PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Hum Reprod. Author manuscript; available in PMC 2010 June 28.
Published in final edited form as:
PMCID: PMC2893033
NIHMSID: NIHMS212847

Mucin gene expression in human male urogenital tract epithelia

Abstract

BACKGROUND

Mucins are large, hydrophilic glycoproteins that protect wet-surfaced epithelia from pathogen invasion as well as provide lubrication. At least 17 mucin genes have been cloned to date. This study sought to determine the mucin gene expression profile of the human male urogenital tract epithelia, to determine if mucins are present in seminal fluid, and to assess the effect of androgens on mucin expression.

METHODS AND RESULTS

Testis, epididymis, vas deferens, seminal vesicle, prostate, bladder, urethra and foreskin were assessed for mucin expression by RT-PCR and immunohistochemistry. Epithelia of the vas deferens, prostate and urethra expressed the greatest number of mucins, each expressing 5–8 mucins. Messenger RNA of MUC1 and MUC20, both membrane-associated mucins, were detected in most tissues analyzed. Conversely, MUC6 was predominantly detected in seminal vesicle. MUC1, MUC5B and MUC6 were detected in seminal fluid samples by immunoblot analysis. Androgens had no effect on mucin expression by cultured human prostatic epithelial cells.

CONCLUSIONS

Each region of urogenital tract epithelium expressed a unique mucin gene repertoire. Secretory mucins are present in seminal fluid, and androgens do not appear to regulate mucin gene expression.

Keywords: Mucin, MUC, Male urogenital tract, male reproductive tract epithelia

Introduction

The wet-surfaced epithelia of the body, including those of the urogenital, gastrointestinal, and respiratory tracts, and the ocular surface, are the primary sites of pathogenic infection. Wet-surfaced epithelia of the body, in addition to providing defense mechanisms against infection, must be lubricated to prevent luminal surfaces from adhering to one another. A class of molecules that provides both pathogen barrier and lubricating, disadhesive functions to the wet-surfaced epithelia of the body are large, high molecular weight, hydrophilic glycoproteins known as mucins (for review, see (Jeffery and Li, 1997; DeSouza et al., 1998; Lagow et al., 1999; Corfield et al., 2001; Gipson and Argueso, 2003; Gipson et al., 2004)). Mucins by definition have tandem repeats of amino acids in their protein backbone rich in serine and threonine that provide sites for O-linked glycosylation. Carbohydrates usually make up a majority of the mass of the mucin molecule (Gendler and Spicer, 1995; Moniaux et al., 2001). To date, at least 17 mucin genes have been cloned (Gendler et al., 1987; Gum et al., 1989; Gum et al., 1990; Lan et al., 1990; Porchet et al., 1991; Bobek et al., 1993; Dufosse et al., 1993; Toribara et al., 1993; Arias et al., 1994; Meezaman et al., 1994; Shankar et al., 1994; Guyonnet Duperat et al., 1995; Williams et al., 1999; Pratt et al., 2000; Williams et al., 2001; Yin and Lloyd, 2001; Gum et al., 2002; Pallesen et al., 2002; Chen et al., 2004; Higuchi et al., 2004): MUC1–4, 5AC, 5B, 6–13, 15–17, 19, and 20. Based on sequencing data, two classes of mucins have been identified. These include the membrane-associated mucins (MUC1, 3, 4, 11/12, 13, 15, 16, 17, and 20) and the secreted mucins. The latter category includes both the large gel-forming (MUC2, 5AC, 5B, 6, and 19) and small soluble mucins (MUC7 and 9).

Membrane-associated mucins have hydrophobic domains towards the carboxy terminus of the protein that allow them to span the cell membrane. The extracellular domain of membrane-associated mucin molecules may extend up to 500 nm from the epithelial cell surface (Bramwell et al., 1986), forming a dense glycocalyx along the apical surface of the epithelia that is the cells' protective barrier. Experimental data indicate that the extracellular domain of membrane-associated mucins also provides a disadhesive character to the apical, luminal surfaces of epithelia (Hilkens et al., 1992; Ligtenberg et al., 1992; Komatsu et al., 1997). The studies further indicate that the negatively charged carbohydrate residues on the mucin protein backbone provide the disadhesive character (Hilkens et al., 1992; Ligtenberg et al., 1992). The extracellular domain of membrane-associated mucins can be detected in mucosal secretions (Ellingham et al., 1997; Jumblatt et al., 1999; Pflugfelder et al., 2000; Zhao et al., 2001; Argueso et al., 2002; Spurr-Michaud et al., 2004) as well as in sera of breast tumor (Burchell et al., 1984; Linsley et al., 1986) and ovarian tumor (Yin et al., 2002) patients, indicating that the extracellular domain is shed from apical surfaces (Rossi et al., 1996) or that splice variants are secreted in which the membrane-spanning and cytoplasmic domain are not translated (Gendler, 2001; Moniaux et al., 2001). The shed membrane-associated mucins may contribute to protection/lubrication of the epithelia in both soluble and membrane-tethered forms. Recent data indicate that membrane-associated mucins are multifunctional molecules, providing not only barrier and lubrication functions but also signal transduction through their juxtamembrane regions (Pandey et al., 1995; Yamamoto et al., 1997; Carraway et al., 2002; Ren et al., 2002). Several membrane-associated mucins have EGF-like domains near their membrane-spanning domain, and phosphorylation sites have been detected in the MUC1 cytoplasmic tail (Zrihan-Licht et al., 1994; Pandey et al., 1995; Quin and McGuckin, 2000).

