pathway for Dol-P is conserved in Giardia, even if some of the important enzymes are different from those of higher eukaryotes (e.g. cis-prenyltransferase) or remain unidentified (e.g. dolichol kinase). We ruled out the possibility that Giardia uses Dedols (as described in eubacteria) rather than dolichols, and our data suggests that the saturase of Giardia acts on Dedol, as described in higher eukaryotes (Kato et al. 1999).
  • The Giardia cis-prenyltransferase (Gl-UPPS), which closely resembles the undecaprenyl pyrophosphate synthase of bacteria, also makes polyprenyl pyrophosphate with 11 isoprene units. Similarly, Trypanosoma, which makes a polyprenol with 11 isoprene units (Löw et al. 1991), has a cis-prenyltransferase that closely resembles the undecaprenyl pyrophosphate synthase of bacteria. These results suggest the possibility that the length of the polyprenol chain may be predicted by the ancestry of the cis-prenyltransferase (Clade 1 in Figure 4 are long, while Clade 2 are short). An exception to this generalization is Plasmodium, which has a Clade 1 cis-prenyltransferase but makes a polyprenol with just 11 isoprene units (D'Alexandri et al. 2006). Recent manipulations of the Micrococcus luteus cis-prenyltransferase have identified some of the active site amino acids important for determining the length of polyprenols (Kharel et al. 2006).
  • Gl-UPPS also makes polyprenols with 11 isoprene units in transformed Saccharomyces rer2Δ, srt1Δ double-deletion mutant, and there is no apparent defect in N-glycan synthesis or GPI anchor synthesis. It appears that, for the most part, dolichol kinases, Alg enzymes and Dol-P-Man synthases are not sensitive to the number of isoprene units present in their dolichols in vivo.
  • Despite the absence of a SEC59 ortholog in Giardia, the protist has a CTP-dependent dolichol kinase, as described in higher eukaryotes (Heller et al. 1992). Conversely, we were unable to identify a cis-prenyltransferase in Entamoeba.
Materials and methods
Giardia and Saccharomyces strains and growth conditions
Trophozoites of the first genome project WB strain of Giardia were grown axenically in TYI-S media supplemented with 10% serum and 1 mg/mL bile (Morrison et al. 2007). Giardia cells were chilled on ice for 20 min and then concentrated by centrifugation.
Saccharomyces strains used in this study, which include single deletion strains made on a BY4743 background that were obtained from Euroscarf, are listed in Table I (Brachmann et al. 1998). Yeasts were cultured in 2% (wt/vol) Bacto peptone and 1% (wt/vol) yeast extract supplemented with 2% glucose (wt/vol) (YPD, yeast peptone dextrose medium). Synthetic minimal media were made of 0.67% (wt/vol) yeast nitrogen base and 2% (wt/vol) glucose, supplemented with auxotrophic requirements. For solid media, agar (Difco, Voigt Global Distribution Inc, Lawrence, KS) was added at a 2% (wt/vol) final concentration. Sporulation of the diploid cells and tetrad dissection were performed by standard yeast genetic methods. Yeast cells were grown at 30°C and harvested at logarithmic growth phase (1 to 2 OD units/mL).
Methods to identify Giardia and Saccharomyces polyprenols
The dolichol fraction was isolated from membrane of Saccharomyces (10 mg of protein) and Giardia (40 mg of protein), as described (Grabińska et al. 2005) and subjected to analysis by liquid chromatography and mass spectrometry (LC-MS). To increase the amount of dolichol in the Giardia sample before separation of the lipids on the silica gel column, we treated prenyl phosphates with potato acid phosphatase, as described (Fujii et al. 1982).
LC/MS of lipids was performed using a Shimadzu LC system (comprising a solvent degasser, two LC-10A pumps and a SCL-10A system controller) coupled to a QSTAR XL quadrupole time-of-flight tandem mass spectrometer (as above). LC was operated at a flow rate of 200 μL/min with a linear gradient as follows: 100% of mobile phase A was held isocratically for 2 min and then linearly increased to 100% mobile phase B over 14 min and held at 100% B for 4 min. Mobile phase A consisted of methanol/acetonitrile/aqueous 1 mM ammonium acetate (60/20/20, v/v/v). Mobile phase B consisted of 100% ethanol containing 1 mM ammonium acetate. A Zorbax SB-C8 reversed-phase column (5 μm, 2.1 × 50 mm) was obtained from Agilent (Palo Alto, CA). The postcolumn splitter diverted +AH4-10% of the LC flow to the electrospray ionization source of the mass spectrometer.
