Search tips
Search criteria 


Logo of aemPermissionsJournals.ASM.orgJournalAEM ArticleJournal InfoAuthorsReviewers
Appl Environ Microbiol. 2010 June; 76(12): 3924–3935.
Published online 2010 April 30. doi:  10.1128/AEM.01604-09
PMCID: PMC2893510

Diversity of Oligotrichia and Choreotrichia Ciliates in Coastal Marine Sediments and in Overlying Plankton[down-pointing small open triangle]


Elucidating the relationship between ciliate communities in the benthos and the plankton is critical to understanding ciliate diversity in marine systems. Although data for many lineages are sparse, at least some members of the dominant marine ciliate clades Oligotrichia and Choreotrichia can be found in both plankton and benthos, in the latter either as cysts or active forms. In this study, we developed a molecular approach to address the relationship between the diversity of ciliates in the plankton and those of the underlying benthos in the same locations. Samples from plankton and sediments were compared across three sites along the New England coast, and additional subsamples were analyzed to assess reproducibility of methods. We found that sediment and plankton subsamples differed in their robustness to repeated subsampling. Sediment subsamples (i.e., 1-g aliquots from a single ~20-g sample) gave variable estimates of diversity, while plankton subsamples produced consistent results. These results indicate the need for additional study to determine the spatial scale over which diversity varies in marine sediments. Clustering of phylogenetic types indicates that benthic assemblages of oligotrichs and choreotrichs appear to be more like those from spatially remote benthic communities than the ciliate communities sampled in the water above them.

Planktonic ciliates provide a critical trophic link between the microbial and macroscopic components of the pelagic food web, and the subclasses Choreotrichia and Oligotrichia are the most abundant ciliate groups in this environment (46). One key to understanding the diversity and ecology of Choreotrichia and Oligotrichia is the relationship between benthic and planktonic forms. While the ciliates in these two groups are predominantly swimmers (54), there is crossover between benthic and pelagic environments for many species. Some taxa are described as epibenthic, living in the layer of water just above the sediment (16, 54), some have the capacity to live attached to sediment particles for a period and then become free-swimming (21), and a large number of taxa within these two groups spend a portion of their life cycles in dormancy, persisting in the sediments in cyst form (22, 23, 25, 35, 36, 39, 40, 41, 43, 49, 51). An accurate assessment of ciliate dynamics in the plankton requires careful study of both benthic and pelagic environments and the extent of coupling between the two environments.

The role of the cyst in the life cycle of marine planktonic ciliates is particularly critical for understanding their distribution, evolutionary history, and ecology (6) as cysts provide a mechanism for dormancy during periods of poor environmental conditions. Relatively few marine ciliate species have been directly studied to determine conditions for encystment and excystment, period of dormancy (22, 23, 25, 26, 43), and role of the encystment cycle in the ecology of the organism (36). Moreover, studies on the conditions related to encystment and excystment in ciliates reveal different patterns and potential causes depending on the species (22, 23, 25, 26, 36, 43). While some data link the cycle of encystment with environmental factors such as light (23), temperature (23, 25, 26), and presence of food (22), other data suggest a temporal/seasonal cycling independent of external environmental conditions (26, 36, 43).

A further factor limiting our understanding of the role of cysts in the life cycle of ciliates is identification based on the limited morphological features of the cysts, which are highly convergent (4, 17). In the case of ciliates that encyst within a lorica, as in the tintinnids, this is less of a problem (45), but for aloricate species, identification is not certain without direct observation of excystment (41, 48). Hence, morphological surveys of ciliates in benthic environments frequently capture members of the Oligotrichia and Choreotrichia (19, 31, 52, 53, 54) but are often limited to identification at the genus level using morphological approaches.

More is known about planktonic ciliates, where morphology provides a wealth of data (11) and where molecular studies have revealed tremendous diversity, with many rare haplotypes (10). We define distinct sequences at the small-subunit (SSU) ribosomal DNA (rDNA) locus as haplotypes to remain conservative in our approach to identifying operational taxonomic units (OTUs) because ciliates have an unusual genome structure with high chromosome copy number, which potentially could generate multiple sequence types for the same locus within an organism or within a species. Planktonic ciliates show high molecular diversity at the SSU rDNA locus (10, 24), and primer sequences have been developed to detect ciliates from environmental samples within the subclasses Choreotrichia and Oligotrichia (10). Ciliates from these subclasses sampled across three coastal locations comprised distinct assemblages, with a few ubiquitous and abundant haplotypes (10) and many singletons (haplotypes unique to a particular sample).

This study lays the groundwork for an alternative to morphological methods for analyzing benthic assemblages of oligotrichs and choreotrichs and comparing them to assemblages in the overlying water. Our goal was to compare levels of genetic diversity between sediment and plankton samples as a means of assessing the potential of methods for monitoring exchange between these two communities. There are two main questions addressed in this study: (i) are the two environments, plankton and sediment, comparable in robustness to repeated sampling using PCR, cloning, and sequencing and (ii) what is the relationship between genetic diversity of oligotrich and choreotrich ciliate communities sampled in marine sediments and in the plankton?

