Search tips
Search criteria 


Logo of aacPermissionsJournals.ASM.orgJournalAAC ArticleJournal InfoAuthorsReviewers
Antimicrob Agents Chemother. 2010 July; 54(7): 2940–2952.
Published online 2010 May 10. doi:  10.1128/AAC.01617-09
PMCID: PMC2897275

Arylimidamide DB766, a Potential Chemotherapeutic Candidate for Chagas' Disease Treatment [down-pointing small open triangle]


Chagas' disease, a neglected tropical illness for which current therapy is unsatisfactory, is caused by the intracellular parasite Trypanosoma cruzi. The goal of this work is to investigate the in vitro and in vivo effects of the arylimidamide (AIA) DB766 against T. cruzi. This arylimidamide exhibits strong trypanocidal activity and excellent selectivity for bloodstream trypomastigotes and intracellular amastigotes (Y strain), giving IC50s (drug concentrations that reduce 50% of the number of the treated parasites) of 60 and 25 nM, respectively. DB766 also exerts striking effects upon different parasite stocks, including those naturally resistant to benznidazole, and displays higher activity in vitro than the reference drugs. By fluorescent and transmission electron microscopy analyses, we found that this AIA localizes in DNA-enriched compartments and induces considerable damage to the mitochondria. DB766 effectively reduces the parasite load in the blood and cardiac tissue and presents efficacy similar to that of benznidazole in mouse models of T. cruzi infection employing the Y and Colombian strains, using oral and intraperitoneal doses of up to 100 mg/kg/day that were given after the establishment of parasite infection. This AIA ameliorates electrocardiographic alterations, reduces hepatic and heart lesions induced by the infection, and provides 90 to 100% protection against mortality, which is similar to that provided by benznidazole. Our data clearly show the trypanocidal efficacy of DB766, suggesting that this AIA may represent a new lead compound candidate to Chagas' disease treatment.

Chagas' disease (CD) is a neglected tropical illness that affects at least 12 million people in areas of disease endemicity in Latin America, where 50 million people are at risk of infection (22-24). In addition, many reports show that the occurrence of CD in areas where the disease is not endemic, such as the United States and Europe, is attributed mainly to the migration of infected people (30, 31, 50). The etiological agent is the intracellular obligatory parasite Trypanosoma cruzi, a hemoflagellate protozoan that presents a complex life cycle with distinct morphological stages in its obligatory passage through vertebrate and invertebrate hosts (63). CD can be transmitted by Triatominae insect feces, blood transfusion, organ transplantation, laboratory accidents, and oral and congenital routes (42, 66). It has the following two successive phases: a short acute phase characterized by a patent parasitemia, followed by a long progressive chronic phase that included mainly cardiac and/or digestive alterations (7, 61). The current therapy for CD comprised of nifurtimox (Nif) (5-nitrofurane, Bayer 2502; Bayer, Germany) and benznidazole (Bz) (2-nitroimidazole; Laboratório Farmacêutico do Estado de Pernambuco [LAFEPE], Brazil) has limitations, including long treatment periods, occurrence of side effects, variable results, and low efficacy during the chronic phase, which justify the search for new drugs (60, 69). Although Bz is not an ideal drug, it arrests electrocardiographic alterations, reduces progression of the disease, and protects the patients against deterioration of the clinical condition (70).

Aromatic diamidines (AD) and analogues target the minor groove of DNA and represent a promising class of antiparasitic agents (58, 65, 72). AD and their congeners present broad-spectrum activity against pathogenic microorganisms, and some of them have veterinary and human clinical uses {e.g., pentamidine isethionate [1,5-bis(4-amidino-phenoxy)pentane] (Pentacarinat; Rhodia)} (45, 57, 72). However, these compounds often cause considerable side effects and require parenteral routes of administration, which stimulates the synthesis and screening of new analogs and prodrugs to overcome these limitations (19, 34, 56, 59). The effect of several AD analogues was demonstrated against T. cruzi, and among them, significant in vitro activity was found for arylimidamides (AIAs), including DB889, DB786, and DB702 (46, 54, 55). Also, diamidines protect against mortality in mouse experimental models of acute T. cruzi infection (15, 19).

In the present work, our goal was to evaluate in vitro and in vivo the activity of a new synthesized AIA, DB766, against T. cruzi. Our data showed the excellent trypanocidal effect of DB766 upon different forms and strains of the parasite, displaying efficacy similar to that of benznidazole in mouse experimental models of acute infection. Our results suggest that this AIA as well as other compounds of this class represent very promising candidates for Chagas' disease treatment.



The synthesis of the AIA DB766 (Fig. (Fig.1)1) was performed, according to methodology previously reported by us (64). Stock solutions were prepared in dimethyl sulfoxide (DMSO), with the final concentration in the in vitro experiments never exceeding 0.6%, which did not exert any toxicity toward the parasite or mammalian host cells (data not shown). Bz (Rochagan; Roche) and gentian violet (Sigma-Aldrich) were used as reference drugs.

FIG. 1.
Chemical structure of DB766.


The 12 strains of T. cruzi used in the present study are described in Table Table1.1. Bloodstream trypomastigote forms (BT) were obtained from T. cruzi-infected Swiss mice at the peak of parasitemia (39). The Colombian strain was maintained by serial passages in C3H/He mice (25). In some assays, following parasite isolation from the different hosts (Table (Table1),1), epimastigote forms were maintained in liver infusion tryptose (LIT) medium, with weekly passages, and then were used in the in vitro studies (16). Intracellular amastigotes lodged within cardiac cell cultures were employed, as previously reported (18).

Trypanosoma cruzi strains presently useda

Samples collection and parasite isolation.

The strains 762, 855, 875, 956, 958, and 960 of T. cruzi were isolated from Triatoma brasiliensis captured in peridomiciles in a rural area of Russas in the Vale do Jaguaribe (Ceará, Brazil). The RBviii and MS1523 strains were isolated from Rhodnius brethesi (Hemiptera; Reduviidae) and Didelphis marsupialis (Marsupialia; Didelphidae), respectively, captured in the Amazon forest (Rio Negro, Amazonas, Brazil). Parasite isolation through xenodiagnosis and hemoculture followed procedures previously described (27). The isolated parasites were transferred to LIT medium supplemented with 10% fetal calf serum by weekly passages (11). The cultures were maintained under controlled conditions (28°C) for the trypanocidal assays.

Mammalian cell cultures.

For both drug toxicity and infection assays, primary cultures of embryonic cardiomyocytes (CM) were obtained from Swiss mice as previously reported (39). After purification, the CM were seeded at a density of 1.0 × 105 cells/well into 24-well culture plates or 0.5 × 105 cells/well into 96-well microplates containing gelatin-coated coverslips. The cultures were then sustained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% horse serum, 5% fetal bovine serum (FBS), 2.5 mM CaCl2, 1 mM l-glutamine, and 2% chicken embryo extract. The cell cultures were maintained at 37°C in an atmosphere of 5% CO2, and the assays were performed at least three times in duplicate.

Cytotoxicity tests.

In order to rule out the toxic effects of DB766 on host cells in vitro, uninfected CM were incubated for 24 and 72 h at 37°C in the presence or absence of DB766 (0 to 96 μM) diluted in DMEM. The CM morphology and spontaneous contractibility were evaluated by light microscopy. The cell death rates were measured by MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] colorimetric assay (41). The absorbance was measured at a wavelength of 490 nm with a spectrophotometer (VersaMax tunable microplate reader; Molecular Devices), which allows for the determination of LC50s (drug concentrations that reduce 50% of cellular viability). Additionally, cellular viability was monitored through creatine kinase cardiac isotype (CK-MB) levels released into the supernatant of untreated and DB766-treated CM, as reported previously (62).

Trypanocidal analysis.

