(A) The tetraploid cells carry two versions of chromosome II with deletions within the TYR1 ORF: the “ty”-allele contains a 5′ portion of the TYR1 ORF (nucleotides 1–700) and the “yr1”-allele contains a 3′ portion (nucleotides 300–1358). The green box represents the ORF of the TYR1 gene; the striped boxes represent the missing DNA sequences of the mutants; and the light blue rectangle represents the area of homology between the chromosomes. Note: for simplicity only one of each pair of sister chromatids of the G₂/M cells are presented (thereby, having the appearance of G₁ cells). (For a complete description of recombination and segregation at mitosis see Figure S7.) Gene conversion with or without crossing-over as well as reciprocal exchange between heteroalleles can generate Tyr⁺ cells. Recombination leading to Tyr⁺ can generate different combinations of TYR1 alleles within the resulting tetraploid cell. A large conversion tract will result in 3 types of alleles regardless of associated crossing-over: the original truncated parental heteroalleles and the TYR1⁺ converted allele. A reciprocal exchange that occurs at short conversion region will yield a forth allele “y” retains only a small portion of the gene. Depending on segregation of sister chromatids at mitosis, half the Tyr⁺ recombinants that arise by a reciprocal exchange would not possess the “y” allele (for details see Figure S7). (B) The 4 alleles described in (A) can be distinguished by size of PCR products using the following primers: 5′GAATACCGTAGCACTTGAAGGAAAGAGGACAGCATATCCA 5′CACAAAAGAAGGCCTAATATTATAGGAAATCAGCATTAAAAAC. The allele sizes are 1360 bp (TYR1), 1060 bp (“yr1”), 700 bp (“ty”) and 400 bp (“y”). Presented are PCR products of the TYR1 locus from 4 colonies obtained after UV irradiation (40 J/m²) of the MCD1 simplex strains. Tyr⁺ colonies that result from a reciprocal exchange event can be identified by the presence of a “y” allele (encircled). The “M” corresponds to DNA molecular size markers.