The secreted mucins, gel-forming and small soluble, are produced by epithelial goblet cells and associated submucosal glands. The common features of gel-forming mucins are cysteine-rich D domains on either side of large long domains of tandem repeats. Three D domains are located in the amino terminal region of the protein and one in the carboxy region (Perez-Vilar and Hill, 1999). MUC6, however, lacks the carboxy D domain. The D domains provide sites for homo-multimerization of gel-forming mucin molecules; the large homo-multimers provide the viscosity of the mucosal secretions. The small soluble mucins lack D domains and subsequently remain as monomers (Bobek et al., 1993).

Although mucins of the female reproductive tract have been studied (for review, see (Carson et al., 1998; Gipson, 2001)), little is known about the mucin gene repertoire of the male urogenital tract. As assayed by in situ hybridization and immunohistochemistry, ejaculatory epithelial ducts and seminal vesicles expressed MUC6, while the prostate and bladder samples tested did not (Bartman et al., 1998; Leroy et al., 2003). In other male urogenital tissues, MUC1 message and protein have been detected in human testis and epididymis (Franke et al., 2001), and MUC1, 3, and 4 have been reported in the normal urothelium (N'Dow et al., 2000). Mucin gene expression in the human prostate, however, is controversial. In contrast to the MUC6 studies cited above (Bartman et al., 1998; Leroy et al., 2003), Northern blot and immunostaining assays detected MUC1 and MUC6 in the human prostate (Ho et al., 1993; Gold et al., 1994). Furthermore, Ho et al. (Ho et al., 1993) did not detect MUC2 or 3 in the prostate, while Durrant and colleagues (Durrant et al., 1994) reported MUC2 expression using an antibody to the tandem-repeat of the mucin. A comprehensive analysis of mucin gene expression in the human testis, epididymis, vas deferens, seminal vesicle, prostate, bladder, urethra, and foreskin has not been reported. Inconsistencies such as those reported for MUC2 and MUC6 expression in the prostate (Ho et al., 1993; Durrant et al., 1994) validate assaying human specimens for both mucin mRNA and protein. In addition, there have been no reports on specific mucin components of seminal plasma. Similarly, androgen regulation of mucin gene expression in male urogenital tract epithelia has not been studied. A comprehensive analysis of mucins in the male urogenital tract will provide a baseline for future studies that aim to clarify which mucins may be involved in the various activities of the different regions of the male urogenital tract, where they may contribute to protection against infections from sexually transmitted pathogens, provide disadhesive functions to facilitate sperm passage and provide lubrication to maintain luminal patency.

Materials and methods

Tissue and seminal plasma acquisition and preparation

All discarded human tissue specimens of surgical and post-mortem origin collected from the human male urogenital tract were obtained in accordance with good clinical practice, Institutional Review Board and informed consent regulations of the Schepens Eye Research Institute and the Brigham and Women's Hospital, and the doctrines of the Declaration of Helsinki. Normal discarded tissues were collected from the urogenital tract during autopsy of male patients or as surgical specimens from prostatectomy, orchiectomy, malignancy of the bladder, vasectomy, and circumcision. Tissues collected included testis, epididymis, vas deferens, seminal vesicle, prostate, bladder, urethra, and foreskin. The tissues were snap frozen in liquid nitrogen for RNA isolation, or frozen in optimum cutting temperature [OCT] compound (IMEB, Inc.; San Marcos, CA) or fixed in 4% paraformaldehyde for immunofluorescence microscopy within 45 min of surgical removal or 38 h post-mortem.

Semen samples were collected from five male partners of women who had been pregnant within the previous two years. After 48 h of sexual abstinence, semen samples were collected by masturbation and submitted for semen analysis. Samples were diluted 1:1 with sterile PBS, mixed thoroughly, and centrifuged for 10 min at 400 × g. Seminal plasma was removed, aliquoted, and stored at −70°C.