BT (5.0 × 106 cells per ml) were incubated for 24 h at 37°C in RPMI 1640 medium (Sigma-Aldrich) supplemented with 5% FBS, in the presence or absence of serial dilutions of the compounds (0 to 32 μM). According to protocols already established by our group (M. N. Correia Soeiro and A. J. Romanha), experiments were also performed at 4°C, with BT maintained in freshly isolated mouse blood (96% and 50%) in the presence or absence of serial dilutions of the compound (up to 32 μM). After drug incubation, the parasite death rates were determined by light microscopy using a Neubauer chamber that allows the direct visualization and quantification of the number of motile and live parasites, and then IC50s (drug concentrations that reduce 50% of the number of the treated parasites) were calculated. For the analysis of the effect on intracellular parasites, after 24 h of parasite-host cell interaction (10:1 parasite/CM ratio), the infected cultures were washed to remove free parasites and then incubated at 37°C with increasing but nontoxic doses of the test drug (up to 10.6 μM). The CM were maintained at 37°C in an atmosphere of 5% CO2 and air, and the medium was replaced every 24 h. After drug exposure, the untreated and treated infected CM were fixed for 20 min at 4°C with 4% paraformaldehyde (PFA) and stained with 10 μg/ml 4′,6-diamidino-2-phenylindole (DAPI) for DNA staining to enable visualization of parasites and host cell nuclei and direct quantification of the infection levels. Finally, the samples were mounted with 2.5% 1.4-diazabicyclo-(2.2.2)-octane (DABCO) and examined using a Zeiss photomicroscope equipped with epifluorescence (Zeiss, Thornwood, NY). The mean number of infected host cells was then determined using at least 400 host cells for three independent experiments run in duplicate. Only characteristic parasite nuclei and kinetoplasts were counted as surviving parasites, since irregular structures could mean parasites undergoing death (18). The drug activity was estimated by calculating the inhibition levels of the endocytic index (EI; the percentage of infected cells versus the mean number of parasites per infected cell) (15). The IC50s were averaged from at least three determinations done in duplicate.

For the analysis of the effect on epimastigotes, 5 × 106 parasites/ml were maintained as described above, harvested during exponential phase of growth (5-day-old culture forms), and incubated at 28°C for up to 96 h in LIT medium in the presence or absence (control samples) of increasing doses of DB766 (0 to 32 μM) and Bz (0 to 250 μM) (40). After daily quantification using a Neubauer chamber, the IC50s were averaged from at least three determinations done in duplicate.

Transmission electron microscopy (TEM) analysis.

For TEM analysis, BT were treated for 2 to 24 h at 37°C with DB766 at the concentration of its IC50, rinsed with phosphate-buffered saline (PBS), fixed for 60 min at 4°C with 2.5% glutaraldehyde diluted in 0.1 M cacodylate buffer, pH 7.2, and postfixed for 1 h at 4°C with 1% OsO4 and 0.8% potassium ferricyanide using the same buffer. The parasites were dehydrated in a graded series of acetone and finally embedded in Epon. Sections were stained with uranyl acetate and lead citrate and examined using a Jeol JEM-1011 electron microscope (15).

Fluorescence microscopy analysis.

For fluorescence analysis, BT (3 × 106 cells/ml) were incubated with 10 μg/ml DB766. Subsequently, the parasites were washed and mounted with 2.5% DABCO, and the fluorescence was analyzed with a Zeiss photomicroscope equipped with epifluorescence (Zeiss Inc., Thornwood, NY). The fluorescence intensity was determined using the program ImageJ 1.41 (NIH, Bethesda, MD) by the sum of the fluorescent pixel values in the selections (nuclear DNA [nDNA] and kinetoplast DNA [kDNA]). The results were expressed as kDNA/nDNA ratios that reflect the partition of kDNA and nDNA fluorescence measurements of at least 50 individual parasites (14).

Mouse infection and treatment schemes.

Five- to seven-week-old female and male C3H/He (H-2k) mice and eight-week-old male Swiss mice were obtained from the animal facilities of Fundação Oswaldo Cruz (CECAL; Rio de Janeiro, Brazil). All animal procedures were previously approved and carried out in accordance with the guidelines established by the FIOCRUZ Committee of Ethics for the Use of Animals (CEUA L-028/09, L-371/07, and L-486/08).

Mice were housed at a maximum of 8 per cage and kept in a specific-pathogen-free (SPF) room at 20 to 24°C under a 12-h light/12-h dark cycle and provided with sterilized water and chow ad libitum. Infection was performed by intraperitoneal (i.p.) injection of 102 or 5 × 103 bloodstream forms of the Colombian strain in C3H/He (H-2k) mice, a model that reproduces features of the CCC strain (35) and of 104 Y strains in Swiss mice (19).

The animals were divided into the following groups: uninfected (noninfected and nontreated); untreated (infected but nontreated); and treated (infected and treated with up to 100 mg/kg/day DB766 or with 100 mg/kg/day Bz [15, 20]). Swiss and C3H/He (H-2k) mice received 0.2 and 0.1 ml by i.p. dosing, respectively, or 0.1 ml by the oral route (gavage) of DB766 at 5 and 8 days postinfection (dpi) (Y strain), at the parasitemia onset (21 dpi and 5 dpi for the Colombian and Y strains, respectively), and then daily or every other day (e.o.d.) for 10 treatments. For the Bz treatment, the infected mice received 0.1 ml by gavage by following the same therapeutic schemes as described above. In all assays, only mice with positive parasitemia were used to compose the experimental groups (n ≥ 6 animals per group).

Mouse acute toxicity.

In order to determine the maximum tolerated dose (MTD) of DB766 for in vivo testing against T. cruzi, 8- to 10-week-old female and male Swiss Webster and C3H/He (H-2k) mice were used. On day 1, each animal was i.p. injected with DB766 every 2 h with an increasing dose of the compound, starting at 5 mg/kg. After 2 h, an additional 15 mg/kg was applied (resulting in a cumulative dose of 20 mg/kg). After a further 2 h, 30 mg/kg was applied (cumulative dose = 50 mg/kg), after another 2 h, 50 mg/kg was applied (cumulative dose = 100 mg/kg), and finally, after another 2 h, 100 mg/kg was applied (cumulative dose = 200 mg/kg). On days 2 and 3, mice were inspected for toxic and subtoxic symptoms, according to OECD (Organisation for Economic Co-operation and Development) guidelines. Forty-eight hours after drug injection, the MTD was determined. The MTD of Bz was also evaluated as described above.

Parasitemia, mortality rate, and ponderal curve analyses.

The level of parasitemia was checked by using the Pizzi-Brener method (8). Body weight was evaluated at 0 to 120 dpi, and the mortality was checked daily and expressed as a percentage of cumulative mortality (percent CM) (15, 20).

Electrocardiography (ECG).

ECG recording and analysis were performed as previously described (15, 19). Briefly, mice were placed under stable sedation with diazepam (20 mg/kg i.p.) and fixed in the supine position, and eight-lead ECGs were recorded from 18-gauge needle electrodes subcutaneously implanted in each limb and two electrodes at precordial position lead II. The electrocardiographic tracings were obtained with a standard lead (dipolar lead DII), recording with amplitude set to give 2 mV/1 s. ECG was recorded by using band-pass filtering (Bio Amp; AD Instruments, Hastings, United Kingdom) between 0.1 and 100 Hz. Supplemental amplification and analog-digital conversion was performed with a PowerLab 16S instrument (AD Instruments, Hastings, United Kingdom). Digital recordings (16 bit, 4 kHz/channel) were analyzed with the Scope (version 3.6.10) program (AD Instruments). The signal-averaged ECG (SAECG) was calculated by using the mouse SAECG extension (version 1.2) program (AD Instruments) and a template-matching algorithm. The ECG parameter was evaluated using the following standard criteria: the heart rate was monitored by beats per minute.

Histopathological analysis.

