PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jbacterPermissionsJournals.ASM.orgJournalJB ArticleJournal InfoAuthorsReviewers
 
J Bacteriol. 2010 July; 192(13): 3503–3511.
Published online 2010 April 30. doi:  10.1128/JB.00054-10
PMCID: PMC2897652

A Bacillus anthracis S-Layer Homology Protein That Binds Heme and Mediates Heme Delivery to IsdC [down-pointing small open triangle]

Abstract

The sequestration of iron by mammalian hosts represents a significant obstacle to the establishment of a bacterial infection. In response, pathogenic bacteria have evolved mechanisms to acquire iron from host heme. Bacillus anthracis, the causative agent of anthrax, utilizes secreted hemophores to scavenge heme from host hemoglobin, thereby facilitating iron acquisition from extracellular heme pools and delivery to iron-regulated surface determinant (Isd) proteins covalently attached to the cell wall. However, several Gram-positive pathogens, including B. anthracis, contain genes that encode near iron transporter (NEAT) proteins that are genomically distant from the genetically linked Isd locus. NEAT domains are protein modules that partake in several functions related to heme transport, including binding heme and hemoglobin. This finding raises interesting questions concerning the relative role of these NEAT proteins, relative to hemophores and the Isd system, in iron uptake. Here, we present evidence that a B. anthracis S-layer homology (SLH) protein harboring a NEAT domain binds and directionally transfers heme to the Isd system via the cell wall protein IsdC. This finding suggests that the Isd system can receive heme from multiple inputs and may reflect an adaptation of B. anthracis to changing iron reservoirs during an infection. Understanding the mechanism of heme uptake in pathogenic bacteria is important for the development of novel therapeutics to prevent and treat bacterial infections.

Pathogenic bacteria need to acquire iron to survive in mammalian hosts (12). However, the host sequesters most iron in the porphyrin heme, and heme itself is often bound to proteins such as hemoglobin (14, 28, 85). Circulating hemoglobin can serve as a source of heme-iron for replicating bacteria in infected hosts, but the precise mechanisms of heme extraction, transport, and assimilation remain unclear (25, 46, 79, 86). An understanding of how bacterial pathogens import heme will lead to the development of new anti-infectives that inhibit heme uptake, thereby preventing or treating infections caused by these bacteria (47, 68).

The mechanisms of transport of biological molecules into a bacterial cell are influenced by the compositional, structural, and topological makeup of the cell envelope. Gram-negative bacteria utilize specific proteins to transport heme through the outer membrane, periplasm, and inner membrane (83, 84). Instead of an outer membrane and periplasm, Gram-positive bacteria contain a thick cell wall (59, 60). Proteins covalently anchored to the cell wall provide a functional link between extracellular heme reservoirs and intracellular iron utilization pathways (46). In addition, several Gram-positive and Gram-negative bacterial genera also contain an outermost structure termed the S (surface)-layer (75). The S-layer is a crystalline array of protein that surrounds the bacterial cell and may serve a multitude of functions, including maintenance of cell architecture and protection from host immune components (6, 7, 18, 19, 56). In bacterial pathogens that manifest an S-layer, the “force field” function of this structure raises questions concerning how small molecules such as heme can be successfully passed from the extracellular milieu to cell wall proteins for delivery into the cell cytoplasm.

Bacillus anthracis is a Gram-positive, spore-forming bacterium that is the etiological agent of anthrax disease (30, 33). The life cycle of B. anthracis begins after a phagocytosed spore germinates into a vegetative cell inside a mammalian host (2, 40, 69, 78). Virulence determinants produced by the vegetative cells facilitate bacterial growth, dissemination to major organ systems, and eventually host death (76-78). The release of aerosolized spores into areas with large concentrations of people is a serious public health concern (30).

Heme acquisition in B. anthracis is mediated by the action of IsdX1 and IsdX2, two extracellular hemophores that extract heme from host hemoglobin and deliver the iron-porphyrin to cell wall-localized IsdC (21, 45). Both IsdX1 and IsdX2 harbor near iron transporter domains (NEATs), a conserved protein module found in Gram-positive bacteria that mediates heme uptake from hemoglobin and contributes to bacterial pathogenesis upon infection (3, 8, 21, 31, 44, 46, 49, 50, 67, 81, 86). Hypothesizing that B. anthracis may contain additional mechanisms for heme transport, we provide evidence that B. anthracis S-layer protein K (BslK), an S-layer homology (SLH) and NEAT protein (32, 43), is surface localized and binds and transfers heme to IsdC in a rapid, contact-dependent manner. These results suggest that the Isd system is not a self-contained conduit for heme trafficking and imply that there is functional cross talk between differentially localized NEAT proteins to promote heme uptake during infection.

MATERIALS AND METHODS

Protein purification.

IsdX1 and IsdC were purified as previously described (44, 45). BslK was purified as a glutathione S-transferase (GST) fusion protein. Briefly, DNA encoding the NEAT domain (amino acids 46 to 165) of bslK (bslKN) was amplified from B. anthracis genomic DNA (45) using primers NEATforward (5′ GATCGATCGGATCCGCAGCTAGCAAATTAGCAGATG 3′) and NEATreverse (5′ GATCGATCGAATTCTTAGTGCCCAAGTTGGTACATCTG 3′). The underlined sequence refers to BamHI and EcoRI restriction sites, respectively. Following amplification, DNA was ligated into the BamHI/EcoRI restriction sites of pGEX2TK to create pgst-bslKN and transformed into Escherichia coli XL1-Blue.

XL1-Blue harboring pgst-bslKN was propagated in 100 ml of LB with ampicillin (0.1 mg/ml) overnight at 37°C. Bacteria were next inoculated into 1.5 liters of fresh LB + ampicillin and rotated at 250 rpm at 37°C. After 2 h of incubation, 1.5 mM isopropyl-β-d-thiogalactopyranoside (IPTG) was added and cultures were incubated for an additional 2 h. Bacteria were sedimented by centrifugation at 6,000 × g for 8 min and suspended in phosphate-buffered saline (PBS) (137 mM NaCl, 2.7 mM KCl, 10 mM sodium phosphate dibasic, 2 mM potassium phosphate monobasic, pH 7.4), and cells were broken with two passes through a French press at 14,000 lb/in2. Bacterial lysates were centrifuged at 30,000 × g for 15 min, and soluble protein in supernatants was passed through a 0.45-μm-pore-size cellulose filter. Filtrates were subjected to affinity chromatography on 2 ml glutathione-Sepharose (GE Healthcare, Piscataway, NJ), and the column was preequilibrated with 20 ml of PBS. Columns were washed with 40 ml PBS, and target proteins were eluted with 2 ml PBS containing 25 mM reduced glutathione.

GST-BslKN was dialyzed against 4 liters of PBS for 24 h to remove the glutathione. When necessary, the GST tag was cleaved away from GST-BslKN by thrombin digestion according to the manufacturer's instructions (GE Healthcare). Endogenous bound heme was removed from BslKN preparations by lowering the pH to 2.0 with HCl and extracting free heme with methyl ethyl ketone (MEK) as described previously (4). Approximately 50% of the recombinant BslKN is observed to precipitate following MEK treatment. Protein concentrations were determined by either the bicinchoninic acid method (Pierce, Rockford, IL) or SDS-PAGE (36). All protein preparations were stored at −20°C. This method yields 1 to 2 mg/ml of GST-free apo-BslKN that is greater than 90% homogeneous, as judged by SDS-PAGE.