To investigate the first question, we designed resampling experiments in plankton and sediment collections to test spatial heterogeneity as well as the robustness of repeated PCR cloning and sequencing for capturing diversity. Using two plankton samples collected by different means from the same time and place, we compared the similarity of subsamples in this environment to the similarity between separate subsamples of sediment collected at the same time and place. Additionally, we resampled DNA extracted from each of the two environments and investigated the reproducibility of repeated PCR cloning and sequencing between environmental types.

To investigate the second question, we compared the diversity in sediment samples collected in the Gulf of Maine and Long Island Sound in May 2005 to previously published data from plankton samples collected at the same times and locations (10). Cluster analyses of the communities in sediment and plankton were used to determine the degree of coupling between the benthic and pelagic forms of Oligotrichia and Choreotrichia. The predicted result would be that the ciliate community observed in the plankton represents a subset of the diversity found in the benthic community, including cysts, beneath it. While the community in the plankton for many oligotrichs and choreotrichs would change depending on prevailing environmental conditions, predation, and chance, the benthic community, which includes encysted planktonic forms, should represent the longer-term diversity in a given region.


Sample collection. (i) Sediment.

Ciliates were sampled from three near-shore locations. Two were in the Gulf of Maine, Bucks Harbor, ME (44°38.20′N, 67°22.29′W), and Southport Island, ME (43°49.05′N, 69°39.16′W), and one was in Connecticut on Long Island Sound (41°19.00′N, 72°03.65′W). Sediment samples were collected on the same day in May 2005 in tandem with plankton collections (10). In each location, collections consisting of the uppermost ~1-cm layer of sediment were transferred into a 50-ml conical tube (approximately 20 to 25 g total). The Maine samples were immediately placed in a cooler with dry ice during transport to the lab. Connecticut samples were collected at the University of Connecticut's Avery Point marine campus and did not need to be transported. Samples from both locations were stored at −80°C until DNA extraction. Ambient water temperature, salinity, and chlorophyll concentration in the water column were recorded at each collection. For chlorophyll, 100 ml was filtered onto a Whatman GFF glass fiber filter. The filter was folded in half, wrapped in aluminum foil, and stored at −80°C prior to extraction in 90% aqueous acetone and quantification by fluorescence.

(ii) Plankton.

Plankton samples for subsampling robustness estimates were collected at Southport Island, ME, and Ipswich, MA (42°42.708′N, 70°47.79′W), using a preconcentration step (siphoning 50 to 60 liters of water through a submerged 20-μm mesh) as described by Doherty et al. (10). A second sample from Ipswich, MA, was collected using the following approach: 2 liters of water was sampled and filtered through a 3.0-μm cellulose nitrate filter (Millipore catalog no. 7193-002), immediately placed on dry ice for transport back to the lab, and stored at −80°C until DNA extraction.

DNA extraction, amplification, and sequencing.

For each sediment DNA extraction, we weighed ~1 g of sediment and extracted using the DNeasy plant kit by Qiagen (catalog no. 69104). We modified the manufacturer's protocol for our sediment by initially placing the sample in either DNA preparation buffer (100 mM NaCl, Tris-EDTA at pH 8, and 0.5% SDS) or buffer AP1 from the DNeasy kit, mixing by vortexing, and removing the supernatant to use for genomic DNA extraction. Plankton samples were extracted using a standard 2:1 phenol-chloroform extraction protocol (2). Filters were removed from buffer, and the samples were incubated with proteinase K at 50°C overnight. Twice we added an equal volume of phenol, vortexed, and centrifuged, followed by addition of an equal volume of chloroform, vortexing, and centrifugation.

We amplified DNA fragments by PCR with Phusion polymerase and reagents from Finnzyme Inc. using primers designed to be specific for Choreotrichia and Oligotrichia SSU ribosomal DNA as described by Doherty et al. (10). The primer pair consisted of 1199+ (5′ GCCGACTCGGGATCGGGGGC) and 1765− (5′ CCCCAKCACGACDCMTATTGCTG). PCR products were gel isolated and cleaned using the UltraClean GelSpin DNA purification kit from Mo Bio Laboratories (catalog no. 12400-100). We used either the pSTBlue-1 perfectly blunt cloning kit from Novagen (catalog no. 70191-4DFRZ) or the Zero Blunt TOPO PCR cloning kit (Invitrogen catalog no. 45-0245) for cloning and then picked and miniprepped colonies using the PureLink 96 plasmid purification system from Invitrogen (catalog no. 12263-018). Sequencing reactions were performed using the BigDye Termination kit (Applied Biosystems), and reaction products were cleaned with a Sephadex plate column and sequenced on an ABI 377 automated sequencer.

Sequence assembly and phylogenetic analysis.