Cell culture

We sought to characterize non-cancerous prostatic epithelial cells for mucin gene expression in order to identify potential transcriptional regulators of mucin expression. The primary human, adult prostatic epithelial cells used were PrEC (Cambrex Bio Science Walkersville, Inc.; Walkersville, MD). Cells were grown in Clonetics™ Prostate Epithelial Growth Media [PrEGM] (Cambrex Bio Science Walkersville, Inc.) containing bovine pituitary extract, insulin, hydrocortisone, gentamicin sulfate amphotericin-B, retinoic acid, transferrin, triiodothyronine, epinephrine, and human recombinant epidermal growth factor, per the manufacturer's instructions. Cells were cultured in six-well plates at 2.5 × 103 cells/cm2 at 37°C in a 5% carbon dioxide atmosphere to confluence. To assess the potential regulatory effects of androgens and serum on mucin gene expression, media was supplemented with one of the following: 10% (v/v) calf serum (Invitrogen; Rockville, MD), 10−6 M dexamethasone, 10–8 M dihydrotestosterone [DHT] (Steraloids, Inc.; Newport, RI), or 1 nM or 5 nM mibolerone, a non-metabolizable androgen (BioMol Research Laboratories, Inc.; Plymouth Meeting, PA). Dexamethasone, DHT, and mibolerone were dissolved in ethanol (less than or equal to 0.01% v/v final concentration). Duplicate wells for each treatment condition, including an untreated control group, were harvested at 1, 3, and 6 days. The media was changed every 48 h.

RNA isolation and reverse transcription

Total RNA was extracted from pulverized, frozen tissues using TRIzol reagent (Invitrogen) in accordance with the manufacturer's recommended protocol. Cell culture lysates were homogenized in 1× Lysis Buffer (PE-Applied Biosystems), and total RNA was isolated using the ABI Prism 6100 Nucleic Acid PrepStation (Applied Biosystems User Guide, 2001). As previously described (Argueso et al., 2002), 2 μg aliquots of total RNA were treated with DNase I (Amplification Grade; Invitrogen) and reverse transcribed using random hexamer primers and Superscript II reverse transcriptase (Invitrogen), per the manufacturer's instructions.

Polymerase chain reaction

RNA isolated from tissue specimens was assayed by conventional RT-PCR at 35 cycles, to look for expression of MUC1, 2, 3, 4, 5AC, 5B, 6, 7, 13, 16, 17, 19, 20, with glyceraldehyde-3-phosphate dehydrogenase [GAPDH] as a quality control. PCR primers and amplification parameters for the mucin genes are indicated in Table I (Finkbeiner et al., 1993; Bernacki et al., 1999; Argueso et al., 2003). MUC3 primers used in this screening recognized a homologous region in both MUC3A and 3B genes. Studies of the incompletely characterized mucins, MUC8, 9, and 11, were not conducted. Real-time PCR compatible primers (TaqMan chemistry, Applied Biosystems) for membrane-associated mucin MUC15 (Pallesen et al., 2002) were designed using Primer Express software (Applied Biosystems) and are as follows: MUC15 Forward: TACAGCCAGCCCCACCTAATT; MUC15 Reverse: GAAAACAGATGGGTTAAGTGTGACAA. Nucleotide database searches using BLASTN (http://www.ncbi.nlm.nih.gov/blast/, provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD) verified the specificity of the MUC15 primer set. The identity of the purified 81-bp MUC15 PCR product was confirmed by the DNA Sequencing Center for Vision Research, the Ocular Molecular Genetics Institute of the Massachusetts Eye and Ear Infirmary (Boston, MA).

TABLE I
Primers used for PCR analysis.

Androgen receptor expression in RNA isolated from PrEC cells was determined by RT-PCR, using primers and amplification parameters as previously described (Table I) (Lau et al., 2000). Samples lacking cDNA were run in each assay as negative controls, and cDNA from different tissues known to express one of the mucin genes or from human prostatic tissue, known to express the androgen receptor, were run as positive controls. Amplified products were run on a 2% agarose gel and visualized with ethidium bromide.

Real-time PCR

Relative mucin gene expression in the PrEC cell line was assayed with double-labeled fluorogenic primers and probes (TaqMan; Applied Biosystems), as previously described (Argueso et al., 2002), using a sequence detection system (ABI Prism 7900HT; Applied Biosystems). MUC1, 4, 5AC, (Table I) and GAPDH PCR primers and probes used in this study have been reported (Argueso et al., 2002). Equivalent PCR amplification efficiencies for GAPDH, the endogenous control, and the target mucin genes were confirmed.