Holo forms of BslKN were prepared by passing 50 ml of a solution of 10 μM hemin (solubilized in 0.1 M NaOH) over GST-BslKN (~2 mg) immobilized on glutathione-Sepharose, followed by a wash with 50 ml of PBS, pH 7.4. Bound protein was treated with either thrombin (to release holo-BslKN) or 25 mM reduced glutathione [to elute GST-(holo)BslKN], and heme content was measured by determining the A403/A280 ratio. This procedure results in an approximately 8-fold increase in bound heme over that in untreated controls.

BslK localization.

To create BslK harboring a hexa-histidyl C-terminal tag (BslKH6), DNA encoding full-length bslK was amplified from B. anthracis Sterne 34F2 genomic DNA using primers bslkH6 forward (5′ GATCGATCTCTAGAGCGGAAAGCGTACTTATGTAGG 3′) and reverse (5′ GATCGATCGGTACCCTAGTGGTGATGGTGATGATGTTTCATTTCTTTCTTCAATTTATC 3′). The underlined and italicized sequences refer to XbaI/KpnI restriction sites and the hexa-histidyl tag, respectively. DNA encoding bslkH6 was ligated into the XbaI/KpnI sites of the expression plasmid pLM5 (32, 45, 48), and pLM5-bslkH6 was transformed into B. anthracis 34F2 as described previously (34). B. anthracis harboring pLM5-bslkH6 or the vector only (pLM5) was incubated in Luria broth containing 25 μg/ml kanamycin and 1.5 mM IPTG for 16 h at 30°C. When cultures reached an optical density of 1.0, cells were harvested by centrifugation at 15, 000 × g, cell supernatants were removed, and cell sediments (cell-associated sample) were washed two times with PBS, pH 7.4, and resuspended in 100 μl of sample buffer (3 M urea, 4% SDS, 1% β-mercaptoethanol, 10% glycerol, 50 mM Tris-HCl, pH 7.5). Supernatants (secreted sample) were adjusted to 10% trichloroacetic acid and incubated at 4°C for 1 h; the precipitant was sedimented at 15, 000 × g, and proteins were solubilized in 100 μl of sample buffer. Then, 10 μl each of the cell-associated and secreted samples (SD and Sec., respectively; see Fig. Fig.2)2) were subjected to 15% SDS-PAGE, proteins were electrotransferred to polyvinylidene difluoride (PVDF) membrane, and blots were exposed to αΗis6 (1:1,000; GenScript, Piscataway, NJ) followed by goat anti-rabbit-horseradish peroxidase (HRP) (1:10,000) and enhanced chemiluminescence (Pierce, Rockford, IL).

FIG. 2.
The localization of BslK. (A) Luria broth cultures containing B. anthracis with pLM5-bslKH6 or pLM5 were grown with or without IPTG for 16 hours and fractionated into cell-associated (SD, the bacterial sediment) and secreted (Sec., medium supernatant) ...

For the guanidine extraction experiments, B. anthracis strain Sterne (34F2) harboring pLM5-bslKH6 was grown in the presence of IPTG in brain heart infusion (BHI) for 12 h at 30°C. Bacilli were harvested by centrifugation (15, 000 × g), washed two times with PBS (pH 7.4), and incubated with 50 μl of 4 M guanidine-HCl (GN) or Tris buffer (50 mM, pH 7.0) for 5 min with gentle shaking. Cells were again centrifuged (15,000 × g), supernatants (guanidine-extractable fraction [ES]) were separated from washed sediments (guanidine-resistant fraction [SD]), and each fraction (~50 μl) was mixed with an equal volume of sample buffer. A 10-μl aliquot of each fraction was subjected to SDS-PAGE, and proteins were analyzed via αHis6 Western blotting or staining with Coomassie blue.

Heme binding to BslKN.

Apo-BslKN (1 μM) was incubated in PBS, pH 7.4, with or without hemin chloride (0.1 to 1.6 μM) for 5 min at 25°C, followed by a spectral analysis at 403 nm using a DU800 spectrophotometer (Beckman-Coulter, London, United Kingdom). The binding curve was generated following the subtraction of a hemin-only reference value for each of the assayed concentrations. Unless otherwise specified, iron-porphyrin that is free or bound to protein is referred to as “hemin” or “heme,” respectively.

Heme transfer from BslK to IsdC.

Heme recipients (apo forms of IsdC, IsdX1, or bovine serum albumin [BSA]) were either purified as described above or commercially purchased (BSA from Sigma). Each recipient (150 μl of a 10 μM solution) was incubated with GST-(holo)BslKN (10 μM) coupled to glutathione-Sepharose for 30 min at 25°C. Reactions were centrifuged to generate sediment (donor) and supernatant (recipient) fractions, the sediment was washed three times with 1 ml PBS, and the donor was eluted with 150 μl of 25 mM reduced glutathione in PBS, pH 7.4. Both fractions were subjected to absorbance spectroscopy at 403 nm to quantitate heme content.

Spectrometry-based studies.

The kinetics of transfer from holo-BslKN to apo-IsdC was measured using an RSM-1000 (OLIS, Bolgart, GA) stopped-flow spectrophotometer (1,000 spectra per second). Briefly, 200 μl of holo-BslKN (4 μM) was mixed with 200 μl of apo-IsdC (5 μM) in PBS at 20°C, and the absorbance changes at 410 and 380 nm were obtained (relative to the A580) from spectra accumulated over 2 s. The dead time of the instrument is ~3 ms, and the light path is 20 mm. The spectral changes at 380 nm are specific for holo-BslKN, while those at 410 nm are specific for IsdC. The rates of heme loss from BslKN were determined by incubating purified holo-BslKN (4 μM) with the apo form of a mutant (H64Y/V68F) sperm whale myoglobin (40 μM) heme-scavenging agent (27), and spectral changes at 403 nm relative to the control wavelength (433 nm) were monitored over 48 h at 25°C using an HP8453 spectrophotometer (Agilent, Santa Clara, CA). For the spectral scan demonstrated in Fig. Fig.5C,5C, recombinant GST-free BslKN (4 μM) purified from E. coli was analyzed via a wavelength scan using an HP8453 spectrophotometer.

FIG. 5.
Absorbance spectra of holo-BslKN and apo-IsdC. (A) Holo-BslKN (4 μM) was mixed with or without apo-Mb (40 μM), and spectral changes at 250 to 750 nm were monitored for 1 minute to 24 hours. (B) Holo-BslKN (4 μM), apo-IsdC (5 μM), ...

The association of BslKN with IsdC.