We assembled and edited sequences using SeqMan (DNAStar Inc.). We selected a 99% similarity cutoff for genealogical analyses and diversity estimation to allow for discrimination between highly related but distinct taxa (10). Haplotypes were then checked for identity with published sequences using BLAST search on NCBI ( All sequences in the analysis were screened for PCR chimeras using the recombination detection software RDP version 2.0 (34) with the Chimaera (48, 50, 55) and GENECONV (42) applications. Putative recombinants were then visually inspected in MacClade version 4.06 (30) for confirmation. To independently confirm the results from the RDP software, we used the Bellerophon (20) server ( and manually inspected putative chimeras detected by this program.

For genealogical analyses, haplotypes were aligned with published sequences from identified morphospecies obtained by searching GenBank for all entries recorded as Choreotrichia and Oligotrichia. In addition, we included 150 sequences from uncultured environmental samples in our phylogeny that appeared in BLAST search results as closely related to known Choreotrichia and Oligotrichia sequences. We used the CLUSTAL W algorithm as implemented in MegAlign (DNAstar Inc., Madison, WI) to align our sequences with the published sequences. We finalized alignments by eye in MacClade version 4.06 (30).

Bayesian analyses were conducted for each primer data set using a GTR + G + I model of sequence evolution in MrBayes (51). Four simultaneous MCMCMC chains were run for 10,000,000 generations, sampling every 100 generations. Whether likelihood scores (L) were stationary was determined by plotting the −ln (L) generation number. All trees below the observed level for stationary scores were discarded, resulting in a “burn-in” of 75,000 generations. Estimation of best-fit models for partial SSU rDNA gene sequences was performed using MrModelTest (version 2; Evolutionary Biology Centre, Uppsala University; program distributed by the author).

Statistical analyses.

We compared levels of diversity between samples by calculating rarefaction curves using EstimateS (version 8; and comparing the number of clones sequenced to the number of observed haplotypes based on our 99% assembling criterion. We also calculated the nonparametric richness estimator Chao1 with EstimateS using 100 randomizations, sampling without replacement.

We performed principal coordinate analysis and hierarchical clustering analysis using the online software UniFrac to test whether sediment samples cluster together in the phylogenetic tree based on environment (29). UniFrac can be used to determine whether environments differ significantly in community composition, whether community differences are concentrated within particular lineages of the phylogenetic tree, and whether environmental factors group communities together (29). We used the Bayesian tree and a text file with sequence labels mapped to environmental samples as input for the UniFrac analyses. The distances were plotted as points in a multidimensional space, one dimension fewer than the number of samples, so that the principal coordinates describe how much of the variation each of the axes in this new space explains. These coordinates were then analyzed for correlation with environmental parameters of the samples. We used the unweighted pair group method with arithmetic mean (UPGMA) hierarchical clustering algorithm, which clusters pairs of samples, and tested robustness of these clusters with jackknife analysis, a nonparametric estimator based on 100 randomized subsamples. We tested whether the sediment samples differed significantly from one another on the Bayesian tree by conducting a P-test in UniFrac, which estimates similarity between communities as the smallest number of changes that would be required to explain the distribution of sequences in the tree (33).

Resampling. (i) Test for heterogeneity between collections.

For each sediment sample collected, we weighed out three or more 1-g subsamples, extracted total DNA as described above, and amplified and sequenced each sample separately for spatial comparison. For evaluating heterogeneity in plankton collections, we sampled water from Ipswich, MA (42°42.708′N, 70°47.79′W), and compared two filtering approaches. In the first approach, we used the preconcentration method described by Doherty et al. (10), where a large volume of seawater (60 liters) was preconcentrated down to 5 liters by siphoning through a submerged 20-μm mesh and then filtered. In the second approach, we sampled a much smaller volume (21) and filtered it without preconcentration approximately 1 h after sampling.

(ii) Test for reproducibility of molecular sampling.

We amplified genomic DNA from each sediment subsample by PCR in 2 or more separate reactions. These PCR products were cloned and sequenced individually, and resulting haplotype diversity was evaluated for reproducibility by PCR within and between subsamples. For plankton samples, we extracted genomic DNA from filters collected from plankton in the Gulf of Maine in May 2005 to compare the resulting diversity to our previously published estimates for samples collected in the same location (10). We generated clone libraries from the PCR products amplified from these new filters and sequenced 257 clones. We compared the results from this additional sequencing effort to initial estimates of diversity obtained for the sample-based sequencing of 84 clones (10).

Nucleotide sequence accession numbers.

Previously unpublished sequences generated in both plankton and sediment environments were submitted to the GenBank database ( under the accession numbers GU993549 to GU993580, HM001218, and HM001219 (see Appendix).


Diversity sampled in sediments.

In total, we analyzed 729 clones from sediment samples (Table (Table1).1). We identified 49 haplotypes, and of these more than half (32) were rare in the sample (represented by 3 or fewer sequences). The remaining 22 haplotypes were represented by a greater number of sequences, and all but two were sampled in multiple PCRs (Table (Table1).1). The most abundant haplotype, sampled in 206 clones, was identified through BLAST searches to be 100% identical to an environmental spirotrichid haplotype sampled in New England coastal waters (GenBank accession no. EF553401). This haplotype falls within the Choreotrichia in our phylogeny as a sister group to a sequenced morphospecies, the tintinnid Codonella sp. (GenBank accession no. DQ487193) (Fig. (Fig.11 a). A second haplotype, found in high abundance (126 clones) as well as throughout the samples, was a haplotype that BLAST search results show to be 100% identical to morphospecies Strombidium biarmatum (GenBank accession no. AY541684) within the Oligotrichia (Fig. (Fig.1b).1b). This morphospecies was also the one most commonly found with molecular methods in planktonic ciliate samples (10). Strombidium biarmatum was described recently on the basis of samples from the Gulf of Trieste in the Mediterranean Sea (1).