The LC-MS results were compared with an in vitro cis-prenyltransferase assay performed as described (Szkopinska et al. 1997). Briefly, Saccharomyces or Giardia membranes were incubated with [1-14C] IPP (60 mCi/mmol) and exogenous FPP. Gl-UPPS activity was stimulated by the presence of 0.1% Triton X-100. The length of the Dedol product was determined by reverse-phase thin layer chromatography (TLC) using standards produced in vitro by BY4741 strain of Saccharomyces and commercially available undecaprenols (American Radiolabeled Chemicals, Inc., St Louis, MO). Giardia membranes were prepared according to procedures described for preparation of Trichomonas membranes (Grabińska et al. 2008).
To make recombinant Gl-UPPS and recombinant E. coli bacA undecaprenyl pyrophosphate phosphatase in E. coli, coding sequences of each were amplified with polymerase chain reaction (PCR) and cloned into the pET30a vector (EMD Biosciences-Novagen, Madison, WI) in such a way that each protein was tagged at the N-terminus with a polyhistidine-S-tag. pET30a vectors containing the Gl-UPPS or bacA genes were each transformed into E. coli Rosetta 2 cells (Novagen). E. coli in the logarithmic growth phase were induced to express heterologous protein by incubation with 1 mM isopropyl-β-d-thiogalactopyranoside for 4 h at 30°C. The harvested cells were lysed by sonication, and His-tagged proteins were purified on a nickel column according to the Invitrogen protocol (Gl-UPPS) or by published methods (El Ghachi et al. 2004). Protein purity was judged by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and western blotting using a monoclonal mouse antibody against the S tag.
The cis-prenyltransferase assay was done using 10 μg of Gl-UPPS, and Dedol-PP product was dephosphorylated with undecaprenyl pyrophosphate phosphatase, as described (El Ghachi et al. 2004). Products were separated by TLC on precoated plates of silica gel 60 (Merck) using diisobutyl ketone/acetic acid/water (8:5:1, v/v/v) as a mobile phase.
Bioinformatic methods
The predicted proteins of Giardia of the WB strain (first genome project) and GS strain (second genome project), which have been deposited in the non-redundant (NR) data at GenBank or GiardiaDB, were searched with Psi-Blast using cis-prenyltransferases (Rer2p and Srt1p) and dolichol kinase (Sec59p) sequences from Saccharomyces (Altschul et al. 1997; Aurrecoechea et al. 2008; Franzén et al. 2009; Heller et al. 1992; Morrison et al. 2007; Sato et al. 1999, 2001). Giardia proteins were also searched with B. subtilis undecaprenol kinase and E. coli diacylglycerol kinase (Lis and Kuramitsu 2003). Similar methods were used to search the predicted proteins of representative protists, metazoans, fungi, plants, eubacteria and archaea in the NR database at the National Center for Biotechnology Information (NCBI).
The single predicted cis-prenyltransferase of the WB strain of Giardia (GiardiaDB 50803_15256 or GenBank EDO82194) was examined for conserved domains using the CD search at the NCBI (Marchler-Bauer et al. 2005). The set of eukaryotic and prokaryotic cis-prenyltransferases was aligned using multiple sequence comparison by log-expectation (Edgar 2004). The alignment was manually refined, and gaps were removed using BioEdit. The finished alignment was used to construct the phylogenetic tree using TREE-PUZZLE, a program to reconstruct phylogenetic trees from molecular sequence data by the maximum likelihood method (Schmidt et al. 2002). Similar methods were used to draw the Sec59 tree.
Expression of Giardia cis-prenyltransferase in a Saccharomyces rer2Δ, srt1Δ double-deletion mutant
A Saccharomyces rer2Δ/RER2, srt1Δ/SRT1 double-deletion mutant (KG219) was made using a single Saccharomyces rer2Δ/RER2 deletion strain (Y23137) as a starting point. Briefly, deletion of SRT1 gene was accomplished using the plasmid pUG27 that carries the loxP-his5+-loxP gene disruption cassette (Gueldener et al. 2002). PCR primers used to target the srt1 gene were TTATAAAGAACAGGCTGCCTTTCAAACATAGGACGTTTCTGTTGACCATACAGCTGAAGCTTCGTCTTCGTACGC (sense) and TTCAGAATGTTCTTTGCCCTCTCTTGGGCTTTCTAGTTTTGCACTTTTACGCATAGGCCACTAGTGGATCTG (antisense). The pUG27-srt1 knock-out construct was transformed into Y23137 yeast cells. Transformants able to grow on medium lacking histidine and containing G418 were isolated, and the correct insertion of the deletion cassette was verified by PCR. The double heterozygous mutant rer2::kanMX4/RER2, srt1:: his3MX6loxP/SRT1 was called KG219.