The ΔCT method (Applied Biosystems) was employed for the relative quantitation of mucin gene expression (Argueso et al., 2002; Gipson et al., 2003). Quantitative mRNA expression of each mucin gene amplified in the cell line was expressed relative to the amount of MUC1 mRNA present in a calibrator sample (ΔΔCT method), namely the untreated control culture group of each time point assayed. Samples were amplified in triplicate in a 50 μl total volume reaction for 2 min at 50°C, 10 min at 95°C, and 40 cycles of 15 sec at 95°C and 1 min at 60°C. Controls (no template) included in each real-time PCR assay confirmed that the amplification reagents were not contaminated with DNA. Real-time PCR results were statistically compared using the Fisher Protected Least-Significant Difference (Fisher's PLSD) test (StatView, Version 5.0, SAS Institute; Cary, NC). P < 0.05 was considered significant.

Immunofluorescence microscopy

Morphological characteristics of each of the male urogenital tract tissues were analyzed on hematoxylin- and eosin-stained sections. Mucins were immunolocalized in the testis, epididymis, seminal vesicle, prostate, bladder, urethra, and foreskin by immunofluorescence [IF] microscopy as previously described (Gipson et al., 1992; Inatomi et al., 1995). Vas deferens tissue was not available for immunofluorescence analysis. Tissues were incubated for 1 h at room temperature in primary antibody. Antibodies and their dilutions used are indicated in Table II. All antibodies, with the exception of the MUC4 antibody designated 528, have been previously described. The antibody was made to a synthetic peptide (SSIVPGTFHPTLSEAC) from the deduced amino acid sequence of a MUC4 genomic clone (Gipson et al., 1999). Peptides were synthesized by solid-phase procedure (F moc chemistry) and then glutaraldehyde-conjugated to keyhole limpet hemocyanin in the Peptide Synthesis Core of the Reproductive Endocrine Sciences Center, Massachusetts General Hospital. Antibodies against the conjugated 528 peptide were produced in chickens by Avian Antibodies, Inc. (Carlisle, MA) and affinity purified prior to use.

TABLE II
Primary antibodies used for immunohistochemistry and immunoblot analysis.

Samples lacking primary antibody were run as negative controls. Sections were incubated in secondary antibody in the fluorescein-conjugated donkey-anti mouse IgG or donkey-anti chicken IgY (both at 1:50 dilution from Jackson Immuno Research; West Grove, PA) and were coverslipped with Vectashield, a propidium iodide-containing antifade mounting medium that also acts as a nuclear counterstain (Vector Laboratories; Burlingame, CA) (Argueso et al., 2002).

Sections incubated with the MUC6 primary antibody, CLH5, were pretreated with neuraminidase as previously reported (Gipson et al., 1992). Antigen retrieval (15 min at 97°C in 10 mM citrate buffer, pH 6.0) was necessary prior to incubation with the commercially available MUC4 antibody, 1G8.

Agarose gel electrophoresis and immunoblot analysis

Total protein (125 μg) from seminal plasma was denatured and separated under reducing conditions in a 1% (w/v) agarose gel in electrophoresis buffer (Tris/Glycine/SDS), a modification of Thornton et al. (Thornton et al., 2000). Appropriate controls were also included in the assays to ensure the specificity of the protein detected. The proteins were then vacuum blot transferred to a nitrocellulose membrane, blocked with 5% nonfat dry milk (w/v) in Tris-buffered saline with 0.1% Tween 20 [TTBS] or PBS, and probed with the following antibodies: 214D4 (MUC1), 8G7 (MUC4), CLH2 (MUC5AC), 799W (MUC5AC), and CLH5 (MUC6) (Table II). Following incubation with peroxidase-conjugated-goat-anti-mouse IgG1 (MUC1, 4, 5AC, 6) or anti-chicken IgY (MUC5B) secondary antibody, binding was detected using SuperSignal West Pico Chemiluminescent Substrate (Pierce; Rockford, IL).

Results

In order to determine the mucin profile for native human male urogenital tract epithelia, human tissue from multiple individuals, as available, were analyzed for message (see Table III) and protein. On average, 3 to 7 specimens were assayed for mucin message and 3 to 9 specimens for mucin protein, whereas only 1 to 2 specimens of vas deferens and epididymis were available (discarded epithelial specimens from these tissues were difficult to collect). Five seminal plasma samples were also collected for immunoblot analysis.

TABLE III
Results of RT-PCR for mucins on male reproductive tissue.