FIG. 1.FIG. 1.
Phylogeny of oligotrich and choreotrich haplotypes based on Bayesian analysis of partial SSU rDNA gene sequences. Topologies shown are trees with the highest likelihood scores. Numbers at nodes are Bayesian posterior probabilities. All branches are drawn ...
Haplotypes found by PCR of DNA isolated from multiple subsamples of sediment

Twenty-eight of the 49 haplotypes sequenced from the sediment had been seen in previously published planktonic samples (10). Only one of these can be associated with a described morphospecies, the aforementioned Strombidium biarmatum. Sixteen haplotypes were found in more than one sediment sample, while 33 haplotypes were captured in only one sample (“singleton haplotypes”) (Table (Table1).1). Of these 33 singleton haplotypes, 20 had been previously captured in plankton samples (10), leaving 13 of 49 haplotypes that were found only once among the pooled plankton and benthic observations.

We detected no evidence of PCR recombination in our haplotype sequences. Using the RDP software (34) and the Chimaera program (47, 48, 55), we detected no recombinants, even after decreasing the stringency of the test by incrementally raising the P values. We also applied the GENECONV program (42), which applies a sliding window approach to identification of recombinants for every possible triplet of bases. This program did identify putative recombinant sequences, but we determined by visual inspection in MacClade that they contained levels of polymorphism too high to be consistent with PCR recombination. For confirmation of this result, we reanalyzed the sequences using the Bellerophon program (20) and manually inspected the putative chimeras. We were not able to confirm the presence of chimeras using these two independent approaches.

Bayesian analyses of the SSU rDNA data from our sediment samples combined with published data show that the majority of haplotypes in our sediment samples fall within the Oligotrichia (30 of the 49 sequences), 18 haplotypes fall within the Choreotrichia, and one haplotype (hbp110) groups most closely with the outgroup, the Protocruziid spirotrich Protocruzia adherens (Fig. (Fig.11).

Resampling of plankton and sediment. (i) Heterogeneity within collections.

We examined replicate subsamples from the same initial collection of sediment (~20 to 25 g) (Table (Table1).1). Levels of diversity and haplotype representation varied widely among these replicates (Tables (Tables11 and and2).2). For example, from a comparison of replicates with ~20 clones sequenced, subsample 2 showed a diversity of 1 or 2 haplotypes, while replicate 3 revealed a diversity of 6 or 7 different haplotypes (Table (Table1).1). Chao1 diversity estimates and rarefaction curves calculated for the samples also varied between replicates (see Table Table4;4; Fig. Fig.2a).2a). For the sake of clarity, we show the rarefaction curves estimated for only one of the locations, Southport Island, ME, to illustrate the inconsistency between subsamples (Fig. (Fig.2a2a).

FIG. 2.
Comparisons of observed levels of diversity as determined from rarefaction curves for subsamples calculated with EstimateS version 8.0 for sediment and plankton. Observed diversity (Sobs, MaoTao) versus the number of clones sequenced is shown. Error bars ...
Comparison of haplotypes obtained in Southport Island, ME, plankton samples from replicate PCRs with 84 clones analyzed from replicate Rep1 (10) and an additional 257 clones from replicate Rep2
Estimates of diversity of ciliates in different sediment samples and from replicate PCRs

We compared plankton samples collected using different filtering methods from the location in Ipswich, MA (Table (Table3).3). These samples, standard collection (Cstd) and modified collection (Cnov), are similar in that they are both dominated by the same abundant haplotype, which we call hbp95, and they share 50% of their haplotype assemblages. The difference between these samples is largely due to the presence or absence of rare haplotypes. One notable exception is haplotype 258_05, which was relatively abundant in the 60-liter preconcentrated sample but rarer in the 2-liter sample, suggesting that this haplotype may have died off rapidly in the 2 h between collection and filtering.

Comparison of haplotypes obtained in plankton from Ipswich, MA, using two collection methods: Cstd, representing our standard methods (10), and Cnov, the alternative method described in this study

(ii) Reproducibility of molecular methods.

For determining whether the variance observed in sediments was a result of PCR bias, we analyzed replicate PCRs on DNA extracted from each sediment subsample. Our diversity estimates and rarefaction curves showed more consistency in replicate PCR experiments conducted on the same DNA extraction than on replicate extractions performed on sediments in the same location (Table (Table4;4; Fig. Fig.2a).2a). Comparisons of membership between these replicate subsamples are consistent with estimated diversity results (Table (Table11).