The interaction of holo-BslKN with apo-IsdC was analyzed by surface plasmon resonance (SPR) spectroscopy using a BIAcore 3000 biosensor (GE Healthcare, Sweden) (54, 58). Apo-IsdC in HBS (10 mM HEPES, pH 7.4, 0.15 M NaCl, 3 mM EDTA, 0.05% Tween 20) was covalently coupled to a carboxy-methyl (CM5) sensor chip at 25°C to 5,650 response units (RU) using amine chemistry as described previously (29, 55). Holo-BslKN (0.5 to 10 μM) in HBS was injected at 20 μl/min for 300 s, and dissociation was monitored after HBS injection for another 300 s at 25°C. Affinity constants were estimated by fitting the data to a simple 1:1 binding model (15, 21) and analyzed using dR/dt = kaC(RmaxR) − kdR, where R is the SPR signal (in response units), ka is the association rate constant (in M−1 s−1), kd is the dissociation rate constant (in s−1), C is the concentration of holo-IsdX1 (in M), Rmax is the maximum holo-IsdX1 binding capacity (in response units), and dR/dt is the rate of change of the SPR signal. The equilibrium binding constant (KD) of the complex was determined as the ratio of ka/kd. All reported constants represent the mean of results from nine separate injections of holo-BslKN, varying in concentration from 0.5 to 10 μM. Data were prepared by “double referencing,” where parallel injections of analyte and buffer are flowed over a control dextran surface and immobilized apo-IsdC. Sensograms were fit using BIAevaluation 4.1 software (GE Healthcare).

RESULTS

BslK localizes to the cell surface.

Reasoning that B. anthracis may contain multiple mechanisms or systems for heme uptake, an in silico search of the B. anthracis genome for genes predicted to encode NEAT domain-containing proteins yielded the recently described Isd hemophore system (isdC, isdX1, and isdX2) (44, 45), a gene encoding a putative surface protein and virulence factor (BAS0520) (8), and bslK (BAS1021). Interestingly, bslK is also annotated as encoding three SLH domains (Fig. (Fig.1)1) and is conserved in the Bacillus cereus group (B. anthracis, B. cereus, and B. thuringiensis) of Gram-positive bacteria (32). The SLH domain has been demonstrated to mediate protein binding to cell wall structures (23, 38, 39, 43, 53, 62). Examination of the DNA immediately upstream of the transcriptional start site of bslK indicates a sequence (GACATTGATAATCATTATC) that is similar (three mismatches) to the consensus sequence for the binding of the ferric uptake repressor (fur), suggesting that bslK is regulated by fur and expressed under conditions of iron limitation (similar to the Isd proteins) (9, 45, 50). Collectively, this information led to the hypothesis that in B. anthracis and related bacteria, BslK is a surface protein that participates in heme acquisition.

FIG. 1.
Predicted structural motifs of BslK. The amino acid sequence of BslK (BAS1021), highlighting the signal peptide (1 to 32), NEAT (46 to 165), and three SLH domains (1, 170 to 212; 2, 230 to 271; 3, 291 to 332), is demonstrated. Notable residues include ...

To characterize the localization of BslK, the open reading frame of full-length bslK was fused to DNA encoding a hex-histidyl tag and cloned into pLM5 such that the recombinant gene is under the control of an IPTG-inducible spac promoter (pLM5-bslKH6) (48). B. anthracis harboring pLM5 (vector control) or pLM5-bslKH6 was grown in the presence or absence of IPTG, and cultures were separated into cell-associated (bacterial sediment [SD]) and secreted (culture supernatant [Sec]) fractions. Samples of each fraction were subjected to SDS-PAGE, and BslKH6 was detected by αHis Western analysis. As indicated in Fig. Fig.22 A, a single immunoreactive species of approximately 37 kDa was observed in the cell-associated fraction of cultures that had been incubated with IPTG. This species was not observed in the absence of IPTG or in the vector (pLM5) control samples, consistent with the observed species being BslKH6.

To determine if cell-associated BslKH6 is a surface protein, we treated BslKH6-expressing cells with guanidine-HCl (GN), a chaotropic agent known to induce the release of noncovalently attached cell envelope proteins such as S-layer polypeptides from the surface of bacteria (42, 63, 70). B. anthracis cells were grown in the presence of IPTG, and bacterial sediments were treated with 4 M guanidine for 5 min. Following centrifugation, guanidine-extractable proteins (ES) and guanidine-resistant sediments (SD) were subjected to αHis Western blotting or proteins were stained with Coomassie blue. As demonstrated in Fig. 2B, a single species was observed in the guanidine-extractable supernatant but not the guanidine-resistant sediment fraction of IPTG-treated cells. However, no BslKΗ6 was observed in the supernatant (ES) of cells treated with a Tris buffer control. Coomassie blue staining of each fraction indicated that guanidine was effective at releasing most of the Sap (arrow), a known S-layer protein of B. anthracis, from the cell envelope (Fig. (Fig.2C)2C) (20, 32). In similar studies, guanidine treatment did not lead to the release of the membrane protein sortase B, indicating that the cell membrane remained intact in these experiments (data not shown). Collectively, these results provide evidence that BslK is noncovalently associated with the cell envelope of B. anthracis, a notion consistent with the presence of its three SLH domains.

BslK binds heme.

To determine if BslK is a heme-binding protein, DNA encoding the NEAT domain (amino acids 46 to 165 termed BslKN) was fused to DNA encoding glutathione S-transferase (GST) in the plasmid pGEX2TK to create pgst-bslkN. Following transformation into E. coli, an approximately 42-kDa protein (theoretical mass of GST-BslKN = 40,322 Da) was overexpressed when cells were incubated with IPTG (Fig. (Fig.33 A). The addition of lysates to glutathione-Sepharose imparted a brown tint to the Sepharose resin, even after extensive washing, suggesting that GST-BslKN bound endogenous iron-porphyrin from E. coli (Fig. (Fig.3B,3B, Bound). Elution of bound proteins with excess glutathione removed the brown tint (Fig. (Fig.3B,3B, Elute) and yielded two protein species upon SDS-PAGE analysis (the approximately 42-kDa band and a smaller 26-kDa product) (Fig. (Fig.3C,3C, Elute). Both proteins were reactive in αGST Western blotting (data not shown), confirming the 42-kDa protein to be GST-BslKN and the 26-kDa protein to be free GST. Thrombin treatment of glutathione-Sepharose-bound GST-BslKN released the approximately 18-kDa NEAT domain of BslK from GST (Fig. (Fig.3C,3C, Soluble), whereas GST remained bound to the glutathione-Sepharose (Fig. (Fig.3C,3C, Sediment).

FIG. 3.
Purification and heme-binding activity of BslKN. (A) E. coli XL1-Blue harboring pgst-bslKN was incubated with or without IPTG, cell lysates were solubilized in sample buffer, and 10 μl was applied to SDS-PAGE, followed by gel staining with Coomassie ...

After removal of endogenous iron-porphyrin (4), purified apo-BslKN was incubated with increasing amounts of hemin and the spectral absorbance at 403 nm was monitored. As indicated in Fig. Fig.3D,3D, BslKN bound hemin in a dose-dependent and saturable manner with an apparent dissociation constant (Kd) of less than 0.1 μM. Taken together, these data suggest that BslK is a heme-binding protein in B. anthracis.

BslKN can transfer heme to IsdC.

The finding that BslKN is a surface and heme-binding protein prompted us to examine if holo-BslKN could transfer heme to the cell wall protein IsdC. To test this, we used an assay in which purified heme donors fused to GST are incubated with potential heme recipients and reaction mixtures are separated by GST-affinity chromatography (21). GST-(holo)BslKN was incubated with either a buffer control (PBS) or equimolar amounts of bovine serum albumin (BSA), apo-IsdX1, or apo-IsdC, reactions were separated into sediment (GST-BslKN) and supernatant (BSA, IsdX1, or IsdC) fractions, and relative heme content was measured by quantitating the absorbance of each fraction at 403 nm (Fig. (Fig.44 A). As demonstrated in Fig. Fig.4B,4B, nearly 60% of the heme originally loaded onto GST-(holo)BslKN was transferred to apo-IsdC. In contrast, less than 10% of the heme was transferred to BSA or apo-IsdX1 (Fig. (Fig.4B).4B). The latter result suggests that heme exchange in this experiment is not due to free or nonspecifically bound heme being present in the GST-(holo)BslKN preparations. Heme signals for each fraction were also not due to differences in either the donor or recipient protein amounts (Fig. (Fig.4C).4C). Collectively, these results suggest that holo-BslKN can transfer its heme to apo-IsdC in a directional and specific manner at equilibrium.