Mucin gene and protein expression profile

Epithelia from all major regions within the male urogenital tract, from testis to foreskin, were analyzed for mucin message and protein. Gene transcripts for MUC1, 3, 4, 5AC, 6, 13, 15, 17, and 20 were detected by RT-PCR (Table III, Figure 1). Human epithelia known to express each mucin gene, and their corresponding negative controls, validated all RT-PCR assays – human trachea (MUC1, 4, 5B, 7, 13, 16, 19, 20), small intestine (MUC2, 3, 17), stomach (MUC5AC, 6) and salivary gland (MUC15) (data not shown). The housekeeping gene, GAPDH, was amplified in all of the samples, and only those samples with quality starting mRNA were assayed for mucin gene expression. MUC2, 5B, 7, 16, and 19 message were not detected in male urogenital tract epithelia. Of the nine (9) mucin gene transcripts detected, well-characterized antibodies were only available for localization of MUC1, 4, 5AC, 5B, and 6 proteins. The results of immunolocalization of these mucin proteins in the male urogenital tract generally support the RT-PCR data, with exceptions noted below.

Figure 1
Representative RT-PCR analyses of mucin mRNA from human vas deferens, prostate, and urethra. 1, MUC1 (104bp); 2, MUC2 (441bp); 3, MUC3 (234bp); 4, MUC4 (101bp); 5AC, MUC5AC (103bp); 5B, MUC5B (405bp); 6, MUC6 (303bp); 7, MUC7 (901bp); 13, MUC13 (73bp); ...

Testis, epididymis, and vas deferens

Testicular tissue expressed mRNA for MUC1 and 20 in 2 out of 3 samples and for MUC4, 5AC, and 6 in 1 out of 3 samples amplified. The mucin antibodies used in this study did not bind to the testicular sections assayed, indicating that, despite the presence of MUC1 message in the testis, the corresponding protein was not detected. By contrast, MUC1 mRNA (2 out of 2 samples) and protein (1 out of 1 sample) were detected in the caudal epididymis. In fact, antibodies to MUC1 bound relatively uniformly and intensely to the stereocilia on the apical membrane of the ductal epithelium (Figure 2B, C). Of all the male urogenital tract epithelia analyzed, the binding intensity of MUC1 protein was the greatest in the pseudostratified epithelium of the caudal epididymis. MUC6 and 15 gene transcripts were also detected in 1 of 2 epididymis samples, making this the urogenital tract epithelium that expressed the fewest mucins (Table III). Only one sample of vas deferens was available for assay, and it was found to express MUC1, 3, 4, 5AC, 15, 17, and 20. Well-preserved epithelium from the vas deferens was not available for immunofluorescence analysis.

Figure 2
Immunofluorescence localization of mucin protein in epithelial cells of the epididymis. (A) Light micrograph showing histology of epididymis tissue. (B) MUC1 protein (HMFG-2 antibody) is localized to the apical luminal surface (large arrow) of the epithelia ...

Seminal vesicle and prostate

MUC1, 6, and 20 mRNA was detected in 5 out of 5 seminal vesicle samples, and MUC4, 15, and 17 in 1 to 2 out of 5 samples. Three seminal vesicle sections displayed positive apical membrane binding for MUC1. Unlike the epididymis, where there was uniform binding of the MUC1 antibody, the binding pattern for MUC1 in the luminal epithelium of the seminal vesicle was patchy (Figure 3B). MUC6 protein was detected throughout the cytoplasm of some seminal vesicle epithelial cells, and other cells had little if any antibody binding to MUC6 (Figure 3C).

Figure 3
Localization of mucin protein in seminal vesicle epithelia. (A) Histology of seminal vesicle epithelium as determined by hematoxylin and eosin staining. (B) Patchy MUC1 (HMFG-2 antibody) immunolocalization to the luminal epithelium of the seminal vesicle. ...

Mucin gene transcripts for MUC1, 3, 4, and 20 were amplified in 6 out of 6 prostate samples, and MUC5AC expression was detected in 4 of 6 prostate specimens. Regional variations in mucin protein localization, as with seminal vesicle, were noted in the prostate. Antibodies to both MUC1 and 4 bound to the apices of the epithelial cell membranes lining the lumen of the prostate gland (Figure 4B, C). MUC5AC protein was also detected in the cytoplasm towards the apical surface of the glandular epithelium (Figure 4D).

Figure 4
Immunolocalization of mucin protein in prostate epithelium. (A) Histology of prostate depicting the integrity of the specimen's epithelium. MUC1 antibody (HMFG-2) (B) and MUC4 antibody (1G8) (C) bound to the apical portions of the prostate epithelium. ...