Heart tissue was removed, cut longitudinally, rinsed in ice-cold PBS, and fixed in Millonig-Rosman solution (10% formaldehyde in PBS). The tissue was dehydrated and embedded in paraffin. Sections (3 μm) were stained by hematoxylin and eosin and analyzed by light microscopy. The numbers of amastigote nests and inflammatory infiltrates (more than 10 mononuclear cells) were determined with at least 100 fields (total magnification, 4×) for each slide. The mean number of amastigote nests or inflammatory infiltrates per field was determined from at least three mice per group, with three sections from each mouse.

Biochemical analysis.

At different times of infection, mouse blood was collected and immediately submitted for determination of glutamate pyruvate transaminase (GPT) and creatine kinase (CK) using the Reflotron system (Roche Diagnostics, F. Hoffmann-La Roche Ltd., Basel, Switzerland) (53).

Cure assessment.

Cure criteria were based on the following two parasitological methods: PCR and hemoculture assays, which detect parasite kDNA minicircle-specific sequences or the parasite itself, respectively. Animals presenting negative results by both tests were considered cured. Briefly, 60 days after drug treatment, 1,000 μl of blood was collected from the hearts of anesthetized mice, and then 500, 200, and 250 μl were used for PCR, hemoculture, and biochemical analyses, respectively. For PCR, the blood was diluted in a 1:3 volume of guanidine solution (guanidine-HCl [6 M]/EDTA [0.2 M]) and heated for 90 s in boiling water in order to cleave the parasite kDNA network (10). The PCR was performed using primers (5′AAATAATGTACGGG[T/G]GAGATGCATGA3′ and 5′GGTTCGATTGGGGTTGGTGTAATATA3′), which amplify a 330-bp sequence from the kinetoplast DNA (approximately 120,000 copies/parasite), as previously described by Wincker et al. (1994) (73). The PCR was carried out using GeneAmp PCR system 9700 (Applied Biosystems) as follows: one step at 94°C for 3 min (to activate the Taq DNA polymerase), 2 cycles at 98°C for 1 min and 64°C for 2 min, 38 cycles at 94°C for 1 min and 64°C for 1 min, followed by a final extension at 72°C for 10 min. The amplification products were detected on a 1.50% agarose gel electrophoresis following staining with ethidium bromide (5 mg/ml). For hemoculture, 200 μl of blood was added to 5 ml LIT medium, incubated at 28°C for 60 days, and weekly examined by light microscopy to detect epimastigote forms (28). Only negative hemoculture samples were further screened by PCR analysis.

Statistical analysis.

Statistical analysis was carried out using Student's t test, with the level of significance set at P values of <0.05. The data represent means ± standard deviations from 3 experiments run in duplicate.


The incubation of BT (Y strain) for 2 h in the presence (4°C) or absence (37°C) of 96% mouse blood resulted in a dose-dependent effect, yielding IC50s of 1.14 ± 0.05 and 0.56 ± 0.03 μM, respectively (Fig. (Fig.22 A and B). After 24 h of treatment, DB766 was highly effective, giving IC50s of 0.11 ± 0.07 μM and 0.060 ± 0.004 μM after incubation at 4°C and 37°C, respectively (Fig. 2A and B). The activity of this AIA and that of furamidine (DB75) against BT were further studied in another set of assays employing parasite strains with different patterns of natural resistance to Bz and Nif, including a CL-susceptible pattern and Colombian- and YuYu-resistant patterns, which were compared to those of parasites from the moderately resistant Y strain (28). The incubation at 4°C with the compounds diluted in 50% mouse blood showed that no significant effect was found with DB75 (IC50 > 32 μM) (Table (Table2).2). However, treatment with DB766 resulted in striking activity, regardless of the drug resistance phenotype of the strain. The IC50s of DB766 yielded values of ≤1 μM (Table (Table2),2), which were about 30-fold lower than that of gentian violet (30.6 μM) (data not shown). Also, DB766 was equally active upon epimastigote forms from eight different T. cruzi stocks obtained from peridomiciliar and sylvatic triatomines and from a sylvatic mammalian host (D. marsupialis) (Table (Table3).3). DB766 was more active than Bz against all parasite stocks (Table (Table3).3). It is worth noting that while treatment of the 855 and 875 strains with DB766 gave IC90 values of 0.33 ± 0.03 μM and 0.24 ± 0.09 μM, the treatment of those with Bz gave values of 225.6 ± 9.41 μM and 195.7 ± 73.8 μM, respectively (Table (Table33).

FIG. 2.
Activity of DB766 upon bloodstream and intracellular forms of Trypanosoma cruzi (Y strain) in vitro. (A, B) Activity of DB766 upon bloodstream trypomastigotes during the treatment at 4°C with the drug diluted with 96% of mouse blood (A) ...
In vitro activity of DB766 and DB75 upon bloodstream trypomastigotes from different T. cruzi stocks
In vitro activity of DB766 and Bz upon epimastigotes from different T. cruzi stocks

Prior to assessing the activity of DB766 on T. cruzi-infected cardiomyocytes, its threshold for toxicity on mammalian cells was determined by MTT. LC50s were higher than 32 and 16.42 μM after 24 and 72 h of DB766 incubation, respectively. Morphological and biochemical findings (dosage of CK-MB) confirmed the toxicity of DB766 only in doses greater than 10.6 μM (data not shown). This value became the highest drug concentration used in the tests with T. cruzi-infected CM. DB766 also proved to be extremely potent against intracellular forms (Y strain), yielding an IC50 of 0.025 ± 0.006 μM after 72 h of drug treatment, which corresponds to 96 h of infection (Fig. 2C to F).

Due to the characteristic fluorescence of DB766, it was possible to follow its subcellular distribution in T. cruzi. This arylimidamide accumulated in the nuclei and kDNA of the parasites (Fig. (Fig.33 A). Since consistently higher labeling was found in the kDNA compared to that found in the parasite nuclei, the accumulation of 10 μg/ml DB766 was evaluated in both of the DNA-enriched structures over a period of time, and the results were expressed as kDNA/nDNA ratios (14). Our data showed a statistically significant (P = 0.003) time-dependent increase in kDNA binding compared to that in the nucleus, reaching ratio values of 2.1 ± 0.5 after 60 min of drug exposure (Fig. (Fig.3A,3A, inset).

FIG. 3.
Fluorescent and transmission electron microscopy analyses of the effect of DB766 on trypomastigotes of T. cruzi. Differential interference contrast (A) and fluorescent (B) analyses showing intracellular localization within bloodstream trypomastigotes ...

To further explore the parasite targets of DB766, TEM studies were performed with BT treated for 2 and 24 h. Our findings showed that even after short periods of incubation, the main and highly consistent ultrastructural alteration was related to the parasite nucleus and, importantly, to the mitochondria, with considerable mitochondrial swelling and crista dilation (Fig. 3D and E).

Our first in vivo approach evaluated DB766 and Bz acute toxicity in C3H/He (H-2k) mice and female and male Swiss mice. The administration of increasing doses of both drugs up to 200 mg/kg induced neither mortality nor major detectable toxic side effects up to 48 h after drug injection, except weight loss that reached about 10% and 7% in male Swiss mice treated with DB766 and Bz, respectively (data not shown).

DB766 activity was first assayed in Swiss mice inoculated with 104 bloodstream parasites (Y strain) using two doses (25 and 50 mg/kg/day i.p.) at the onset (5 dpi) and at the parasitemia peak (8 dpi). In parallel, a control group was orally (p.o.) treated with Bz (100 mg/kg/day) as the reference drug. DB766 was highly active in vivo. When infected mice were treated for only 2 days with 25 and 50 mg/kg/day, the peak load of circulating parasites (at 8 dpi) was reduced by 78% and 88%, respectively, showing animal survival rates (at 120 dpi) of 100 and 88%, respectively, in comparison with a survival rate of 37.5% in the infected and untreated group (Fig. (Fig.44 A and B). As this treatment regimen did not result in a parasitological cure, as evaluated by both hemocultive and PCR assays of all surviving mice, including Bz-treated animals (data not shown), we extended the treatment to a 10-day regimen, starting at the parasitemia onset (5 dpi) and continuing for 10 consecutive daily doses. DB766 at 25 and 50 mg/kg/day led to a reduction of the levels of parasitemia at the peak (8 dpi) by 88% and 98%, respectively (Fig. (Fig.4C).4C). Furthermore, the survival rate was 100% at 120 dpi (Fig. (Fig.4D).4D). The analysis of body weight showed that the animals treated with both doses of DB766 recovered the body weight loss induced by the parasite infection at a lower rate than with Bz treatment (data not shown).