We assessed the impact of the increased sequencing effort on observed diversity in planktonic samples. Comparisons were made between published data based on 84 sequences generated from clone libraries sampled in Southport Island, ME, in May 2005 (Rep1) and newly generated sequences from an additional 257 clones of DNA extracted from the same sample (Rep2) (Table (Table3).3). Rarefaction curves generated from the initial 84 sequences and the additional 257 sequences sit directly on top of one another, indicating high similarity in observed levels of diversity between the samples (Fig. (Fig.2b).2b). We observe a greater degree of overlap in membership between the two plankton samples than was seen in repeat sediment samples (Tables (Tables11 and and2).2). However, there is no statistical support for this observed similarity. The results from using Fisher's exact test strongly support the null hypothesis that the samples are independent of one another (P < 0.0001). We suspect that the large proportion of rare haplotypes in these data sets contribute to these differences.

Coupling of benthic and sediment communities.

We performed cluster analysis on ciliate assemblages sampled from the Gulf of Maine and Long Island Sound in May 2005 from both environments to determine the relationship between plankton and sediment communities at the same locations and times. With the software in UniFrac (29), we generated an environmental matrix using genetic distances from the Bayesian SSU rDNA tree. We performed the analysis using both weighted and unweighted branch lengths to determine the effect of abundance versus presence or absence on the clustering of haplotypes. We discerned a pattern only in the case where we used unweighted branches, which is a qualitative (presence versus absence) rather than a quantitative assessment. Principal coordinate analyses using unweighted branches group the sediment communities together, distinct from plankton communities collected in the same locations at the same time (Fig. (Fig.33 a). Hierarchical clustering using UPGMA is consistent with these findings, but jackknife analysis shows only moderate to weak support for many of the nodes (Fig. (Fig.3b).3b). Moreover, analyses using weighted branch lengths cause the observed clustering pattern to fall apart. Hence there is a weak relationship between sediment communities based on membership but not on numerical dominance or rarity.

FIG. 3.
(a) Results for principal coordinate analysis (PCA) based on branch lengths in the Bayesian tree and environmental data for the three sediment (Sed) locations along with data collected from plankton (Plank) samples by Doherty et al. (10). May plankton ...

Plankton samples do not cluster with their respective benthic samples.

There were low levels of overlap between plankton (10) and sediment assemblages (Table (Table5).5). While the total number of sediment haplotypes captured at each location ranged between 17 and 32 and the plankton haplotypes range between 24 and 47, the maximum overlap between plankton and sediment at any given location was only 3 to 5 haplotypes (Table (Table5).5). A much higher level of overlap of haplotypes was found among spatially separated samples for both plankton and sediments (24 and 15 overlapping haplotypes, respectively) than between plankton and sediment at the same location.

Haplotypes shared between plankton and sediment


Question 1: are the two environments, plankton and sediment, comparable in robustness to repeated sampling using PCR, cloning, and sequencing? (i) Spatial heterogeneity.

Plankton diversity estimates are robust to various collection methods and to resampling (Tables (Tables22 and and3).3). Our standard sampling practice, which involves immediately filtering and preserving a large volume (50 to 60 liters) of water after concentration (10), gave results similar to those for a 2-liter sample processed 2 h after collection (Fig. (Fig.2b;2b; see Materials and Methods for further details). In contrast, sediment samples show a high degree of heterogeneity among subsamples in both diversity and membership (Tables (Tables11 and and4;4; Fig. Fig.2a).2a). We do not believe this result to be an artifact of PCR, cloning, and sequencing for the following reasons: (i) we find consistent results between different PCRs amplifying genomic DNA from the same subsample (Table (Table2);2); (ii) the trend is consistent across 26 total PCRs for a total of 15 g of sediment; and (iii) the pattern we observe in plankton samples is quite different, suggesting that our molecular methods are robust (see above) (10).

A comparison of samples taken from the sediment to those collected in the plankton shows that there is a large difference in spatial scale, which each collection method allows us to evaluate. We collected sediments by isolating ~20 g of the top ~1 cm of sediments at a single point. The variance in estimates of diversity among subsamples from a single collection could indicate that oligotrich and choreotrich ciliates are very rare in sediment samples. However, the high haplotype numbers in some subsamples (e.g., 6 haplotypes in subsample BH2a/2b, 9 haplotypes in subsample SI3a/3b, and 11 haplotypes in subsample CT2a/2b [Table [Table1])1]) suggest that this is not the case. Instead, our data suggest that there is considerable spatial heterogeneity in ciliates in sediments on the scale of <1 cm.

(ii) Reproducibility of molecular methods.

In plankton samples, our estimates of diversity and membership are similar based on independent estimates from subsamples containing 84 or 257 clones. The more intensive sampling resulted in a greater number of rare haplotypes in the sample, and the resulting distributions thus differ by the conservative Fisher exact test (Table (Table2;2; Fig. Fig.2b).2b). Although different DNA extractions from the sediment environment produced differing levels of membership and diversity, we also obtained more-consistent results for diversity and membership when resampling from the same DNA sample. Together, these results give us greater confidence in the reproducibility of the molecular methods for both plankton and sediment environments.

