PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

Logo of plosgenPLoS GeneticsSubmit to PLoSGet E-mail AlertsContact UsPublic Library of Science (PLoS)View this Article
 
From:
Published online 2010 July 1. doi: 10.1371/journal.pgen.1001006

Figure 5

An external file that holds a picture, illustration, etc.
Object name is pgen.1001006.g005.jpg
Genetic reporter for recombination between heteroalles residing on homologous chromosomes in tetraploid strains.

(A) The tetraploid cells carry two versions of chromosome II with deletions within the TYR1 ORF: the “ty”-allele contains a 5′ portion of the TYR1 ORF (nucleotides 1–700) and the “yr1”-allele contains a 3′ portion (nucleotides 300–1358). The green box represents the ORF of the TYR1 gene; the striped boxes represent the missing DNA sequences of the mutants; and the light blue rectangle represents the area of homology between the chromosomes. Note: for simplicity only one of each pair of sister chromatids of the G2/M cells are presented (thereby, having the appearance of G1 cells). (For a complete description of recombination and segregation at mitosis see Figure S7.) Gene conversion with or without crossing-over as well as reciprocal exchange between heteroalleles can generate Tyr+ cells. Recombination leading to Tyr+ can generate different combinations of TYR1 alleles within the resulting tetraploid cell. A large conversion tract will result in 3 types of alleles regardless of associated crossing-over: the original truncated parental heteroalleles and the TYR1+ converted allele. A reciprocal exchange that occurs at short conversion region will yield a forth allele “y” retains only a small portion of the gene. Depending on segregation of sister chromatids at mitosis, half the Tyr+ recombinants that arise by a reciprocal exchange would not possess the “y” allele (for details see Figure S7). (B) The 4 alleles described in (A) can be distinguished by size of PCR products using the following primers: 5′GAATACCGTAGCACTTGAAGGAAAGAGGACAGCATATCCA 5′CACAAAAGAAGGCCTAATATTATAGGAAATCAGCATTAAAAAC. The allele sizes are 1360 bp (TYR1), 1060 bp (“yr1”), 700 bp (“ty”) and 400 bp (“y”). Presented are PCR products of the TYR1 locus from 4 colonies obtained after UV irradiation (40 J/m2) of the MCD1 simplex strains. Tyr+ colonies that result from a reciprocal exchange event can be identified by the presence of a “y” allele (encircled). The “M” corresponds to DNA molecular size markers.

Images in this article

  • Figure 1
  • Figure 2
  • Figure 3
  • Figure 4
  • Figure 5
  • Figure 6
  • Figure 7
  • Figure 8
Click on the image to see a larger version.