Bladder, urethra, and foreskin

As determined by RT-PCR analysis, the human bladder expressed MUC1, 3, 4, 5AC, 13, 15, 17, and 20. The immunohistochemical data on MUC1, 4, and 5AC supported the RT-PCR findings. The bladder samples assayed were contracted after fixation, as evidenced by the rounded appearance of the apical epithelial cells, the overall thickness of the transitional epithelium and the appearance of crypt-like foldings. MUC1 localized to the apical cytoplasm of the transitional epithelium at the tops of the artificial folds lining the lumen of the bladder (Figure 5B). Curiously, MUC5AC antibody bound to clusters of apical cells of the epithelium and these surface cells were filled with the mucin (Figure 5C).

Figure 5
Immunolocalization of mucin protein in bladder epithelium. (A) Light micrograph showing histology from a representative section. (B) MUC1 protein (HMFG-2 antibody) localized to the apices of the crypts of the transitional epithelium. (C) MUC5AC (791 antibody) ...

Urethral epithelium expressed MUC1, 3, 4, 5AC, 13, 15, 17 and 20 (Table III). MUC1 protein distribution was prominent along the apical layer of the stratified epithelium of the urethra and, to a lesser extent, in the subapical cells of the epithelium (Figure 6B). On the other hand, MUC4 binding was more evenly distributed throughout the stratified epithelium (Figure 6C). The only secretory mucin detected in the urethra was MUC5AC, where it was localized to the glands of Littré present in the lamina propria of the urethra (Figure 6D). The foreskin, discarded following circumcision, was the most external human male urogenital tissue assayed. MUC1, 3, 4, 5AC, 13, 15, 17, and 20 gene transcripts were amplified, and MUC1 and 4 protein (1 out of 2 samples) were detected in the foreskin, confirming the transcriptional data.

Figure 6
Distribution of mucin protein in urethral epithelium. (A) Histological characterization of urethra sample. Prominent apical binding of MUC1 (HMFG-2 antibody) (B) and MUC4 (528 antibody) (C), with some localization of both mucin proteins to the subapical ...

MUC1 and 20 were detected in most of the male urogenital tract epithelia, with the exception of epididymis (MUC1 only). Representative agarose gels of PCR products amplified from vas deferens, prostate, and urethra are presented in Figure 1. A summary of RT-PCR data for all of the tissue types analyzed can be found in Table III.

Mucins present in seminal plasma

Immunoblot analysis for presence of MUC1, 4, 5AC, 5B, and 6 was performed on five samples of seminal plasma from fertile men. MUC1, 5B, and 6 proteins were detected, but differences in binding intensities were noted between individuals in equally loaded gels (Figure 7). The MUC1 antibody (214D4) bound to all five seminal plasma samples assayed, with two samples showing greater intensity. Two bands were observed in one sample indicating polymorphism of the gene (Gendler and Spicer, 1995). MUC6 binding (CLH5 antibody) was the most variable, with MUC6 protein strongly detected in only two out of five samples, with one more intense than the other. Compared to MUC1 and 6, MUC5B binding (799W antibody) was relatively uniform amongst the samples and displayed the characteristic smear observed in immunoblot detection of highly glycosylated gel-forming mucins such as MUC5B (Gipson et al., 2001). Despite detection of MUC4 and 5AC message by RT-PCR in urethral tissues, protein was not found in the seminal plasma samples assayed (data not shown). Positive and negative controls included in the immunoblot analysis confirmed the specificity of mucin proteins detected in seminal plasma (Figure 7).

Figure 7
Representative immunoblots demonstrating the presence of MUC1, 5B, and 6 in five samples of seminal plasma. Varying levels of mucin protein were observed in the samples. 125 μg of total protein was loaded in each lane and run on a 1% (w/v) agarose ...

Mucin mRNA expression in primary prostatic epithelial cells [PrEC]

Primary prostatic epithelial cells, PrEC, were used for assessing androgen regulation of mucin expression in the prostatic epithelium. Dihydrotestosterone [DHT] and mibolerone, a non-metabolizable androgen, were tested. The expression of androgen receptor and GAPDH, an internal mRNA quality control, in PrEC cells was confirmed by RT-PCR (Figure 8) prior to relative quantitation by real-time PCR of mucin transcripts in confluent cultures.

Figure 8
Androgen receptor [AR] and GAPDH mRNA expression (RT-PCR) in confluent PrEC cells. cDNA were electrophoresed on 2% agarose gels and visualized with ethidium bromide. PCR products of expected amplicon size were amplified from RNA from PrEC cells from all ...