FIG. 4.
Effect of DB766 in T. cruzi infection (Y strain) in vivo. The activity of 25 and 50 mg/kg/day DB766 (i.p.) and 100 mg/kg/day benznidazole (by p.o. gavage) was evaluated upon T. cruzi infection in male Swiss mice inoculated with 104 bloodstream trypomastigotes, ...

Next, the later dosing scheme was adopted for mice infected with 102 and 103 bloodstream trypomastigotes of the Colombian strain, starting treatment at the onset of parasitemia (21 dpi) (Fig. (Fig.5).5). A striking decrease in parasitemia occurred in mice infected with 102 organisms when both doses were tested by an i.p. route, reaching about 73% reduction in the mean number of parasites using the 25 mg/kg/day dose (parasitemia peaked at 44 dpi) compared to that in untreated mice, which displayed 468 ± 219 × 104 parasites/ml at the parasitemia peak (44 dpi) (Fig. (Fig.5A).5A). Mice treated with 100 mg/kg/day Bz or 50 mg/kg/day DB766 presented a delayed parasitemia peak (59 dpi), reaching maximum levels of 54 ± 34 and 33 ± 36 × 104 parasites/ml, respectively (Fig. (Fig.5A).5A). At 120 dpi, Bz-treated mice present increased GPT levels, while neither doses of DB766 caused hepatic alterations (data not shown) Similar to the finding observed during the infection with the Y strain, animals of both dosage groups of DB766 did not recover the body weight loss induced by the Colombian infection at the same rate as those treated with Bz (data not shown).

FIG. 5.
Effect of DB766 on T. cruzi infection (Colombian strain) in vivo. Activity of 25 and 50 mg/kg/day DB766 and 100 mg/kg/day benznidazole upon parasitemia curves of T. cruzi infection in female C3H mice inoculated with 102 (A) and 103 (B, C) bloodstream ...

The i.p. administration of DB766 at 25 and 50 mg/kg/day for 10 consecutive days also proved effective for controlling parasitemia in mice infected with 103 trypomastigotes of the Colombian strain, leading to a profound reduction in the mean number of circulating parasites (Fig. (Fig.5B).5B). At 41 dpi (parasitemia peak), 50 mg/kg/day DB766 showed efficacy similar to that of Bz (Fig. (Fig.5B).5B). However, when Colombian strain-infected mice were orally treated with DB766, neither dose reduced parasitemia (Fig. (Fig.5C).5C). Next, oral administration of DB766 at a higher dose (100 mg/kg/day) was given for 10 days, for comparison with the i.p. administration. At this dose, oral administration of DB766 presented activity similar to that of Bz. At 31 dpi, a strong reduction of parasitemia—98% for DB766 p.o. and 99% for Bz—was observed, resulting in 100% survival, while all the infected and untreated mice were dead at day 120 (Fig. (Fig.66 A and B). Treatment with DB766 by the i.p. route, although showing an impressive parasitemia reduction (>99%), led to the survival of only 60% of the animals (Fig. 6A and B). Additionally, i.p. administration of 100 mg/kg/day DB766 profoundly decreased cardiac parasitism and inflammation at 43 dpi, showing 95%- and 75%-higher reduction in both parameters, respectively, compared to that of the infected and Bz-treated mouse groups (Fig. 6C and D). Interestingly, while Bz-treated mice displayed an increase of 68% in CK, treatment with DB766 by both routes showed enzyme levels similar to those of the uninfected group (Fig. (Fig.6E).6E). ECG analysis also showed that DB766, by both routes, but not Bz, yielded heart rate levels similar to those of the uninfected group (Fig. (Fig.6F).6F). In addition, dosing of DB766 by both routes did not significantly alter GPT plasma levels compared to that of the uninfected group, while the reference drug showed an enhancement of 54% (Fig. (Fig.6G).6G). The mice treated with DB766, by both routes did not recover the weight loss induced by the parasite infection at the same rates as those treated with Bz (Fig. (Fig.6H6H).

FIG. 6.
Effect of daily administration of DB766 on T. cruzi infection in vivo. Activity of 100 mg/kg/day DB766 (i.p. and p.o.) and benznidazole (p.o.) upon T. cruzi infection in male C3H mice inoculated with 5 × 103 bloodstream trypomastigotes (Colombian ...

Since i.p. treatment with 100 mg/kg/day DB766 led to a reduction in circulating and cardiac parasitism superior to that of Bz, but it failed to provide 100% protection against mouse mortality, and this AIA yields long half-lives and large volumes of distribution (M. Z. Wang, unpublished data), our next step was to evaluate whether DB766 administration on every other day (e.o.d.; total of 5 doses, with each dose given every 48 h) could retain the efficacy and improve animal survival by reducing possible drug toxicity. Our data showed that administration (i.p.) of 100 mg/kg/day DB766 for 10 alternated days resulted in a strong reduction in parasitemia levels (Y strain), reaching >98% of inhibition while Bz provided only a 79.4% reduction (Fig. (Fig.77 A). Histopathological analysis performed at 14 dpi confirmed the high efficacy of DB766 that importantly reduced cardiac parasitism (94%) and inflammation (78%), giving results similar to those for Bz use (Fig. 7C and D). Biochemical analysis of CK and GPT levels at 14 dpi showed that under this therapy scheme, DB766 and Bz were able to protect against muscle (Fig. (Fig.7E)7E) and hepatic (Fig. (Fig.7F)7F) lesions induced by parasite infection. Although this scheme of treatment also led to complete recovery of the body weight loss induced by the infection (Fig. (Fig.7G),7G), DB766 treatment protected 80% of the animals against mortality, whereas Bz protected 100% of them (Fig. (Fig.7B7B).

FIG. 7.
Effect of e.o.d. treatment of DB766 on T. cruzi infection in vivo. Activity of 100 mg/kg/day DB766 (i.p.) and benznidazole (p.o.) upon T. cruzi infection in male Swiss mice inoculated with 104 bloodstream trypomastigotes (Y strain) and treated e.o.d., ...

Finally, although DB766 and Bz presented remarkable efficacy in reducing parasitemia and mortality rates even against the naturally Bz-resistant Colombian strain, in all schemes (i.p. and p.o.; daily and e.o.d. dosing), both drugs failed to induce parasitological cure, as evaluated by light microscopy, hemoculture, and PCR analyses (data not shown).


It has been suggested that the ideal drug for CD etiological treatment should fulfill the following requirements: (i) be orally effective against the acute and chronic phases of infection, using a single or few doses (treatment regimen under 60 days); (ii) exert no toxicity to the patients; (iii) provide pediatric formulation; (iv) be active against a broad panel of T. cruzi stocks and lineages; and (v) be effective against bloodstream trypomastigotes, inhibiting the invasion of new cells, and upon intracellularly dividing amastigotes, preventing the release of new infective parasites (6, 38, 51). In the present study, experimental assays were designed in order to address these requirements, considering the complexity of the parasite biology. Therefore, we investigated the DB766 activity through in vitro and in vivo assays using highly stringent protocols, evaluating the toxicity on mammalian cells and the efficacy against amastigote and trypomastigote forms, on different parasite strains (including Bz-susceptible and -resistant stocks), and through short schemes and routes of treatment in vivo. With the goal of establishing a head-to-head comparison of efficacy and toxicity between Bz and DB766, similar therapeutic schemes were employed.