Question 2: what is the relationship between genetic diversity of oligotrich and choreotrich ciliate communities sampled in marine sediments and in the plankton?

With the important caveat that our sampling of sediments did not produce consistent results among subsamples, we assessed the similarities in communities between plankton and sediment. We did not observe strong similarities between sediment haplotype assemblages (this study) and the plankton haplotype assemblages in the waters above (10). Comparisons of levels of relative diversity reveal little overlap between plankton and sediment communities from the same locations (Table (Table5).5). Using pooled sediment subsamples as a proxy, we find comparable levels of diversity in sediments compared to plankton samples (Table (Table4)4) and there is no evidence that sediments are sources of broader genetic diversity from which the plankton community is drawn, as a “seed bank” hypothesis for benthic assemblages would predict. Also inconsistent with a seed bank hypothesis, the sediment communities are more similar to each other in clustering analyses than they are to the community in the plankton directly above, though support here is weak (Fig. (Fig.33).

Within sediments, we would expect to find interstitial ciliates, ciliates in cyst form, and epibenthic ciliates in the small fraction of water taken along with each sample. Given that very few of the haplotypes we captured are identical to sequenced morphospecies, we cannot discern between these three possible sources of ciliate diversity in our data set. Morphological surveys, where identification is often only to the genus level, generally report only 2 to 4 different oligotrich and choreotrich ciliate types in a sediment sample, although they may be numerically abundant (15, 19, 31, 44, 52, 53, 54). Our molecular sampling efforts reveal much higher levels of diversity (up to 32 haplotypes at a single site and 49 haplotypes total across three sediment sites) (Table (Table5;5; see Appendix), indicating either that our efforts are effective at capturing a good portion of cysts in the sediment or that we are sampling a diversity of cryptic benthic dwelling oligotrich and choreotrich ciliates.

On the largest scale, we found that common haplotypes were widespread. For example, EF553401, Strombidium biarmatum, hbp95, and EF553452 were found at the Connecticut site and both Maine sites, a total range of approximately 700 km. However, on the scale of repeated subsampling (~1 cm), we found surprising lack of coherence in the presence of different haplotypes. EF553401, for example, represented about one-half of all sequenced clones from Buck's Harbor subsample 1, yet it was found in none of the other three subsamples at all. This is consistent with the idea that benthic ciliate species are distributed in a very patchy manner on small scales, as indicated by morphology-based observations (31, 53).

While resting stages in other eukaryotic plankton groups such as copepods represent a historical record about the genetic makeup of a community (5, 8, 18, 32), we found no evidence that ciliate resting stages play the same role. Studies of encystment and excystment within the Choreotrichia and Oligotrichia report relatively short periods of dormancy, ranging from 19 h for Strombidium oculatum (35) to 6 months for a Pelagostrobilidium sp. (39) and two seasons for Strombidium conicum (26). The majority of the sediment haplotypes that we sampled, the bulk of which do not match to any known morphospecies, were neither widespread nor abundant in the plankton. The one exception is Strombidium biarmatum (1), which is a cyst-forming species found throughout sediment and plankton samples (this study; 10).

This survey found little overlap between benthic ciliate assemblages and those of the overlying water and no evidence that the benthos serves as a reservoir of diversity for the plankton. We did find similarity in benthic and planktonic assemblages in that both contain a few common haplotypes and many rare ones. This confirms the findings of a number of contemporary studies indicating a much higher degree of diversity in marine eukaryotic microbes than has heretofore been appreciated (3, 7, 9, 12, 27, 28, 37, 38, 57). Further studies of the degree to which sediment-associated choreotrichs and oligotrichs may be interstitial or epibenthic or may be freely exchanged between sediment and plankton will be needed to uncover the ecological roles of the many haplotypes we observed.


We thank Barbara Costas for help with sampling.

This work was supported by the National Science Foundation (OCE-0221137 to L.A.K. and G.B.M.).


Haplotype diversity sampled in this study is shown in Table TableA1A1.

Haplotype diversity sampled in this study a


[down-pointing small open triangle]Published ahead of print on 30 April 2010.