Androgen regulation of three of the five mucins detected in the native prostatic epithelium (MUC1, 4, and 5AC), were analyzed. The mRNA values of MUC1 mucin in the untreated control group served as the calibrator for the corresponding time point's treatment groups (baseline relative expression = 1). The untreated control group expressed only MUC1 at 1, 3 and 6 days of culture (Figure 9A). MUC5AC remained undetectable throughout the time course of the experiment (data not shown). Neither DHT nor mibolerone, at any concentration, effected mucin expression. To test the PrEC cells response to dexamethasone and serum, potent regulators of mucins in ocular surface epithelia (Gipson et al., 2003; Hori et al., 2004), PrEC cells were treated with 10−6 M dexamethasone or switched to serum-containing media (10% (v/v)) for the duration of the experiment. Unlike ocular surface epithelia, dexamethasone had no effect on mucin gene expression, but as in ocular surface epithelia, both MUC1 and MUC4 transcripts were significantly upregulated in the serum treatment groups. MUC1 expression peaked at 1 day post-treatment, with an 18-fold increase (Figure 9A), whereas MUC4 expression peaked with a 3.3-fold increase at 6 days post-treatment (Figure 9B).

Figure 9
Real-time PCR assay of relative expression of membrane-associated mucins MUC1 (A) and MUC4 (B) in primary prostatic epithelial cells, PrEC, treated with the androgens DHT and mibolerone, dexamethasone and serum. The level of MUC1 in the untreated control ...

Discussion

The data obtained in this study provide baseline information on mucin gene expression profiles of the male urogenital tract epithelia. The data also indicate that each region of the male urogenital tract epithelium analyzed has a unique mucin gene repertoire. These variations in mucin expression may reflect specific functions of each region. The fact that testis and epididymis epithelia are most distal from the external environment (and thus the pathogen source) and have spermatozoa associated with their epithelial surfaces may be reflected in their mucin expression patterns. For example, spermatozoa are moved gently through the lumen of the epididymis epithelium by surface cilia or stereocilia that are richly invested with MUC1, which may prevent their adherence. The occlusion of the epididymis that occurs in gonorrheal and chlamydial infection (Ness et al., 1997) may be due in part to the presence of fewer mucins in this region. Similar occluding and cicatrizing pathological processes occur at the ocular surface and in these cases mucin-secreting cells are lost (Nelson et al., 1983; Argueso et al., 2002).

Several more membrane-associated mucins are expressed in the vas (ductus) deferens and urethra, regions in which sperm transport is rapid and driven by muscular contraction. Forces on the surface of these epithelia may be harsher, requiring better lubrication and disadhesive properties. In addition, these tubular organs are closer to the external environment than the epididymis and thus more subject to infection.

The glands emptying into the vas deferens and urethra have unique secretory products that may have caustic effects on these epithelia, thus requiring mucin protection. For example, seminal vesicle epithelium produces MUC6 that may protect its surface from its alkaline secretions. MUC6 expression is limited to the stomach and seminal vesicles, which has led Toribara et al. to hypothesize that MUC6 shields against harsh acid or alkaline environments better than other gel-forming mucins because this mucin has fewer exposed unglycosylated regions (specifically an absence of the unglycosylated carboxy-terminal D domain) that would be subject to acid/alkaline degradation (Toribara et al., 1997). Similarly, prostatic epithelium has a large mucin gene repertoire, including several membrane-associated mucins and the gel-former MUC5AC. A large repertoire of mucins may protect this epithelium from secreted lytic enzymes. Bladder epithelium also expresses several membrane-associated mucins as well as MUC5AC, a gel-forming mucin. It too exists in a caustic, urea-rich environment, and the redundancy of expression of membrane-associated mucins, including MUC1, 3, and 4, confirming the previous findings by N'Dow and colleagues (N'Dow et al., 2000) may indicate that a mucin-rich protective surface barrier is required by bladder epithelium.

It is not surprising that gel-forming mucins MUC5B and MUC6 are constituents of seminal plasma, since sperm motility studies indicate that cervical mucins protect sperm from the vaginal environment and assists their transport through the female reproductive tract (Eriksen et al., 1998). Mucins in the male urogenital tract may serve similar functions, especially along the urethra where both urine and sperm are conducted out of the body. Our immunoblot data detecting MUC5B protein in seminal plasma is of particular interest, since MUC5B was not detected by RT-PCR or immunohistochemistry in any of the urogenital tract epithelia analyzed. Perhaps the Cowper's Glands, which were not available for study, could account for this discrepancy. However, only 5% of seminal secretions originate from these secondary glands; prostate and seminal vesicle secretions account for the majority of the seminal volume (reviewed in (Owen and Katz, 2005)). Unlike MUC5B, MUC4 and MUC5AC proteins were not detected in the seminal plasma samples despite finding their transcripts in the male urogenital epithelia, especially in the prostate and urethra. Although it is unclear why these mucin proteins were not found, proteases, such as trypsin and prostate specific antigen [PSA], have been found in seminal fluid (Paju et al., 2000) and may destroy the antigen binding sites on these mucins.