Our analysis confirmed previous reports regarding the excellent activity of AIAs in vitro against T. cruzi (46, 54, 55) and Leishmania spp. (52), being superior to that of aromatic diamidines (18, 52). As observed in this study with DB766, AIAs display low toxicity on mammalian cells and are highly active at nanomolar doses against both BT and amastigotes (Y strain) as little as 2 h after drug treatment. AIAs also retain the activity at 4°C in the presence of blood constituents, thus having potential use in blood banks (55). In this regard, DB766 showed an activity that was 30.6-fold higher than that of gentian violet, a reference drug for blood therapy in CD. In addition, DB766 was active against parasite isolates that circulate in peridomiciliar and sylvatic ecotopes in the following two different regions in Brazil: (i) the northeast (Jaguaribe Valley, Ceará state), which represents an important area for CD surveillance, where high rates of natural triatomine infection are observed (mostly T. cruzi type I lineage) (M. M. Lima, unpublished data) and vectorial control still requires effort to avoid new cases of human transmission (2, 21), and (ii) the Amazon region, which presents an important new epidemiologic challenge due to the increasing reports of human acute cases, mainly by oral contamination as well as by wild triatomine vectorial transmission (1).

Since several strains of T. cruzi exhibit different levels of resistance to Nif and Bz, and this variability may partially explain the observed differences in effectiveness of chemotherapy involving these two compounds (9, 51, 60), further in vitro studies were performed comparing the activities of DB766 and BT on T. cruzi strains that present naturally Bz-susceptible (CL), -moderate (Y), and -resistant (Colombian and YuYu) profiles. Here we have documented the high trypanocidal activity of DB766, regardless of the drug resistance profile. The significant activity of DB766 upon several parasite strains represents a very important finding, since T. cruzi comprises numerous clonal populations with distinct characteristics, such as different sensitivity to Nf and Bz, diverse biological parameters, and enzymatic diversity (26, 28, 43, 47-49). In addition, strain heterogeneity may also be related to the different clinical manifestations and outcomes in CD (3, 38).

Interestingly, DB766 presented higher efficacy than DB75, confirming that the activity of AIAs is superior to that of AD on T. cruzi (46, 55). This improved activity of AIAs compared to that of AD may be due to differences in their physical properties, as follows: while AD are highly basic molecules, with a pKa of near 11, the AIA pKa is near 7. Therefore, at physiological pH, amidines are protonated and, thus, cationic molecules, while the AIAs are essentially neutral molecules, enabling their passive diffusion through membranes of both parasite and host cells. This large difference in physical properties probably affects absorption and distribution and likely plays an important role in the differences in activity of these two classes of compounds (5).

The fluorescent and transmission electron microscopy studies showed that DB766 is localized in the parasite nucleus and in kDNA, accumulating in larger amounts in the latter structure. The AIAs promoted ultrastructural alterations in the mitochondrial cristae. Our data corroborate with previous studies with AD and AIAs performed with Leishmania spp. (13, 29, 33), T. cruzi (15, 18, 46, 54), and Trypanosoma brucei (37). These results suggest that DB766 may act on the mitochondrion-kinetoplast complex, although other cellular targets cannot be excluded and further biochemical studies are needed.

Our in vitro results show the excellent activity of DB766 against different T. cruzi strains, with efficacy superior to those of Bz and gentian violet. The outstanding selectivity index, ranging between >533 (for BT, Y strain) and 714 (for amastigotes, Y strain), is at least 10-fold higher than the 50-fold index proposed by Nwaka and Hudson (44). All together, these data justify further studies in vivo employing different models of experimental T. cruzi infection. Since no major acute toxicity was noted with uninfected mice treated by DB766, we moved to using models of experimental T. cruzi infection. In these studies, the stringency level was increased after initially evaluating the effect upon the Y strain and then advancing to the Colombian strain experimental model. The evaluation of the effects of DB766 was performed using a combination of parasitological, biochemical, clinical, and histopathological tests, which allowed for a thorough investigation of its activity and toxicity.

Previous results demonstrated that AD such as DB569 (20) and DB1362 (15), although not affecting the parasitemia, reduced the cardiac parasitism and inflammation and downmodulated the expression of CD8+ T cells in heart tissue (19). While both of the AD showed lower trypanocidal efficacy than Bz, DB766 presented activity similar or even superior to that of this reference drug, resulting in 100% protection against mortality, depending on the therapy scheme used. This protection in DB766-treated mice is likely derived from the reduction of tissular lesions (e.g., cardiac and hepatic), resulting from a decrease in the parasite load itself and/or the lower inflammation levels (36). In fact, reduced plasma levels of CK and GPT were consistently found in DB766-treated mice. Furthermore, DB766 also reversed the ECG alterations induced by the parasite infection, corroborating previous data on diamidines (15, 19).

Since T. cruzi is an obligatory intracellular parasite and reservoirs of amastigotes can be found in quite distinct organs and tissues, the ability of AIAs such as DB766 to traverse host cell membranes possibly by passive diffusion and or use of transporters (4, 17), along with their extensive tissue binding in the liver, spleen, and heart (71), makes this class of compounds very attractive for CD treatment. In fact, DB766 proved to be quite effective against intracellular amastigotes, which are considered the main stage for drug targeting (38). The effectiveness of AIAs like DB766 in eradicating intracellular parasites probably is related to their pharmacokinetic properties, including long half-lives and large volumes of distribution (71). These pharmacokinetic characteristics of DB766 are especially relevant, since the poor activity of the nitroheterocyclic compounds during the chronic stages of CD may be related to their unfavorable pharmacokinetic properties, such as relatively short half-lives and limited tissue penetration (69).

Oral administration of DB766 at 100 mg/kg/day showed good efficacy, with reduced circulating and cardiac parasitism, decreased CK and GPT levels, prevention of electric abnormalities induced by the parasite infection, and significantly reduced mouse mortality without major side effects. These data suggest that sufficient quantities of this AIA were absorbed from the mouse gastrointestinal tract, thus effectively delivering DB766 molecules across the gut mucosa, similar to the results reported for the AD prodrug DB289 (32, 67, 68).

The only overt adverse effect noted for DB766 was moderate body weight loss, which may be the cause of the lower animal survival rate (about 60%) found during the administration of 100 mg/kg/day DB766 by the i.p. route. Nevertheless, this dosing resulted in almost undetectable parasite levels in blood and heart and trypanocidal efficacy superior to that of Bz. With the goal of maintaining this superior efficacy but reducing possible drug toxicity, as well as taking into consideration the extensive tissue binding and the relatively long half-life of DB766, we evaluated the effect of 100 mg/kg/day of this AIA through i.p. administration every other day. We found that in addition to keeping the high trypanocidal efficacy, mouse weight recovery at levels similar to those of Bz and uninfected mouse groups was achieved. Using the e.o.d. therapy of DB766, the mouse survival rates improved to 80%. However, the survival rates with this dosage scheme did not reach the same levels as those of Bz and DB766 given orally. Despite these encouraging results, DB766 (using both i.p. and p.o. routes) and Bz did not provide a parasitological cure, as evaluated by the hemocultive and PCR methods. This therapeutic failure may be due to the highly stringent protocols used, which employed treatment periods of only up to 10 days. Many studies of mouse models of acute CD use treatment regimens of at least 20 days (38). A recent study demonstrated that to achieve parasitological cure with Bz, T. cruzi-infected mice were submitted to two treatment regimens (the first during the acute phase and the second during the chronic phase), employing 20 days of drug administration each (12). The encouraging results with DB766 via i.p. administration of up to 50 mg/kg/day and p.o. administration of 100 mg/kg/day merit further studies using longer periods of e.o.d. treatment or combination therapy with Bz, which are now under way.