The coding sequence of putative Giardia cis-prenyltransferase, which was fused to the EKKL ER-retention signal, was amplified from WB strain genomic DNA using two custom primers. The sense primer, which contained a HindIII restriction enzyme site in bold, was AAAAAGCTTATGATCCCCATGCATGTGGC. The antisense sequence, which contained a SalI restriction site in bold and encoded EKKLN in italic, was TTTGTCGACTCAATTCAACTTTTTTTCGTCATGGTTCGATAGGG. The PCR product was cloned into the pGEM-T Easy vector and sequenced (Promega, Madison, WI).
To express Giardia cis-prenyltransferase (Gl-UPPS) in the Saccharomyces cells, a NotI-surrendered insert was subcloned into the pNEV-N plasmid under the control of the PMA1 promoter and terminator (Sauer and Stolz 1994). The pNEV–Gl-UPPS plasmid was transformed into the KG219 yeast strain. Yeasts were sporulated, and colonies were selected that were resistant to G418 and able to grow on the medium lacking histidine. These yeasts, which express the Giardia cis-prenyltransferase in a Saccharomyces rer2Δ, srt1Δ double-deletion mutant, were labeled KG119. A single deletion mutant rer2Δ that expressed GL-UPPS was called KG120.
KG119 and its wild-type counterpart BY4741 were characterized in six ways. 1) Polyprenols were extracted and characterized by mass spectroscopy, as described above for Giardia. 2) Membranes were isolated and incubated with radiolabeled IPP and exogenous FPP, and radiolabeled Dedols were demonstrated by reverse-phase TLC, as described above. 3) The N-glycosylation status of carboxypeptidase (CPY) was determined by western blotting of Saccharomyces glycoproteins with antibodies to CPY (Molecular Probes, Eugene, OR) before or after peptide:N-glycanaseF treatment. A negative control was a Saccharomyces alg5Δ mutant (Heesen et al. 1994). 4) Maturation of the GPI anchors present on the Saccharomyces Gas1p (Gatti et al. 1994) was determined by western blotting of Saccharomyces glycoproteins with antibodies to Gas1p (kind gift of Laura Popolo). A negative control was a Saccharomyces gpi1 thermosensitive mutant (Leidich et al. 1994). 5) Expression of SRT1 mRNAs was measured in wild type versus Saccharomyces rer2Δ with or without the exogenous Gl-UPPS. 6) Cell wall stress was indirectly determined by measuring chitin levels (Popolo et al. 1997). Chitin content was measured by an assay adapted for microtiter plates, as described (Grabińska et al. 2007).
Dolichol kinase assay
CTP, GTP and UTP were synthesized enzymatically from cytidine diphosphate, guanosine diphosphate or uridine diphosphate and [γ-32P]ATP with nucleoside-5′-diphosphate kinase, as described (Han et al. 2008). The dolichol kinase assay was performed, as described (Heller et al. 1992). Membrane fractions (200 μg) were incubated in a total volume of 100 μL containing 0.05 M Tris–HCl (pH 7.5), 10 mM UTP, 100 mM CaCl2, 0.02–0.1 μCi [γ-32P]CTP in 0.1% Triton X-100 and 2 μg of dolichol mixture for 30 min at room temperature. Alternatively, [γ-32P]ATP or [γ-32P]GTP was used instead of [γ-32P]CTP. When [γ-32P]UTP substituted for [γ-32P]CTP, then 10 mM ATP was used instead of 10 mM UTP. Reactions were terminated by the addition of 750 μL of 1 M KOH in methanol, and alkali-labile lipids were hydrolyzed by incubation at 37°C for 30 min. This step is required to hydrolyze phosphatidic acid. The lipids were extracted by the Folch method, and the 32P incorporation into Dol-P was determined by scintillation counting.