1. Agatha, S., A. Beran, and D. H. Lynn. 2005. Pelagostrobilidium neptuni (Montagnes and Taylor, 1994) and Strombidium biarmatum nov. spec. (Ciliophora, Oligotrichea): phylogenetic position inferred from morphology, ontogenesis, and gene sequence data. Eur. J. Protistol. 41:65-83. [PMC free article] [PubMed]
2. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1992. Short protocols in molecular biology: a compendium of methods from Current Protocols in Molecular Biology. Wiley-Liss, New York, NY.
3. Bass, D., and T. Cavalier-Smith. 2004. Phylum-specific environmental DNA analysis reveals remarkably high global biodiversity of Cercozoa (Protozoa). Int. J. Syst. Evol. Microbiol. 54:2393-2404. [PubMed]
4. Belmonte, G., A. Miglietta, F. Rubino, and F. Boero. 1997. Morphological convergence of resting stages of planktonic organisms: a review. Hydrobiologia 355:159-165.
5. Caudill, C. C., and A. Bucklin. 2004. Molecular phylogeography and evolutionary history of the estuarine copepod, Acartia tonsa, on the northwest Atlantic coast. Hydrobiologia 511:91-102.
6. Corliss, J. O., and S. C. Esser. 1974. Comments on the role of the cyst in the life cycle and survival of free-living protozoa. Trans. Am. Microscop. Soc. 93:578-593. [PubMed]
7. Countway, P., R. J. Gast, P. Savai, and D. A. Caron. 2005. Protistan diversity estimates based on 18S rDNA from seawater incubations in the western North Atlantic. J. Eukaryot. Microbiol. 52:95-196. [PubMed]
8. De Stasio, B. T. 1989. The seed bank of a freshwater crustacean: copepodology for the plant ecologist. Ecology 70:1377-1389.
9. Díez, B., C. Pedrós-Alió, and R. Massana. 2001. Study of genetic diversity of eukaryotic picoplankton in different oceanic regions by small-subunit rRNA gene cloning and sequencing. Appl. Environ. Microbiol. 67:2932-2941. [PMC free article] [PubMed]
10. Doherty, M., B. A. Costas, G. B. McManus, and L. A. Katz. 2007. Culture-independent assessment of planktonic ciliate diversity in coastal northwest Atlantic waters. Aquat. Microb. Ecol. 48:141-154.
11. Dolan, J. R., M. E. Ritchie, and J. Ras. 2007. The “neutral” community structure of planktonic herbivores, tintinnid ciliates of the microzooplankton, across the SE tropical Pacific Ocean. Biogeosciences 4:297-310.
12. Epstein, S., and P. Lopez-Garcia. 2008. “Missing” protists: a molecular prospective. Biodivers. Conserv. 17:261-276.
13. Reference deleted.
14. Reference deleted.
15. Fenchel, T. 1969. The ecology of marine microbenthos. IV. Structure and function of the benthic ecosystem, its chemical and physical factors and the microfauna communities with special reference to the ciliated protozoa. Ophelia 6:1-182.
16. Fenchel, T., and P. R. Jonsson. 1988. The functional biology of Strombidium sulcatum, a marine oligotrich ciliate (Ciliophora, Oligotrichina). Mar. Ecol. Prog. Ser. 48:1-15.
17. Foissner, W., H. Muller, and S. Agatha. 2007. A comparative fine structural and phylogenetic analysis of resting cysts in oligotrich and hypotrich Spirotrichea (Ciliophora). Eur. J. Protistol. 43:295-314. [PMC free article] [PubMed]
18. Hairston, N. G., Jr., C. M. Kearns, and S. P. Ellner. 1996. Phenotypic variation in a zooplankton egg bank. Ecology 77:2382-2392.
19. Hamels, I., K. Muylaert, K. Sabbe, and W. Vyverman. 2005. Contrasting dynamics of ciliate communities in sandy and silty sediments of an estuarine intertidal flat. Eur. J. Protistol. 41:241-250.
20. Huber, T., G. Faulkner, and P. Hugenholtz. 2004. Bellerophon; a program to detect chimeric sequences in multiple sequence alignments. Bioinformatics 20:2317-2319. [PubMed]
21. Jonsson, P. R., M. Johnsson, and R. W. Pierce. 2004. Attachment to suspended particles may improve foraging and reduce predation risk for tintinnid ciliates. Limnol. Oceanogr. 49:1907-1914.
22. Kamiyama, T. 1994. Effects of extracellular products from phytoplanktonon the excystmentof tintinnids from marine sediments. Mar. Ecol. Prog. Ser. 105:199-201.
23. Kamiyama, T., and Y. Aizawa. 1992. Effects of temperature and light on tintinnid excystment from marine sediments. Nippon Suisan Gakkaishi 58:877-884.
24. Katz, L. A., G. B. McManus, O. L. O. Snoeyenbos-West, A. Griffin, K. Pirog, B. Costas, and W. Foissner. 2005. Reframing the ‘everything is everywhere’ debate: evidence for high gene flow and diversity in ciliate morphospecies. Aquat. Microb. Ecol. 41:55-65.
25. Kim, Y. O., and A. Taniguchi. 1995. Excystment of the oligotrich ciliate Strombidium conicum. Aquat. Microb. Ecol. 9:149-156.
26. Kim, Y. O., and A. Taniguchi. 1997. Seasonal variation of excystment pattern of the planktonic oligotrich ciliate Strombidium conicum. Mar. Biol. 128:207-212.