In conclusion, our in vitro and in vivo data validate the further exploration of DB766 and other AIAs as new potential candidates for CD therapy. As for any new drug, extensive pharmacological and safety studies are required before advancing to clinical trials. Synthesis and evaluation of new AIAs, together with critical information regarding pK/metabolism, will hopefully lead to the identification of improved candidates for the treatment of Chagas' disease.


This work was supported by grants from Fundação Carlos Chagas Filho de Amparo a Pesquisa do Estado do Rio de Janeiro, Fundação de Amparo á Pesquisa do Estado de Minas Gerais (FAPEMIG), Instituto Oswaldo Cruz-Fundação Oswaldo Cruz (IOC-FIOCRUZ), Conselho Nacional Desenvolvimento Científico e Tecnológico (CNPq), Programa estratégico de apoio à pesquisa em saúde V/Fundação Oswaldo Cruz (PAPES V e PDTIS/FIOCRUZ), and the Consortium for Parasitic Drug Development (CPDD) and in part by FAPERJ (grant E-26/111.756/2008). Funding to D.W.B. by the Bill and Melinda Gates Foundation is gratefully acknowledged. M.D.N.C.S., J.L.-V., C.C.B., and A.J.R. are research fellows of the CNPq.

We thank Solange L. de Castro (Laboratório de Biologia Celular/IOC/Fiocruz) for careful revision of the manuscript.


[down-pointing small open triangle]Published ahead of print on 10 May 2010.