Abbreviations
ATPadenosine triphosphate
CPYcarboxypeptidase Y
CTPcytidine triphosphate
Dedoldehydrodolichol
Dedol-PPdehydrodolichyl pyrophosphate
Dol-Pdolichol phosphate
Dol-P-Mandolichol phosphate mannose
FOA5-fluoroorotic acid
FPPfarnesyl pyrophosphate
Gas1pglucanosyltransferase encoded by GAS1
Gl-UPPSGiardia lamblia undecaprenol pyrophosphate synthase
GPIglycosylphosphatidylinositol
GTPguanosine triphosphate
IPPisopentenyl pyrophosphate
LC-MSliquid chromatography and mass spectrometry
LGTlateral gene transfer
NCBINational Center for Biotechnology Information
N-glycanAsn-linked-glycan
NRnon-redundant
PCRpolymerase chain reaction
TLCthin layer chromatography
UTPuridine triphosphate
YPDyeast peptone dextrose medium

Supplementary data
Supplementary data for this article is available online at http://glycob.oxfordjournals.org/.
Funding
National Institutes of Health grants AI048082 (to J.S.) and GM31318 (to P.W.R.). Z.G. and the mass spectrometry facility in the Department of Biochemistry, Duke University Medical Center were supported by a LIPID MAPS glue grant (GM-069338) from the National Institutes of Health.
Conflict of interest statement
None declared.
  • Adam RD. Biology of Giardia lamblia. Clin Microbiol Rev. 2001;14:447–475. [PMC free article] [PubMed]
  • Altschul SF, Madden TL, Schaffer AA, et al. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. [PMC free article] [PubMed]
  • Andersson JO, Sjögren AM, Davis LA, Embley TM, Roger AJ. Phylogenetic analyses of diplomonad genes reveal frequent lateral gene transfers affecting eukaryotes. Curr Biol. 2003;13:94–104. [PubMed]
  • Arruda DC, D'Alexandri FL, Katzin AM, Uliana SR. Anti-leishmanial activity of the terpene nerolidol. Antimicrob Agents Chemother. 2005;49:1679–1687. [PMC free article] [PubMed]
  • Aurrecoechea C, Brestelli J, Brunk BP, Carlton JM, Dommer J, Fischer S, Gajria B, Gao X, et al. GiardiaDB and TrichDB: Integrated genomic resources for the eukaryotic protist pathogens Giardia lamblia and Trichomonas vaginalis. Nucleic Acids Res. 2008;37:D526–D530. [PMC free article] [PubMed]
  • Brachmann CB, Davies A, Cost GJ, Caputo E, Li J, Hieter P, Boeke JD. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 1998;14:115–132. [PubMed]
  • Burda P, Aebi M. The dolichol pathway of N-linked glycosylation. Biochim Biophys Acta. 1999;1426:239–257. [PubMed]
  • Das S, Traynor-Kaplan A, Reiner DS, Meng TC, Gillin FD. A surface antigen of Giardia lamblia with a glycosylphosphatidylinositol anchor. J Biol Chem. 1991;266:21318–21325. [PubMed]
  • D'Alexandri FL, Kimura EA, Peres VJ, Katzin AM. Protein dolichylation in Plasmodium falciparum. FEBS Lett. 2006;580:6343–6348. [PubMed]
  • Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32:1792–1797. [PMC free article] [PubMed]
  • El Ghachi M, Bouhss A, Blanot D, Mengin-Lecreulx D. The bacA gene of Escherichia coli encodes an undecaprenyl pyrophosphate phosphatase activity. J Biol Chem. 2004;279:30106–30113. [PubMed]
  • Franzén O, Jerlström-Hultqvist J, Castro E, Sherwood E, Ankarklev J, Reiner DS, Palm D, Andersson JO, Andersson B, Svärd SG. Draft genome sequencing of Giardia intestinalis assemblage B isolate GS: is human giardiasis caused by two different species? PLoS Pathog. 2009;5:e1000560. [PMC free article] [PubMed]
  • Fujii H, Koyama T, Ogura K. Efficient enzymatic hydrolysis of polyprenyl pyrophosphates. Biochim Biophys Acta. 1982;712:716–718. [PubMed]
  • Fujihashi M, Zhang YW, Higuchi Y, Li XY, Koyama T, Miki K. Crystal structure of cis-prenyl chain elongating enzyme, undecaprenyl diphosphate synthase. Proc Natl Acad Sci USA. 2001;98:4337–4342. [PubMed]