FIG. 4.
Heme transfer to apo-IsdC. (A) Outline of the procedure to monitor heme transfer from holo-BslKN to buffer (line 1), BSA (line 2), apo-IsdX1 (line 3), or apo-IsdC (line 4). (B) GST-(holo)BslKN, coupled to glutathione-Sepharose, was incubated with equimolar ...

The transfer of heme from holo-BslKN to apo-IsdC is rapid.

A determination of the mechanism of heme exchange between hemoproteins in bacteria is necessary to understand the biological function of heme uptake during infection. To gain insights into the mechanism of heme transfer from BslKN to IsdC, we measured the rates of heme dissociation from holo-BslKN and transfer to apo-IsdC. Because the absorbance in the Soret region (~400 nm) acts as a diagnostic “fingerprint” for the individual hemoproteins, transfer kinetics can be determined by measuring spectral changes in this region over time. The loss of heme from holo-BslKN was measured after incubation with the heme-scavenging agent, apo-myoglobin (apo-Mb) (21). As indicated in Fig. Fig.55 A and quantitated in Fig. Fig.6A,6A, no spectral changes were observed in 24 h, indicating that holo-BslKN retained its heme over the course of the experiment, a result that suggests that heme dissociation is very slow (≤10−5 s−1) (27). However, incubation of holo-BslKN with apo-IsdC resulted in pronounced spectral changes compared to the result with a holo-BslKN-only control. A decrease (loss of heme) in the BslKN-specific absorbance peak at A380 and an increase (gain of heme) in the IsdC-specific peak at A410 were observed (Fig. (Fig.5B).5B). As measured by stopped-flow spectroscopy, the time courses for these changes were rapid (<1 s) with pseudo-first-order rate constants of ~6 s−1 at both wavelengths (Fig. (Fig.6B).6B). These data indicate that the transfer of heme from BslK to IsdC is much faster (>105 s) than the thermal dissociation of heme from BslK into solution. The “broad” shoulder observed from 350 to 380 nm is characteristic of holo-BslKN preparations and is also observed for recombinant BslKN purified directly from E. coli (Fig. (Fig.5C).5C). The molecular basis of these spectra is not understood.

FIG. 6.
The kinetics of transfer to apo-IsdC. Holo-BslKN (4 μM) was mixed with either apo-Mb (40 μM) (A) or apo-IsdC (5 μM) (B), and spectral changes at 403 nm (A) or 380/410 nm (B) relative to reference wavelengths were monitored in a ...

Heme transfer from BslKN to IsdC is mediated by protein-protein interactions.

The rapid kinetics of heme transfer from BslKN to IsdC suggests that this process may be facilitated by a protein-protein interaction mechanism. To test this hypothesis, we used surface plasmon resonance (SPR) spectroscopy, a sensitive technique that allows for the determination of the kinetics, specificity, and strength of molecular interactions in real time (54, 58). Apo-IsdC was covalently coupled to a carboxy-methyl (CM) chip. Following infusion of increasing amounts of holo-BslKN, a dose-dependent increase in response units was observed (Fig. (Fig.7).7). Fitting the data to a 1:1 binding interaction allowed for the determination of the KD (1.53 μM), ka (336 M−1 s−1), and kd (5.14 × 10−4 s−1). No response was observed when holo-BslKN was infused over apo-IsdX1 or when BslKN lacked heme (data not shown), consistent with the lack of transfer to IsdX1 observed in Fig. Fig.4.4. Collectively, these data indicate that holo-BslKN associates with apo-IsdC with low-micromolar affinity and suggest that B. anthracis contains multiple, diverse proteins for heme transfer through its envelope structure.

FIG. 7.
The interaction of holo-BslKN and apo-IsdC. (A) Holo-BslKN was injected at concentrations ranging from 0.5 to 10 μM (lower to upper curves) at a constant flow rate of 20 μl/min over 5,650 response units (RUs) of immobilized apo-IsdC. The ...

DISCUSSION

Targeting iron uptake systems to prevent the establishment of bacterial infections represents a promising direction in the development of novel antibacterial agents (47, 68). The generation of effective therapeutics with in vivo efficacy will require basic knowledge of the mechanism of action of iron acquisition systems on a molecular and cellular level. Central to this concept is an understanding of the mode of iron transport through bacterial surface structures that differ in their structure and composition.

The metallo-porphyrin heme is an abundant source of iron for bacterial pathogens, as this molecule constitutes up to 80% of circulating iron inside mammalian hosts. As an indirect form of iron “nutritional immunity,” host heme is tightly bound by the oxygen carrier protein hemoglobin, which itself is sequestered inside erythrocytes (14, 28, 74, 85). To access and utilize host hemoglobin as an iron source, three general processes must occur. First, erythrocytes must be lysed by specific bacterial lipases, thereby releasing hemoglobin into plasma. Second, heme must be extracted from circulating hemoglobin and delivered to the bacterial cell envelope. Finally, heme must be transported through the envelope into the cell for iron-porphyrin degradation.

Several bacterial pathogens also produce an additional surface structure called the S-layer (6, 7, 18, 19, 56, 75). This raises questions concerning whether S-layers, in addition to their proposed structural and protective roles, also function in the transport of small molecules, including heme-iron. Biochemical and microscopic evidence indicates that B. anthracis is capable of forming an S-layer that is principally composed of two proteins: EA1 (extractable antigen 1) and Sap (surface array protein) (5, 20, 53). A common feature of EA1 and Sap is that they each harbor three SLH domains, a conserved structural module that may mediate both the intramolecular assembly of S-layer proteins and intermolecular association with carbohydrates on the cell wall (23, 38, 39, 43, 53, 62). Indeed, the genome of B. anthracis harbors 22 SLH proteins, including BslK (32). The finding that BslK also contains a NEAT domain prompted an investigation into whether this potential surface protein partakes in heme binding and transfer. Treatment of B. anthracis cells expressing a His-tagged form of BslK with guanidine led to the release of BslKH6 into the supernatant, a finding consistent with the extraction of noncovalently associated S-layer proteins from the bacterial surface as reported by others (32, 42, 53, 63, 70). Immunofluorescence microscopy using Texas Red-conjugated anti-hexa-histidyl antibodies also indicated that BslKH6 localized to the bacterial surface (Y. Tarlovsky and A. W. Maresso, unpublished observations). Taken together, these data suggest that BslK may function in heme trafficking at the cell envelope.