27. López-García, P., F. Rodríguez-Valera, C. Pedrós-Alió, and D. Moreira. 2001. Unexpected diversity of small eukaryotes in deep-sea Antarctic plankton. Nature 409:603-607. [PubMed]
28. Lovejoy, C., R. Massana, and C. Pedros-Alio. 2006. Diversity and distribution of marine microbial eukaryotes in the Arctic Ocean and adjacent seas. Appl. Environ. Microbiol. 72:3085-3095. [PMC free article] [PubMed]
29. Lozupone, C., M. Hamady, and R. Knight. 2006. UniFrac—an online tool for comparing microbial community diversity in a phylogenetic context. BMC Bioinformatics 7:371. [PMC free article] [PubMed]
30. Maddison, W. P., and D. R. Maddison. 1992. MacClade: analysis of phylogeny and character evolution. Sinauer, Sunderland, MA.
31. Madoni, P. 2006. Benthic ciliates in Adriatic Sea lagoons. Eur. J. Protistol. 42:165-173. [PubMed]
32. Marcus, N. H., R. Lutz, W. Burnett, and P. Cable. 1994. Age, viability, and vertical distribution of zooplankton resting eggs from an anoxic basin: evidence of an egg bank. Limnol. Oceanogr. 39:154-158.
33. Martin, A. P. 2002. Phylogenetic approaches from describing and comparing the diversity of microbial communities. Appl. Environ. Microbiol. 68:3673-3682. [PMC free article] [PubMed]
34. Martin, D. P., C. Williamson, and D. Posada. 2005. RDP2: recombination detection and analysis from sequence alignments. Bioinformatics 21:260-262. [PubMed]
35. Montagnes, D. J. S., C. D. Lowe, A. Poulton, and P. R. Jonsson. 2002. Redescription of Strombidium oculatum Griber 1884 (Ciliophora, Oligotrichia). J. Eukaryot. Microbiol. 49:329-337. [PubMed]
36. Montagnes, D. J. S., D. Wilson, S. J. Brooks, C. Lowe, and M. Campey. 2002. Cyclical behavior of the tide-pool ciliate Strombidium oculatum. Aquat. Microb. Ecol. 28:55-68.
37. Moon-van der Staay, S., R. De Wachter, and D. Vaulot. 2001. Oceanic 18S rDNA sequences from picoplankton reveal unsuspected eukaryotic diversity. Nature 409:607-610. [PubMed]
38. Moreira, D., and P. López-García. 2002. Molecular ecology of microbial eukaryotes unveils a hidden world. Trends Microbiol. 10:31-38. [PubMed]
39. Muller, H. 2000. Evidence of dormancy in planktonic oligotrich ciliates. Verh. Int. Verein. Limnol. 27:3206-3209.
40. Muller, H. 2002. Laboratory study of the life cycle of a freshwater strombidiid ciliate. Aquat. Microb. Ecol. 29:189-197.
41. Muller, H. 2007. Live observation of excystment in the spirotrich ciliate Meseres corlissi. Eur. J. Protistol. 43:95-100. [PubMed]
42. Padidam, M., S. Sawyer, and C. M. Fauquet. 1999. Possible emergence of new geminiviruses by frequent recombination. Virology 265:218-225. [PubMed]
43. Paranjape, M. A. 1980. Occurrence and significance of resting cysts in a hyaline tintinnid, Helicostmella subulata (Ehre.) Jorgensesn. J. Exp. Mar. Biol. Ecol. 48:23-33.
44. Patterson, D. J., J. Larsen, and J. O. Corliss. 1989. The ecology of heterotrophic flagellates and ciliates living in marine sediments. Prog. Protistol. 3:185-277.
45. Pedros-Alio, C. 2006. Marine microbial diversity: can it be determined? Trends Microbiol. 14:257-263. [PubMed]
46. Pierce, R. W., and J. T. Turner. 1992. Ecology of planktonic ciliates in marine food webs. Rev. Aquat. Sci. 6:139-181.
47. Posada, D. 2002. Evaluation of methods for detecting recombination from DNA sequences: empirical data. Mol. Biol. Evol. 19:708-717. [PubMed]
48. Posada, D., and K. A. Crandall. 2001. Intraspecific gene genealogies: trees grafting into networks. Trends Ecol. Evol. 16:37-45. [PubMed]
49. Reid, P. C. 1987. Mass encystment of a planktonic oligotrich ciliate. Mar. Biol. 95:221-230.
50. Reid, P. C., and A. W. G. John. 1978. Tintinnid cysts. J. Mar. Biol. Assoc. U.K. 58:551-557.
51. Ronquist, F., and J. P. Huelsenbeck. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572-1574. [PubMed]
52. Shimeta, J., C. L. Amos, S. E. Beaulieu, and O. M. Ashiru. 2002. Sequential resuspension of protists by acceleration tidal flow: implication for community structure in the benthic boundary layer. Limnol. Oceanogr. 47:1152-1164.
53. Shimeta, J., R. J. Gast, and J. M. Rose. 2007. Community structure of marine sedimentary protists in relation to flow and grain size. Aquat. Microb. Ecol. 48:91-104.
54. Shimeta, J., and J. D. Sisson. 1999. Taxon-specific tidal resuspension of protists into the subtidal benthic boundary layer of a coastal embayment. Mar. Ecol. Prog. Ser. 177:51-62.
55. Smith, J. M. 1992. Analysing the mosaic structure of genes. J. Mol. Evol. 34:126-129. [PubMed]
56. Reference deleted.
57. Worden, A. Z. 2006. Picoeukaryote diversity in coastal waters of the Pacific Ocean. Aquat. Microb. Ecol. 43:165-175.

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)