  • Gatti E, Popolo L, Vai M, Rota N, Alberghina L. O-linked oligosaccharides in yeast glycosyl phosphatidylinositol-anchored protein gp115 are clustered in a serine-rich region not essential for its function. J Biol Chem. 1994;269:19695–19700. [PubMed]
  • Grabińska K, Palamarczyk G. Dolichol biosynthesis in the yeast Saccharomyces cerevisiae: An insight into the regulatory role of farnesyl diphosphate synthase. FEMS Yeast Res. 2002;2:259–265. [PubMed]
  • Grabińska KA, Ghosh SK, Guan Z, Cui J, Raetz CRH, Robbins PW, Samuelson J. Dolichyl-phosphate-glucose is used to make O-glycans on glycoproteins of Trichomonas vaginalis. EukaryotCell. 2008;7:1344–1351. [PMC free article] [PubMed]
  • Grabińska KA, Magnelli P, Robbins PW. Prenylation of Saccharomyces cerevisiae Chs4p affects chitin synthase III activity and chitin chain length. Eukaryot Cell. 2007;6:328–336. [PMC free article] [PubMed]
  • Grabińska K, Sosińska G, Orlowski J, Swiezewska E, Berges T, Karst F, Palamarczyk G. Functional relationships between the Saccharomyces cerevisiae cis-prenyltransferases required for dolichol biosynthesis. Acta Biochim Pol. 2005;52:221–232. [PubMed]
  • Gueldener U, Heinisch J, Koehler GJ, Voss D, Hegemann JH. A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Res. 2002;30:e23. [PMC free article] [PubMed]
  • Guo RT, Ko TP, Chen AP, Kuo CJ, Wang AH, Liang PH. Crystal structures of undecaprenyl pyrophosphate synthase in complex with magnesium, isopentenyl pyrophosphate, and farnesyl thiopyrophosphate: roles of the metal ion and conserved residues in catalysis. J Biol Chem. 2005;280:20762–20774. [PubMed]
  • Han GS, O'Hara L, Siniossoglou S, Carman GM. Characterization of the yeast DGK1-encoded CTP-dependent diacylglycerol kinase. J Biol Chem. 2008;283:20443–20453. [PubMed]
  • Heesen S, Lehle L, Weissmann A, Aebi M. Isolation of the ALG5 locus encoding the UDP-glucose:dolichyl-phosphate glucosyltransferase from Saccharomyces cerevisiae. Eur J Biochem. 1994;224:71–79. [PubMed]
  • Helenius A, Aebi M. Roles of N-linked glycans in the endoplasmic reticulum. Annu Rev Biochem. 2004;73:1019–1049. [PubMed]
  • Heller L, Orlean P, Adair WL., Jr Saccharomyces cerevisiae sec59 cells are deficient in dolichol kinase activity. Proc Natl Acad Sci USA. 1992;89:7013–7016. [PubMed]
  • Kalin JR, Allen CM., Jr Characterization of undecaprenol kinase from Lactobacillus plantarum. Biochim Biophys Acta. 1979;574:112–122. [PubMed]
  • Kato J, Fujisaki S, Nakajima K, Nishimura Y, Sato M, Nakano A. The Escherichia coli homologue of yeast RER2, a key enzyme of dolichol synthesis, is essential for carrier lipid formation in bacterial cell wall synthesis. J Bacteriol. 1999;181:2733–2738. [PMC free article] [PubMed]
  • Kharel Y, Takahashi S, Yamashita S, Koyama T. Manipulation of prenyl chain length determination mechanism of cis-prenyltransferases. FEBS J. 2006;273:647–657. [PubMed]
  • Leidich SD, Drapp DA, Orlean P. A conditionally lethal yeast mutant blocked at the first step in glycosyl phosphatidylinositol anchor synthesis. J Biol Chem. 1994;269:10193–10196. [PubMed]
  • Lis M, Kuramitsu HK. The stress-responsive dgk gene from Streptococcus mutans encodes a putative undecaprenol kinase activity. Infect Immun. 2003;71:1938–1943. [PMC free article] [PubMed]
  • Loftus B, Anderson I, Davies R, Alsmark UC, Samuelson J, Amedeo P, Roncaglia P, Berriman M, et al. The genome of the protist parasite Entamoeba histolytica. Nature. 2005;433:865–868. [PubMed]