An attempt to purify BslK that lacks the signal peptide but contains the SLH and NEAT domains was compromised by a high degree of insolubility of the recombinant protein (Tarlovsky and Maresso, unpublished observations). Fusion of the NEAT domain of BslK (BslKN) to GST allowed for the purification of a soluble protein with bound iron-porphyrin, suggesting that BslK is a heme-binding protein. Indeed, GST-free BslKN binds pure hemin with an estimated dissociation constant that is lower than 10−7 M, consistent with the finding that no appreciable loss of heme from holo-BslKN is observed, compared to holo-IsdX1 (21), following incubation with apo-Mb (Fig. (Fig.6A).6A). Since the ΔA403 begins to saturate at hemin concentrations between 0.5 and 1.0 μM, it appears that interaction of BslKN (1 μM) with hemin follows a 1:1 binding stoichiometry.

Work over the past 5 years has provided insights into how NEAT domain proteins modulate the movement of heme from extracellular sources such as hemoglobin to proteins localized on the bacterial envelope. In Staphylococcus aureus, the Isd system provides for coordinated heme import with proteins covalently anchored to the cell wall (50, 80). IsdH and IsdB likely function as hemoglobin receptors and partake in heme extraction from hemoglobin (16, 17, 65, 81). Heme is next passed to IsdA and IsdC, two additional cell wall-anchored proteins, which subsequently transfer the heme to the membrane protein IsdE (26, 41, 50, 57, 66, 67, 80, 82, 86). Finally, IsdE likely passes heme to the monooxygenase IsdG, where enzymatic degradation of the heme yields free iron and biliverdin (72, 73).

However, in B. anthracis, heme acquisition from hemoglobin seems to be mediated by the action of two secreted hemophores, the NEAT proteins IsdX1 and IsdX2 (45), which transfer their bound heme directly and rapidly to IsdC (21), a cell wall-anchored protein (24a, 44). Since IsdC has been proposed to be the central conduit for NEAT-mediated heme trafficking in Gram-positive bacteria (41, 58, 71, 86), we hypothesized that BslK may transfer its bound heme directly to apo-IsdC. Indeed, holo-BslKN directionally and rapidly transferred heme to apo-IsdC and with kinetics similar to those observed for IsdX1/IsdX2 → IsdC transfers (21). Further, SPR data indicate that holo-BslK associates with apo-IsdC, a finding also observed for holo-IsdX1/apo-IsdC mixtures. The low rate of heme loss from several characterized NEAT proteins, combined with the growing evidence of NEAT-NEAT interactions observed for heme donor/recipient pairs, suggests that heme transfer between NEAT proteins is mediated by protein-protein interactions in Gram-positive bacteria (21, 41, 57, 61, 86). The finding that B. anthracis contains a noncovalently associated surface protein with heme-binding properties adds to the diverse mechanisms of iron acquisition in B. anthracis, which includes iron scavenging by siderophores (1, 10, 24, 35, 37, 64).

The characterization of BslK generates interesting questions concerning the dynamic interplay of multiple iron-uptake proteins or systems during infection with B. anthracis. For example, the notion that BslK and IsdC form a heme-relay pair indicates that heme can be shuttled to the Isd system by NEAT proteins whose corresponding genes lie outside the Isd locus. This property may confer two functionally distinct advantages for B. anthracis and related Gram-positive bacteria during infection. First, it potentially allows for the differential regulation of NEAT protein expression at the transcriptional level, thereby modulating the amount or timing of NEAT production in response to changes in host iron or heme availability. Second, the presence of multiple NEAT proteins may confer a type of “heme permissiveness” that ensures heme uptake in different tissue niches (a change in the host environment) or in response to changes in the topology of the bacterial envelope.

For example, BslK, by virtue of its SLH domains, may localize to S-layer structures and thereby provide for heme acquisition at a stage during infection when a functional S-layer is present (11, 52). These concepts imply that heme uptake in B. anthracis is more complicated than the simple diffusion of released hemoglobin, or heme-bound IsdX1 and/or IsdX2, to the cell wall. B. anthracis seems to have evolved several mechanisms to ensure that the integrity of heme uptake is maintained despite changes in the host environment and/or the bacterial surface that would otherwise hinder access and transport of limiting nutrients that are required for constant growth and replication of the bacterial cell. Finally, heme transfer between multiple NEAT proteins in vivo will also be influenced by the physical location of each hemoprotein in the cell wall and may be modulated by unknown factors. A test of these biological concepts will require a thorough phenotypic analysis of NEAT mutant strains for their properties of heme extraction, uptake, and utilization in both cell culture and animal models of disease. These studies are currently ongoing in the laboratory.

The findings of this report require an expansion of the model of heme acquisition in B. anthracis (Fig. (Fig.8)8) (21, 44, 45). Under conditions of iron starvation, B. anthracis secretes the hemophores IsdX1 and IsdX2, which scavenge heme from host hemoglobin. The heme-bound hemophores form an active complex with IsdC that facilitates heme transfer to the cell envelope. Alternatively, B. anthracis may utilize BslK, which is noncovalently bound to the external surface of the cell wall via its SLH domains (22, 51), for heme transfer in a rapid manner to IsdC via protein-protein interactions. Holo-IsdC next passes the iron-porphyrin to membrane transporters for delivery into the cell cytoplasm. Iron is then liberated via oxidative degradation of the heme by IsdG (72). Our results provide direct evidence that non-Isd NEAT proteins such as BslK may funnel heme into the Isd system, thereby supporting a model recently proposed by Daou and coworkers for the NEAT protein IlsA (13). Future studies will elucidate the source of heme for BslK and the functional interplay among multiple NEAT proteins at the cell envelope of B. anthracis and will provide mechanistic insights into the processes of heme extraction, transport, and utilization in Gram-positive pathogenic bacteria.

FIG. 8.
A current model for heme acquisition and transport into B. anthracis. In response to the dynamic environment encountered during infection of mammalian hosts, B. anthracis most likely requires functional plasticity of its surface envelope structures to ...

Acknowledgments

This work was supported by grants from the National Institutes of Health: AI069697 to A.W.M., GM035649 and HL047020 to J.S.O., and GM84348 to M.F. A.W.M. was also supported by seed funds from Baylor College of Medicine and J.S.O. by the Robert A. Welch Foundation grant C0612.

We thank Kuanqing Liu and Miriam Balderas for critical reading and suggestions.

Footnotes

[down-pointing small open triangle]Published ahead of print on 30 April 2010.