1. Aguilar, H. M., F. Abad-Franch, J. C. Dias, A. C. Junqueira, and J. R. Coura. 2007. Chagas disease in the Amazon region. Mem. Inst. Oswaldo Cruz 102(Suppl. 1):47-56. [PubMed]
2. Alencar, J. E. 1987. Historia Natural da Doença de Chagas no Estado do Ceará. Ph.D. thesis. Universidade Federal do Ceará, Fortaleza, Brazil.
3. Andrade, L. O., C. R. Machado, E. Chiari, S. D. Pena, and A. M. Macedo. 1999. Differential tissue distribution of diverse clones of Trypanosoma cruzi in infected mice. Mol. Biochem. Parasitol. 100:163-172. [PubMed]
4. Basselin, M., F. Lawrence, and M. Robert-Gero. 1996. Pentamidine uptake in Leishmania donovani and Leishmania amazonensis promastigotes and axenic amastigotes. Biochem. J. 315:631-634. [PubMed]
5. Batista, D. G. J., M. G. O. Pacheco, A. Kumar, D. Branowska, M. Ismail, L. Hu, D. W. Boykin, and M. N. Soeiro. 2009. Biological, ultrastructural effect and subcellular localization of aromatic diamidines in Trypanosoma cruzi. Parasitology 21:1-9. [PubMed]
6. Bettiol, E., M. Samanovic, A. S. Murkin, J. Raper, F. Buckner, and A. Rodriguez. 2009. Identification of three classes of heteroaromatic compounds with activity against intracellular Trypanosoma cruzi by chemical library screening. PLoS Negl. Trop. Dis. 3:e384. [PMC free article] [PubMed]
7. Bilate, A. M., and E. Cunha-Neto. 2008. Chagas disease cardiomyopathy: current concepts of an old disease. Rev. Inst. Med. Trop. São Paulo 50:67-74. [PubMed]
8. Brener, Z. 1962. Therapeutic activity and criterion of cure on mice experimentally infected with Trypanosoma cruzi. Rev. Inst. Med. Trop. São Paulo 4:389-396. [PubMed]
9. Britto, C. C. 2009. Usefulness of PCR-based assays to assess drug efficacy in Chagas disease chemotherapy: value and limitations. Mem. Inst. Oswaldo Cruz 104(Suppl. I):122-135. [PubMed]
10. Britto, C., M. A. Cardoso, P. Wincker, and C. M. Morel. 1993. A simple protocol for the physical cleavage of Trypanosoma cruzi kinetoplast DNA present in blood samples and its use in polymerase chain reaction (PCR)-based diagnosis of chronic Chagas disease. Mem. Inst. Oswaldo Cruz 88:171-172. [PubMed]
11. Bronfen, E., F. S. de Assis Rocha, G. B. Machado, M. M. Perillo, A. J. Romanha, and E. Chiari. 1989. Isolation of Trypanosoma cruzi samples by xenodiagnosis and hemoculture from patients with chronic Chagas' disease. Mem. Inst. Oswaldo Cruz 84:237-240. [PubMed]
12. Bustamante, J. M., L. M. Bixby, and R. L. Tarleton. 2008. Drug-induced cure drives conversion to a stable and protective CD8+ T central memory response in chronic Chagas disease. Nat. Med. 14:542-550. [PMC free article] [PubMed]
13. Croft, S. L., and R. P. Brazil. 1982. Effect of pentamidine isethionate on the ultrastructure and morphology of Leishmania mexicana amazonensis in vitro. Ann. Trop. Med. Parasitol. 76:37-43. [PubMed]
14. Daliry, A., P. B. Silva, C. F. Silva, M. M. Batista, S. L. de Castro, R. R. Tidwell, and M. N. Soeiro. 2009. In vitro analyses of the effect of aromatic diamidines upon Trypanosoma cruzi. J. Antimicrob. Chemother. 64:747-750. [PubMed]
15. da Silva, C. F., M. M. Batista, D. G. J. Batista, E. M. De Souza, P. B. da Silva, G. M. de Oliveira, A. S. Meuser, A. R. Shareef, D. W. Boykin, and M. N. Soeiro. 2008. In vitro and in vivo studies of the trypanocidal activity of a diarylthiophene diamidine against Trypanosoma cruzi. Antimicrob. Agents Chemother. 52:3307-3314. [PMC free article] [PubMed]
16. de Castro, S. L., M. N. C. Soeiro, K. O. Higashi, and M. N. L. Meirelles. 1993. Differential effect of amphotericin B on the three evolutive stages of Trypanosoma cruzi and on the host cell-parasite interaction. Braz. J. Med. Biol. Res. 26:1219-1229. [PubMed]
17. de Koning, H. P., D. J. Bridges, and R. J. Burchmore. 2005. Purine and pyrimidine transport in pathogenic protozoa: from biology to therapy. FEMS Microbiol. Rev. 29:987-1020. [PubMed]
18. De Souza, E. M., A. Lansiaux, C. Bailly, W. D. Wilson, Q. Hu, D. W. Boykin, M. M. Batista, T. C. Araújo-Jorge, and M. N. Soeiro. 2004. Phenyl substitution of furamidine markedly potentiates its anti-parasitic activity against Trypanosoma cruzi and Leishmania amazonensis. Biochem. Pharmacol. 68:593-600. [PubMed]
19. De Souza, E. M., G. M. Oliveira, and M. N. C. Soeiro. 2007. Electrocardiographic finding in acutely and chronically Trypanosoma cruzi-infected mice treated by a phenyl-substituted analogue of Furamidine DB569. Drug Target Insights 2:61-69. [PMC free article] [PubMed]
20. de Souza, E. M., G. M. Oliveira, D. W. Boykin, A. Kumar, Q. Hu, and M. N. C. Soeiro. 2006. Trypanocidal activity of the phenyl-substituted analogue of furamidine DB569 against Trypanosoma cruzi infection in vivo. J. Antimicrob. Chemother. 58:610-614. [PubMed]
21. Dias, J. C. 2007. Southern Cone Initiative for the elimination of domestic populations of Triatoma infestans and the interruption of transfusion Chagas disease: historical aspects, present situation, and perspectives. Mem. Inst. Oswaldo Cruz 102:11-18. [PubMed]
22. Dias, J. C. P. 2009. Elimination of Chagas disease transmission: perspectives. Mem. Inst. Oswaldo Cruz 104(Suppl. I):41-45. [PubMed]
23. Dias, J. C., A. C. Silveira, and C. J. Schofield. 2002. The impact of Chagas disease control in Latin America: a review. Mem. Inst. Oswaldo Cruz 97:603-612. [PubMed]
24. Dias, J. C., A. Prata, and D. Correia. 2008. Problems and perspectives for Chagas disease control: in search of a realistic analysis. Rev. Soc. Bras. Med. Trop. 41:193-196. [PubMed]
25. dos Santos, P. V., E. Roffê, H. C. Santiago, R. A. Torres, A. P. Marino, C. N. Paiva, A. A. Silva, R. T. Gazzinelli, and J. Lannes-Vieira. 2001. Prevalence of CD8(+)alpha beta T cells in Trypanosoma cruzi-elicited myocarditis is associated with acquisition of CD62L(low)LFA-1(high)VLA-4(high) activation phenotype and expression of IFN-gamma-inducible adhesion and chemoattractant molecules. Microbes Infect. 3:971-984. [PubMed]
26. Dvorak, J. A. 1984. The natural heterogeneity of Trypanosoma cruzi: biological and medical implications. J. Cell. Biochem. 24:357-371. [PubMed]
27. Fernandes, O., R. P. Souto, J. A. Castro, J. B. Pereira, N. C. Fernandes, A. C. Junqueira, R. D. Naiff, T. V. Barrett, W. Degrave, B. Zingales, D. A. Campbell, and J. R. Coura. 1998. Brazilian isolates of Trypanosoma cruzi from humans and triatomines classified into two lineages using mini-exon and ribosomal RNA sequences. Am. J. Trop. Med. Hyg. 58:807-811. [PubMed]
28. Filardi, L. S., and Z. Brener. 1987. Susceptibility and natural resistance of Trypanosoma cruzi strains to drugs used clinically in Chagas disease. Trans. R. Soc. Trop. Med. Hyg. 81:755-759. [PubMed]
29. Fusai, T., Y. Boulard, R. Durand, M. Paul, C. Bories, D. Rivollet, A. Astier, R. Houin, and M. Deniau. 1997. Ultrastructural changes in parasites induced by nanoparticle-bound pentamidine in a Leishmania major/mouse model. Parasite 4:133-139. [PubMed]
30. Gascón, J., P. Albajar, E. Cañas, M. Flores, i Prat. J. Gómez, R. N. Herrera, C. A. Lafuente, H. L. Luciardi, A. Moncayo, L. Molina, J. Muñoz, S. Puente, G. Sanz, B. Treviño, and X. Sergio-Salles. 2007. Diagnosis, management and treatment of chronic Chagas' heart disease in areas where Trypanosoma cruzi infection is not endemic. Rev. Esp. Cardiol. 60:285-293. [PubMed]
31. Guerri-Guttenberg, R. A., D. R. Grana, G. Ambrosio, and J. Milei. 2008. Chagas cardiomyopathy: Europe is not spared! Eur. Heart J. 29:2587-2591. [PubMed]
32. Hall, J. E., J. E. Kerrigan, K. Ramachandran, B. C. Bender, J. P. Stanko, S. K. Jones, D. A. Patrick, and R. R. Tidwell. 1998. Anti-Pneumocystis activities of aromatic diamidoxime prodrugs. Antimicrob. Agents Chemother. 42:666-674. [PMC free article] [PubMed]
33. Hentzer, B., and T. Kobayasi. 1977. The ultrastructural changes of Leishmania tropica after treatment with pentamidine. Ann. Trop. Med. Parasitol. 71:157-166. [PubMed]
34. Ismail, M. A., R. K. Arafa, T. Wenzler, R. Brun, F. A. Tanious, W. D. Wilson, and D. W. Boykin. 2008. Synthesis and antiprotozoal activity of novel bis-benzamidino imidazo[1,2-a]pyridines and 5,6,7,8-tetrahydro-imidazo[1,2-a]pyridines. Bioorg. Med. Chem. 16:683-691. [PubMed]
35. Lannes-Vieira, J., J. C. Silverio, I. R. Pereira, N. F. Vinagre, C. M. Carvalho, C. N. Paiva, and A. A. da Silva. 2009. Chronic Trypanosoma cruzi-elicited cardiomyopathy: from the discovery to the proposal of rational therapeutic interventions targeting cell adhesion molecules and chemokine receptors—how to make a dream come true. Mem. Inst. Oswaldo Cruz 104:226-235. [PubMed]
36. Marin-Neto, J. A., E. Cunha-Neto, B. C. Maciel, and M. V. Simões. 2007. Pathogenesis of chronic Chagas heart disease. Circulation 115:1109-1123. [PubMed]