  • Löw P, Dallner G, Mayor S, Cohen S, Chait BT, Menon AK. The mevalonate pathway in the bloodstream form of Trypanosoma brucei. Identification of dolichols containing 11 and 12 isoprene residues. J Biol Chem. 1991;266:19250–19257. [PubMed]
  • Marchler-Bauer A, Anderson JB, Cherukuri PF, et al. CDD: a conserved domain database for protein classification. Nucleic Acids Res. 2005;33:D192–D196. [PMC free article] [PubMed]
  • Morrison HG, McArthur AG, Gillin FD, Aley SB, Adam RD, Olsen GJ, Best AA, Cande WZ, Chen F, Cipriano MJ, et al. Genomic minimalism in the early diverging intestinal parasite Giardia lamblia. Science. 2007;317:1921–1926. [PubMed]
  • Orlean P. Dolichol phosphate mannose synthase is required in vivo for glycosyl phosphatidylinositol membrane anchoring, O mannosylation, and N glycosylation of protein in Saccharomyces cerevisiae. Mol Cell Biol. 1990;10:5796–5805. [PMC free article] [PubMed]
  • Popolo L, Gilardelli D, Bonfante P, Vai M. Increase in chitin as an essential response to defects in assembly of cell wall polymers in the ggp1delta mutant of Saccharomyces cerevisiae. J Bacteriol. 1997;179:463–469. [PMC free article] [PubMed]
  • Sagami H, Kurisaki A, Ogura K. Formation of dolichol from dehydrodolichol is catalyzed by NADPH-dependent reductase localized in microsomes of rat liver. J Biol Chem. 1993;268:10109–10113. [PubMed]
  • Samuelson J, Banerjee S, Magnelli P, Cui J, Kelleher DJ, Gilmore R, Robbins PW. The diversity of dolichol-linked precursors to Asn-linked glycans likely results from secondary loss of sets of glycosyltransferases. Proc Natl Acad Sci USA. 2005;102:1548–1553. [PubMed]
  • Sato M, Fujisaki S, Sato K, Nishimura Y, Nakano A. Yeast Saccharomyces cerevisiae has two cis-prenyltransferases with different properties and localizations. Implication for their distinct physiological roles in dolichol synthesis. Genes Cells. 2001;6:495–506. [PubMed]
  • Sato M, Sato K, Nishikawa S, Hirata A, Kato J, Nakano A. The yeast RER2 gene, identified by endoplasmic reticulum protein localization mutations, encodes cis-prenyltransferase, a key enzyme in dolichol synthesis. Mol Cell Biol. 1999;19:471–483. [PMC free article] [PubMed]
  • Sauer N, Stolz J. SUC1 and SUC2: two sucrose transporters from Arabidopsis thaliana; expression and characterization in baker's yeast and identification of the histidine-tagged protein. Plant J. 1994;6:67–77. [PubMed]
  • Savioli L, Smith H, Thompson A. Giardia and Cryptosporidium join the ‘Neglected Diseases Initiative’ Trends Parasitol. 2006;22:203–208. [PubMed]
  • Schmidt HA, Strimmer K, Vingron M, von Haeseler A. TREE-PUZZLE: maximum likelihood phylogenetic analysis using quartets and parallel computing. Bioinformatics. 2002;18:502–504. [PubMed]
  • Szkopinska A, Grabinska K, Delourme D, Karst F, Rytka J, Palamarczyk G. Polyprenol formation in the yeast Saccharomyces cerevisiae: effect of farnesyl diphosphate synthase overexpression. JLipid Res. 1997;38:962–968. [PubMed]
  • Swiezewska E, Danikiewicz W. Polyisoprenoids: structure, biosynthesis and function. Prog Lipid Res. 2005;44:235–258. [PubMed]
  • Touzé T, Tran AX, Hankins JV, Mengin-Lecreulx D, Trent MS. Periplasmic phosphorylation of lipid A is linked to the synthesis of undecaprenyl phosphate. Mol Microbiol. 2008;67:264–277. [PMC free article] [PubMed]
  • Valentin HE, Lincoln K, Moshiri F, Jensen PK, Qi Q, Venkatesh TV, Karunanandaa B, Baszis SR, Norris SR, Savidge B, et al. The Arabidopsis vitamin E pathway gene5-1 mutant reveals a critical role for phytol kinase in seed tocopherol biosynthesis. Plant Cell. 2006;18:212–224. [PubMed]
Articles from Glycobiology are provided here courtesy of
Oxford University Press