REFERENCES

1. Abergel, R. J., M. K. Wilson, J. E. Arceneaux, T. M. Hoette, R. K. Strong, B. R. Byers, and K. N. Raymond. 2006. Anthrax pathogen evades the mammalian immune system through stealth siderophore production. Proc. Natl. Acad. Sci. U. S. A. 103:18499-18503. [PubMed]
2. Abramova, F. A., L. M. Grinberg, O. V. Yampolskaya, and D. H. Walker. 1993. Pathology of inhalational anthrax in 42 cases from the Sverdlovsk outbreak of 1979. Proc. Natl. Acad. Sci. U. S. A. 90:2291-2294. [PubMed]
3. Andrade, M. A., F. D. Ciccarelli, C. Perez-Iratxeta, and P. Bork. 15 August 2002. NEAT: a domain duplicated in genes near the components of a putative Fe3+ siderophore transporter from Gram-positive pathogenic bacteria. Genome Biol. 33(9):RESEARCH0047. [PMC free article] [PubMed]
4. Ascoli, F., M. R. Fanelli, and E. Antonini. 1981. Preparation and properties of apohemoglobin and reconstituted hemoglobins. Methods Enzymol. 76:72-87. [PubMed]
5. Bahl, H., H. Scholz, N. Bayan, M. Chami, G. Leblon, T. Gulik-Krzywicki, E. Shechter, A. Fouet, S. Mesnage, E. Tosi-Couture, P. Gounon, M. Mock, E. Conway de Macario, A. J. Macario, L. A. Fernandez-Herrero, G. Olabarria, J. Berenguer, M. J. Blaser, B. Kuen, W. Lubitz, M. Sara, P. H. Pouwels, C. P. Kolen, H. J. Boot, and S. Resch. 1997. Molecular biology of S-layers. FEMS Microbiol. Rev. 20:47-98. [PubMed]
6. Beveridge, T. J., P. H. Pouwels, M. Sara, A. Kotiranta, K. Lounatmaa, K. Kari, E. Kerosuo, M. Haapasalo, E. M. Egelseer, I. Schocher, U. B. Sleytr, L. Morelli, M. L. Callegari, J. F. Nomellini, W. H. Bingle, J. Smit, E. Leibovitz, M. Lemaire, I. Miras, S. Salamitou, P. Beguin, H. Ohayon, P. Gounon, M. Matuschek, and S. F. Koval. 1997. Functions of S-layers. FEMS Microbiol. Rev. 20:99-149. [PubMed]
7. Carl, M., and G. A. Dasch. 1989. The importance of the crystalline surface layer protein antigens of rickettsiae in T-cell immunity. J. Autoimmun. 2(Suppl.):81-91. [PubMed]
8. Carlson, P. E., Jr., K. A. Carr, B. K. Janes, E. C. Anderson, and P. C. Hanna. 2009. Transcriptional profiling of Bacillus anthracis Sterne (34F2) during iron starvation. PLoS One 4:e6988. [PMC free article] [PubMed]
9. Carpenter, B. M., J. M. Whitmire, and D. S. Merrell. 2009. This is not your mother's repressor: the complex role of fur in pathogenesis. Infect. Immun. 77:2590-2601. [PMC free article] [PubMed]
10. Cendrowski, S., W. MacArthur, and P. Hanna. 2004. Bacillus anthracis requires siderophore biosynthesis for growth in macrophages and mouse virulence. Mol. Microbiol. 51:407-417. [PubMed]
11. Couture-Tosi, E., H. Delacroix, T. Mignot, S. Mesnage, M. Chami, A. Fouet, and G. Mosser. 2002. Structural analysis and evidence for dynamic emergence of Bacillus anthracis S-layer networks. J. Bacteriol. 184:6448-6456. [PMC free article] [PubMed]
12. Crosa, J. H., A. R. Mey, and S. M. Payne (ed.). 2004. Iron transport in bacteria. ASM Press, Washington, DC.
13. Daou, N., C. Buisson, M. Gohar, J. Vidic, H. Bierne, M. Kallassy, D. Lereclus, and C. Nielsen-LeRoux. 2009. IlsA, a unique surface protein of Bacillus cereus required for iron acquisition from heme, hemoglobin and ferritin. PLoS Pathog. 5:e1000675. [PMC free article] [PubMed]
14. De Domenico, I., D. McVey Ward, and J. Kaplan. 2008. Regulation of iron acquisition and storage: consequences for iron-linked disorders. Nat. Rev. Mol. Cell Biol. 9:72-81. [PubMed]
15. Dementieva, I. S., V. Tereshko, Z. A. McCrossan, E. Solomaha, D. Araki, C. Xu, N. Grigorieff, and S. A. Goldstein. 2009. Pentameric assembly of potassium channel tetramerization domain-containing protein 5. J. Mol. Biol. 387:175-191. [PMC free article] [PubMed]
16. Dryla, A., D. Gelbmann, A. von Gabain, and E. Nagy. 2003. Identification of a novel iron regulated staphylococcal surface protein with haptoglobin-haemoglobin binding activity. Mol. Microbiol. 49:37-53. [PubMed]
17. Dryla, A., B. Hoffmann, D. Gelbmann, C. Giefing, M. Hanner, A. Meinke, A. S. Anderson, W. Koppensteiner, R. Konrat, A. von Gabain, and E. Nagy. 2007. High-affinity binding of the staphylococcal HarA protein to haptoglobin and hemoglobin involves a domain with an antiparallel eight-stranded beta-barrel fold. J. Bacteriol. 189:254-264. [PMC free article] [PubMed]
18. Dworkin, J., and M. J. Blaser. 1997. Molecular mechanisms of Campylobacter fetus surface layer protein expression. Mol. Microbiol. 26:433-440. [PubMed]
19. Engelhardt, H., and J. Peters. 1998. Structural research on surface layers: a focus on stability, surface layer homology domains, and surface layer-cell wall interactions. J. Struct. Biol. 124:276-302. [PubMed]
20. Etienne-Toumelin, I., J. C. Sirard, E. Duflot, M. Mock, and A. Fouet. 1995. Characterization of the Bacillus anthracis S-layer: cloning and sequencing of the structural gene. J. Bacteriol. 177:614-620. [PMC free article] [PubMed]
21. Fabian, M., E. Solomaha, J. S. Olson, and A. W. Maresso. 2009. Heme transfer to the bacterial cell envelope occurs via a secreted hemophore in the gram-positive pathogen Bacillus anthracis. J. Biol. Chem. 284:32138-32146. [PMC free article] [PubMed]
22. Fouet, A., S. Mesnage, E. Tosi-Couture, P. Gounon, and M. Mock. 1999. Bacillus anthracis surface: capsule and S-layer. J. Appl. Microbiol. 87:251-255. [PubMed]
23. Fujino, T., P. Beguin, and J. P. Aubert. 1993. Organization of a Clostridium thermocellum gene cluster encoding the cellulosomal scaffolding protein CipA and a protein possibly involved in attachment of the cellulosome to the cell surface. J. Bacteriol. 175:1891-1899. [PMC free article] [PubMed]
24. Garner, B. L., J. E. Arceneaux, and B. R. Byers. 2004. Temperature control of a 3,4-dihydroxybenzoate (protocatechuate)-based siderophore in Bacillus anthracis. Curr. Microbiol. 49:89-94. [PubMed]
24a. Gat, O., G. Zaide, I. Inbar, H. Grosfeld, T. Chitlaru, H. Levy, and A. Shafferman. 2008. Characterization of Bacillus anthracis iron-regulated surface determinant (Isd) proteins containing NEAT domains. Mol. Microbiol. 70:983-999. [PubMed]
25. Genco, C. A., and D. W. Dixon. 2001. Emerging strategies in microbial haem capture. Mol. Microbiol. 39:1-11. [PubMed]
26. Grigg, J. C., C. L. Vermeiren, D. E. Heinrichs, and M. E. Murphy. 2007. Haem recognition by a Staphylococcus aureus NEAT domain. Mol. Microbiol. 63:139-149. [PubMed]