37. Mathis, A. M., A. S. Bridges, M. A. Ismail, A. Kumar, I. Francesconi, M. Anbazhagan, Q. Hu, F. A. Tanious, T. Wenzler, J. Saulter, W. D. Wilson, R. Brun, D. W. Boykin, R. R. Tidwell, and J. E. Hall. 2007. Diphenyl furans and aza analogs: effects of structural modification on in vitro activity, DNA binding, and accumulation and distribution in trypanosomes. Antimicrob. Agents Chemother. 51:2801-2810. [PMC free article] [PubMed]
38. McKerrow, J. H., P. S. Doyle, J. C. Engel, L. M. Podust, S. A. Robertson, R. Ferreira, T. Saxton, M. Arkin, and I. D. Kerr. 2009. Two approaches to discovering and developing new drugs for Chagas disease. Mem. Inst. Oswaldo Cruz 104(Suppl. I):263-269. [PubMed]
39. Meirelles, M. N., T. C. Araujo-Jorge, C. F. Miranda, W. De Souza, and H. S. Barbosa. 1986. Interaction of Trypanosoma cruzi with heart muscle cells: ultrastructural and cytochemical analysis of endocytic vacuole formation and effect upon myogenesis in vitro. Eur. J. Cell Biol. 41:198-206. [PubMed]
40. Menna-Barreto, R. F., A. Henriques-Pons, A. V. Pinto, J. A. Morgado-Diaz, M. J. Soares, and S. L. De Castro. 2005. Effect of a beta-lapachone-derived naphthoimidazole on Trypanosoma cruzi: identification of target organelles. J. Antimicrob. Chemother. 56:1034-1041. [PubMed]
41. Mosmann, T. 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods 65:55-63. [PubMed]
42. Nóbrega, A. A., M. H. Garcia, E. M. Tatto, T. Obara, E. Costa, J. Sobel, and W. N. Araújo. 2009. Oral transmission of Chagas disease by consumption of açaí palm fruit, Brazil. Emerg. Infect. Dis. 15:653-655. [PMC free article] [PubMed]
43. Nozaki, T., and J. A. Dvorak. 1993. Intraspecific diversity in the response of Trypanosoma cruzi to environmental stress. J. Parasitol. 79:451-454. [PubMed]
44. Nwaka, S., and A. Hudson. 2006. Innovative lead discovery strategies for tropical diseases. Nat. Rev. Drug Discov. 5:941-955. [PubMed]
45. Nyunt, M. M., C. W. Hendrix, R. P. Bakshi, N. Kumar, and T. A. Shapiro. 2009. Phase I/II evaluation of the prophylactic antimalarial activity of pafuramidine in healthy volunteers challenged with Plasmodium falciparum sporozoites. Am. J. Trop. Med. Hyg. 80:528-535. [PMC free article] [PubMed]
46. Pacheco, M. G., C. F. Silva, E. M. Souza, M. M. Batista, P. B. Silva, A. Kumar, C. E. Stephens, D. W. Boykin, and M. N. Soeiro. 2009. Trypanosoma cruzi: activity of heterocyclic cationic molecules in vitro. Exp. Parasitol. 123:73-80. [PubMed]
47. Pena, S. D., C. R. Machado, and A. M. Macedo. 2009. Trypanosoma cruzi: ancestral genomes and population structure. Mem. Inst. Oswaldo Cruz 104:108-114. [PubMed]
48. Postan, M., J. P. McDaniel, and J. A. Dvorak. 1984. Studies of Trypanosoma cruzi clones in inbred mice. II. Course of infection of C57BL/6 mice with single-cell-isolated stocks. Am. J. Trop. Med. Hyg. 33:236-238. [PubMed]
49. Postan, M., J. P. McDaniel, and J. A. Dvorak. 1987. Comparative studies of the infection of Lewis rats with four Trypanosoma cruzi clones. Trans. R. Soc. Trop. Med. Hyg. 81:415-419. [PubMed]
50. Rodriguez-Morales, A. J., J. A. Benitez, I. Tellez, and C. Franco-Paredes. 2008. Chagas disease screening among Latin American immigrants in non-endemic settings. Travel Med. Infect. Dis. 6:162-163. [PubMed]
51. Rodriques Coura, J., and S. L. De Castro. 2002. A critical review on Chagas disease chemotherapy. Mem. Inst. Oswaldo Cruz 97:3-24. [PubMed]
52. Rosypal, A. C., K. A. Werbovetz, M. Salem, C. E. Stephens, A. Kumar, D. W. Boykin, J. E. Hall, and R. R. Tidwell. 2008. Inhibition by dications of in vitro growth of Leishmania major and Leishmania tropica: causative agents of old world cutaneous leishmaniasis. J. Parasitol. 94:743-749. [PubMed]
53. Salomão, K., E. M. de Souza, A. Henriques-Pons, H. S. Barbosa, and S. L. de Castro. 11 March 2009, posting date. Brazilian green propolis: effects in vitro and in vivo on Trypanosoma cruzi. Evid. Based Complement. Alternat. Med. doi:.10.1093/ecam/nep014 [PMC free article] [PubMed] [Cross Ref]
54. Silva, C. F., M. B. Meuser, E. M. De Souza, M. N. Meirelles, C. E. Stephens, P. Som, D. W. Boykin, and M. N. Soeiro. 2007. Cellular effects of reversed amidines on Trypanosoma cruzi. Antimicrob. Agents Chemother. 51:3803-3809. [PMC free article] [PubMed]
55. Silva, C. F., M. M. Batista, R. A. Mota, E. M. De Souza, C. E. Stephens, P. Som, D. W. Boykin, and M. N. Soeiro. 2007. Activity of “reversed” diamidines against Trypanosoma cruzi in vitro. Biochem. Pharmacol. 73:1939-1946. [PubMed]
56. Soeiro, M. N. C., A. P. Dantas, A. Daliry, C. F. Silva, D. G. J. Batista, E. M. De Souza, G. M. Oliveira, K. Salomão, M. M. Batista, M. G. O. Pacheco, P. B. Silva, R. M. Santa-Rita, R. F. S. Menna-Barreto, D. W. Boykin, and S. L. de Castro. 2009. Experimental chemotherapy for Chagas disease: 15 years of research contributions from in vivo and in vitro studies. Mem. Inst. Oswaldo Cruz 104(Suppl. I):301-310. [PubMed]
57. Soeiro, M. N. C., E. M. De Souza, and D. W. Boykin. 2007. Anti-parasitic activity of aromatic diamidines and theirs patented literature. Expert Opin. Patent Lit. 17:927-939.
58. Soeiro, M. N. C., E. M. De Souza, C. E. Stephens, and D. W. Boykin. 2005. Aromatic diamidines as antiparasitic agents. Expert Opin. Investig. Drugs 14:957-972. [PubMed]
59. Soeiro, M. N. C., S. L. De Castro, E. M. De Souza, D. G. J. Batista, C. F. Silva, and D. W. Boykin. 2008. Diamidine activity against trypanosomes: the State of the art. Curr. Mol. Pharmacol. 1:151-161. [PubMed]
60. Soeiro, M. N., and S. L. de Castro. 2009. Trypanosoma cruzi targets for new chemotherapeutic approaches. Expert Opin. Ther. Targets 13:105-121. [PubMed]
61. Sosa-Estani, S., R. Viotti, and E. L. Segura. 2009. Therapy, diagnosis and prognosis of chronic Chagas disease: insight gained in Argentina. Mem. Inst. Oswaldo Cruz 104(Suppl. I):167-180. [PubMed]
62. Souza, E. M., A. Henriques-Pons, C. Bailly, A. Lansiaux, T. C. Araújo-Jorge, and M. N. Soeiro. 2004. In vitro measurement of enzymatic markers as a tool to detect mouse cardiomyocytes injury. Mem. Inst. Oswaldo Cruz 99:697-701. [PubMed]
63. Souza, W. 2009. Structural organization of Trypanosoma cruzi. Mem. Inst. Oswaldo Cruz 104:89-100. [PubMed]
64. Stephens, C. E., F. Tanious, S. Kim, W. D. Wilson, W. A. Schell, J. R. Perfect, S. G. Franzblau, and D. W. Boykin. 2001. Diguanidino and “reversed” diamidino 2,5-diarylfurans as antimicrobial agents. J. Med. Chem. 44:1741-1748. [PubMed]
65. Susbielle, G., R. Blattes, V. Brevet, C. Monod, and E. Käs. 2005. Target practice: aiming at satellite repeats with DNA minor groove binders. Curr. Med. Chem. Anticancer Agents 5:409-420. [PubMed]
66. Teixeira, A. R., N. Nitz, M. C. Guimaro, C. Gomes, and C. A. Santos-Buch. 2006. Chagas disease. Postgrad. Med. J. 82:788-798. [PMC free article] [PubMed]
67. Thuita, J. K., S. M. Karanja, T. Wenzler, R. E. Mdachi, J. M. Ngotho, J. M. Kagira, R. Tidwell, and R. Brun. 2008. Efficacy of the diamidine DB75 and its prodrug DB289, against murine models of human African trypanosomiasis. Acta Trop. 108:6-10. [PubMed]
68. Tidwell, R. R., S. K. Jones, J. D. Geratz, K. A. Ohemeng, M. Cory, and J. E. Hall. 1990. Analogues of 1,5-bis(4-amidinophenoxy)pentane (pentamidine) in the treatment of experimental Pneumocystis carinii pneumonia. J. Med. Chem. 33:1252-1257. [PubMed]
69. Urbina, J. A. 2009. Ergosterol biosynthesis and drug development for Chagas disease. Mem. Inst. Oswaldo Cruz 104(Suppl. I):311-318. [PubMed]
70. Viotti, R., C. Vigliano, B. Lococo, G. Bertocchi, M. Petti, M. G. Alvarez, M. Postan, and A. Armenti. 2006. Long-term cardiac outcomes of treating chronic Chagas disease with benznidazole versus no treatment: a nonrandomized trial. Ann. Intern. Med. 144:724-734. [PubMed]
71. Wang, M. Z., X. Zhu, A. Srivastava, Q. Liu, J. M. Sweat, T. Pandharkar, C. E. Stephens, E. Riccio, T. Parman, M. Munde, S. Mandal, R. Madhubala, R. R. Tidwell, W. D. Wilson, D. W. Boykin, J. E. Hall, D. E. Kyle, and K. A. Werbovetz. 5 April 2010. Novel arylimidamides for the treatment of visceral leishmaniasis. Antimicrob. Agents Chemother. doi:.10.1128/AAC.00250-10 [PMC free article] [PubMed] [Cross Ref]
72. Wilson, W. D., F. A. Tanious, A. Mathis, D. Tevis, J. E. Hall, and D. W. Boykin. 2008. Antiparasitic compounds that target DNA. Biochimie 90:999-1014. [PMC free article] [PubMed]
73. Wincker, P., C. Britto, J. B. Pereira, M. A. Cardoso, W. Oelemann, and C. M. Morel. 1994. Use of a simplified polymerase chain reaction procedure to detect Trypanosoma cruzi in blood samples from chronic chagasic patients in a rural endemic area. Am. J. Trop. Med. Hyg. 51:771-777. [PubMed]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)