27. Hargrove, M. S., E. W. Singleton, M. L. Quillin, L. A. Ortiz, G. N. Phillips, Jr., J. S. Olson, and A. J. Mathews. 1994. His64(E7)->Tyr apomyoglobin as a reagent for measuring rates of hemin dissociation. J. Biol. Chem. 269:4207-4214. [PubMed]
28. Heinemann, I. U., M. Jahn, and D. Jahn. 2008. The biochemistry of heme biosynthesis. Arch. Biochem. Biophys. 474:238-251. [PubMed]
29. Howell, S., M. Kenmore, M. Kirkland, and R. A. Badley. 1998. High-density immobilization of an antibody fragment to a carboxymethylated dextran-linked biosensor surface. J. Mol. Recognit. 11:200-203. [PubMed]
30. Inglesby, T. V., T. O'Toole, D. A. Henderson, J. G. Bartlett, M. S. Ascher, E. Eitzen, A. M. Friedlander, J. Gerberding, J. Hauer, J. Hughes, J. McDade, M. T. Osterholm, G. Parker, T. M. Perl, P. K. Russell, and K. Tonat. 2002. Anthrax as a biological weapon, 2002: updated recommendations for management. JAMA 287:2236-2252. [PubMed]
31. Jonsson, I. M., S. K. Mazmanian, O. Schneewind, T. Bremell, and A. Tarkowski. 2003. The role of Staphylococcus aureus sortase A and sortase B in murine arthritis. Microb. Infect. 5:775-780. [PubMed]
32. Kern, J. W., and O. Schneewind. 2008. BslA, a pXO1-encoded adhesin of Bacillus anthracis. Mol. Microbiol. 68:504-515. [PubMed]
33. Koch, R. 1876. Die Aetiologie der Milzbrand-Krankheit, begruendet auf die Entwicklungsgeschichte des Bacillus anthracis. Beitr. Biol. Pflanzen 2:277-310.
34. Koehler, T. M., Z. Dai, and M. Kaufman-Yarbray. 1994. Regulation of the Bacillus anthracis protective antigen gene: CO2 and a trans-acting element activate transcription from one of two promoters. J. Bacteriol. 176:586-595. [PMC free article] [PubMed]
35. Koppisch, A. T., C. C. Browder, A. L. Moe, J. T. Shelley, B. A. Kinkel, L. E. Hersman, S. Iyer, and C. E. Ruggiero. 2005. Petrobactin is the primary siderophore synthesized by Bacillus anthracis str. Sterne under conditions of iron starvation. Biometals 18:577-585. [PubMed]
36. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685. [PubMed]
37. Lee, J. Y., B. K. Janes, K. D. Passalacqua, B. F. Pfleger, N. H. Bergman, H. Liu, K. Håkansson, R. V. Somu, C. C. Aldrich, S. Cendrowski, P. C. Hanna, and D. H. Sherman. 2007. Biosynthetic analysis of the petrobactin siderophore pathway from Bacillus anthracis. J. Bacteriol. 189:1698-1710. [PMC free article] [PubMed]
38. Lemaire, M., I. Miras, P. Gounon, and P. Beguin. 1998. Identification of a region responsible for binding to the cell wall within the S-layer protein of Clostridium thermocellum. Microbiology 144(Part 1):211-217. [PubMed]
39. Lemaire, M., H. Ohayon, P. Gounon, T. Fujino, and P. Beguin. 1995. OlpB, a new outer layer protein of Clostridium thermocellum, and binding of its S-layer-like domains to components of the cell envelope. J. Bacteriol. 177:2451-2459. [PMC free article] [PubMed]
40. Lincoln, R. E., D. R. Hodges, F. Klein, B. G. Mahlandt, W. I. Jones, Jr., B. W. Haines, M. A. Rhian, and J. S. Walker. 1965. Role of the lymphatics in the pathogenesis of anthrax. J. Infect. Dis. 115:481-494. [PubMed]
41. Liu, M., W. N. Tanaka, H. Zhu, G. Xie, D. M. Dooley, and B. Lei. 2008. Direct hemin transfer from IsdA to IsdC in the iron-regulated surface determinant (Isd) heme acquisition system of Staphylococcus aureus. J. Biol. Chem. 283:6668-6676. [PMC free article] [PubMed]
42. Luckevich, M. D., and T. J. Beveridge. 1989. Characterization of a dynamic S layer on Bacillus thuringiensis. J. Bacteriol. 171:6656-6667. [PMC free article] [PubMed]
43. Lupas, A., H. Engelhardt, J. Peters, U. Santarius, S. Volker, and W. Baumeister. 1994. Domain structure of the Acetogenium kivui surface layer revealed by electron crystallography and sequence analysis. J. Bacteriol. 176:1224-1233. [PMC free article] [PubMed]
44. Maresso, A. W., T. J. Chapa, and O. Schneewind. 2006. Surface protein IsdC and sortase B are required for heme-iron scavenging of Bacillus anthracis. J. Bacteriol. 188:8145-8152. [PMC free article] [PubMed]
45. Maresso, A. W., G. Garufi, and O. Schneewind. 2008. Bacillus anthracis secretes proteins that mediate heme acquisition from hemoglobin. PLoS Pathog. 4:e1000132. [PMC free article] [PubMed]
46. Maresso, A. W., and O. Schneewind. 2006. Iron acquisition and transport in Staphylococcus aureus. Biometals 19:193-203. [PubMed]
47. Maresso, A. W., and O. Schneewind. 2008. Sortase as a target of anti-infective therapy. Pharmacol. Rev. 60:128-141. [PubMed]
48. Marraffini, L. A., and O. Schneewind. 2006. Targeting proteins to the cell wall of sporulating Bacillus anthracis. Mol. Microbiol. 62:1402-1417. [PubMed]
49. Mazmanian, S. K., G. Liu, E. R. Jensen, E. Lenoy, and O. Schneewind. 2000. Staphylococcus aureus mutants defective in the display of surface proteins and in the pathogenesis of animal infections. Proc. Natl. Acad. Sci. U. S. A. 97:5510-5515. [PubMed]
50. Mazmanian, S. K., E. P. Skaar, A. H. Gasper, M. Humayun, P. Gornicki, J. Jelenska, A. Joachimiak, D. M. Missiakas, and O. Schneewind. 2003. Passage of heme-iron across the envelope of Staphylococcus aureus. Science 299:906-909. [PubMed]
51. Mesnage, S., E. Tosi-Couture, and A. Fouet. 1999. Production and cell surface anchoring of functional fusions between the SLH motifs of the Bacillus anthracis S-layer proteins and the Bacillus subtilis levansucrase. Mol. Microbiol. 31:927-936. [PubMed]
52. Mesnage, S., E. Tosi-Couture, P. Gounon, M. Mock, and A. Fouet. 1998. The capsule and S-layer: two independent and yet compatible macromolecular structures in Bacillus anthracis. J. Bacteriol. 180:52-58. [PMC free article] [PubMed]
53. Mesnage, S., E. Tosi-Couture, M. Mock, P. Gounon, and A. Fouet. 1997. Molecular characterization of the Bacillus anthracis main S-layer component: evidence that it is the major cell-associated antigen. Mol. Microbiol. 23:1147-1155. [PubMed]
54. Morton, T. A., and D. G. Myszka. 1998. Kinetic analysis of macromolecular interactions using surface plasmon resonance biosensors. Methods Enzymol. 295:268-294. [PubMed]
55. Murphy, M., L. Jason-Moller, and J. Bruno. 2006. Using Biacore to measure the binding kinetics of an antibody-antigen interaction. Curr. Protoc. Protein Sci. Chapter 19:Unit 19.14. [PubMed]
56. Murray, R. G., J. S. Dooley, P. W. Whippey, and T. J. Trust. 1988. Structure of an S layer on a pathogenic strain of Aeromonas hydrophila. J. Bacteriol. 170:2625-2630. [PMC free article] [PubMed]
57. Muryoi, N., M. T. Tiedemann, M. Pluym, J. Cheung, D. E. Heinrichs, and M. J. Stillman. 2008. Demonstration of the iron-regulated surface determinant (Isd) heme transfer pathway in Staphylococcus aureus. J. Biol. Chem. 283:28125-28136. [PMC free article] [PubMed]
58. Myszka, D. G. 2000. Kinetic, equilibrium, and thermodynamic analysis of macromolecular interactions with BIACORE. Methods Enzymol. 323:325-340. [PubMed]
59. Navarre, W. W., and O. Schneewind. 1999. Surface proteins of Gram-positive bacteria and the mechanisms of their targeting to the cell wall envelope. Microbiol. Mol. Biol. Rev. 63:174-229. [PMC free article] [PubMed]
60. Neidhardt, F. C., J. L. Ingraham, and M. Schaechter. 1990. Physiology of the bacterial cell. Sinauer Associates, Sunderland, MA.
61. Nygaard, T. K., G. C. Blouin, M. Liu, M. Fukumura, J. S. Olson, M. Fabian, D. M. Dooley, and B. Lei. 2006. The mechanism of direct heme transfer from the streptococcal cell surface protein Shp to HtsA of the HtsABC transporter. J. Biol. Chem. 281:20761-20771. [PMC free article] [PubMed]
62. Olabarria, G., J. L. Carrascosa, M. A. de Pedro, and J. Berenguer. 1996. A conserved motif in S-layer proteins is involved in peptidoglycan binding in Thermus thermophilus. J. Bacteriol. 178:4765-4772. [PMC free article] [PubMed]
63. Pena, G., J. Miranda-Rios, G. de la Riva, L. Pardo-Lopez, M. Soberon, and A. Bravo. 2006. A Bacillus thuringiensis S-layer protein involved in toxicity against Epilachna varivestis (Coleoptera: Coccinellidae). Appl. Environ. Microbiol. 72:353-360. [PMC free article] [PubMed]
64. Pfleger, B. F., J. Y. Lee, R. V. Somu, C. C. Aldrich, P. C. Hanna, and D. H. Sherman. 2007. Characterization and analysis of early enzymes for petrobactin biosynthesis in Bacillus anthracis. Biochemistry 46:4147-4157. [PubMed]
65. Pilpa, R. M., E. A. Fadeev, V. A. Villareal, M. L. Wong, M. Phillips, and R. T. Clubb. 2006. Solution structure of the NEAT (NEAr Transporter) domain from IsdH/HarA: the human hemoglobin receptor in Staphylococcus aureus. J. Mol. Biol. 360:435-447. [PubMed]
66. Pilpa, R. M., S. A. Robson, V. A. Villareal, M. L. Wong, M. Phillips, and R. T. Clubb. 2009. Functionally distinct NEAT (NEAr Transporter) domains within the Staphylococcus aureus IsdH/HarA protein extract heme from methemoglobin. J. Biol. Chem. 284:1166-1176. [PMC free article] [PubMed]
67. Pluym, M., N. Muryoi, D. E. Heinrichs, and M. J. Stillman. 2008. Heme binding in the NEAT domains of IsdA and IsdC of Staphylococcus aureus. J. Inorg. Biochem. 102:480-488. [PubMed]
68. Reniere, M. L., V. J. Torres, and E. P. Skaar. 2007. Intracellular metalloporphyrin metabolism in Staphylococcus aureus. Biometals 20:333-345. [PubMed]
69. Ross, J. M. 1957. The pathogenesis of anthrax following the administration of spores by the respiratory route. J. Pathol. Bacteriol. 73:485-494.
70. Sara, M., and U. B. Sleytr. 2000. S-layer proteins. J. Bacteriol. 182:859-868. [PMC free article] [PubMed]
71. Sharp, K. H., S. Schneider, A. Cockayne, and M. Paoli. 2007. Crystal structure of the heme-IsdC complex, the central conduit of the Isd iron/heme uptake system in Staphylococcus aureus. J. Biol. Chem. 282:10625-10631. [PubMed]
72. Skaar, E. P., A. H. Gaspar, and O. Schneewind. 2006. Bacillus anthracis IsdG, a heme-degrading monooxygenase. J. Bacteriol. 188:1071-1080. [PMC free article] [PubMed]
73. Skaar, E. P., A. H. Gaspar, and O. Schneewind. 2004. IsdG and IsdI, heme degrading enzymes in the cytoplasm of Staphylococcus aureus. J. Biol. Chem. 279:436-443. [PubMed]
74. Skaar, E. P., M. Humayun, K. L. DeBord, and O. Schneewind. 2004. Iron source preference of Staphylococcus aureus infections. Science 305:1626-1628. [PubMed]
75. Sleytr, U. B., and P. Messner. 1983. Crystalline surface layers on bacteria. Annu. Rev. Microbiol. 37:311-339. [PubMed]
76. Smith, H., J. Keppie, and J. I. Stanley. 1953. The chemical basis of the virulence of Bacillus anthracis. I. Properties of bacteria grown in vivo and preparation of extracts. Br. J. Exp. Pathol. 34:477-485. [PubMed]
77. Smith, H., J. Keppie, and J. L. Stanley. 1955. The chemical basis of the virulence of Bacillus anthracis. V. The specific toxin produced by Bacillus anthracis in vivo. Br. J. Exp. Pathol. 36:460-472. [PubMed]
78. Smith, H., J. Keppie, and J. L. Stanley. 1954. Observations on the cause of death in experimental anthrax. Lancet 267:474-476. [PubMed]
79. Stojiljkovic, I., and D. Perkins-Balding. 2002. Processing of heme and heme-containing proteins by bacteria. DNA Cell Biol. 21:281-295. [PubMed]
80. Taylor, J. M., and D. E. Heinrichs. 2002. Transferrin binding in Staphylococcus aureus: involvement of a cell wall-anchored protein. Mol. Microbiol. 43:1603-1614. [PubMed]
81. Torres, V. J., G. Pishchany, M. Humayun, O. Schneewind, and E. P. Skaar. 2006. Staphylococcus aureus IsdB is a hemoglobin receptor required for heme iron utilization. J. Bacteriol. 188:8421-8429. [PMC free article] [PubMed]
82. Vermeiren, C. L., M. Pluym, J. Mack, D. E. Heinrichs, and M. J. Stillman. 2006. Characterization of the heme binding properties of Staphylococcus aureus IsdA. Biochemistry 45:12867-12875. [PubMed]
83. Wandersman, C., and I. Stojiljkovic. 2000. Bacterial heme sources: the role of heme, hemoprotein receptors and hemophores. Curr. Opin. Microbiol. 3:215-220. [PubMed]
84. Wilks, A., and K. A. Burkhard. 2007. Heme and virulence: how bacterial pathogens regulate, transport and utilize heme. Nat. Prod. Rep. 24:511-522. [PubMed]
85. Wittenberg, J. B., and B. A. Wittenberg. 1990. Mechanisms of cytoplasmic hemoglobin and myoglobin function. Annu. Rev. Biophys. Biophys. Chem. 19:217-241. [PubMed]
86. Zhu, H., G. Xie, M. Liu, J. S. Olson, M. Fabian, D. M. Dooley, and B. Lei. 2008. Pathway for heme uptake from human methemoglobin by the iron-regulated surface determinants system of Staphylococcus aureus. J. Biol. Chem. 283:18450-18460. [PMC free article] [PubMed]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)