By comparison to the endocervical epithelium of the female reproductive tract, where three of the large gel-forming mucins, MUC5AC, 5B, and 6, were detected in some epithelial cells (Gipson et al., 1997), no such protective redundancy was identified in any cells of male urogenital tract epithelia examined. With the exception of seminal vesicle and epididymis epithelia, MUC5AC was detected in all epithelia assayed, whereas seminal vesicle expressed only MUC6 (mRNA and protein). Our data corroborate previous findings, regarding seminal vesicle epithelial expression of MUC6 (Ho et al., 1995; Bartman et al., 1998; Leroy et al., 2003).

MUC2 and 6 expression in the prostate is controversial. Durrant et al. detected MUC2 by immunohistochemistry using the monoclonal antibody 996/1 (Durrant et al., 1994), while Ho et al. and Gold et al. failed to identify MUC2 expression in the prostate by Northern blot and immunostaining techniques (Ho et al., 1993; Gold et al., 1994). A similar dichotomy exists for MUC6 reports – detected by Northern blot and immunostaining (Ho et al., 1993; Gold et al., 1994) but not by in situ hybridization or immunohistochemistry (Bartman et al., 1998; Leroy et al., 2003). Our data indicate that neither MUC2 nor MUC6 is present in prostatic epithelium.

The mucins in the human female reproductive tract are hormonally regulated. Cervical MUC4 and 5B expression peaks when progesterone levels are low (prior to midcycle) in normally cycling women (Gipson et al., 1999), and the highest levels of MUC5B protein are detected in cervical mucus at midcycle (Gipson et al., 2001). Unlike female reproductive tract mucins, prostatic epithelial mucins MUC1 and 4 do not appear to be under hormonal control. O'Connor et al. reported similar findings for MUC1 when PrEC cells were cultured with DHT (O'Connor et al., 2005).

To our knowledge, the data reported in this manuscript provide the most inclusive mucin profile of the human male urogenital tract epithelia to date. Even so, inherent limitations of the study exist. Since the samples consisted of discarded surgical and post-mortem epithelia, the quantity of usable specimens collected varied from 1 to 9 individuals per epithelia. Moreover, epithelia from all areas of interest within the male urogenital tract were not available for collection. Efferent ducts, ejaculatory ducts, and Cowper's gland, a potential major mucin source, were not available for study.

Further study of mucins in the male urogenital tract may yield information regarding the functional importance of specific mucins in the maintenance of normal reproductive health, including defense against pathogens. The mucin profile and expression level in male urogenital tract epithelia in diseased states, such as infections with sexually transmitted pathogens, will thus be of interest, particularly if downregulation occurs. Effects of inflammation resulting from infections on mucin expression have not been investigated in these epithelia, and, since information on regulators of mucin expression is beginning to be known, therapeutic agents targeted at regulation may be feasible.

Summary Sentence

Tissue-specific mucin repertoires were observed in the human male urogenital tract epithelia; MUC1 and MUC4 expression in prostatic epithelium is not under direct androgenic control.

Acknowledgement

The work in this paper was supported by NIH/NIAID PO1 AI046518

References

  • Argueso P, Balaram M, Spurr-Michaud S, Keutmann HT, Dana MR, Gipson IK. Decreased levels of the goblet cell mucin MUC5AC in tears of patients with Sjögren's syndrome. Invest Ophthalmol Vis Sci. 2002;43:1004–1011. [PubMed]
  • Argueso P, Spurr-Michaud S, Russo CL, Tisdale A, Gipson IK. MUC16 mucin is expressed by the human ocular surface epithelia and carries the H185 carbohydrate epitope. Invest Ophthalmol Vis Sci. 2003;44:2487–2495. [PubMed]
  • Arias EB, Verhage HG, Jaffe RC. Complementary deoxyribonucleic acid cloning and molecular characterization of an estrogen-dependent human oviductal glycoprotein. Biol Reprod. 1994;51:685–694. [PubMed]
  • Bartman AE, Buisine MP, Aubert JP, Niehans GA, Toribara NW, Kim YS, Kelly EJ, Crabtree JE, Ho SB. The MUC6 secretory mucin gene is expressed in a wide variety of epithelial tissues. J Pathol. 1998;186:398–405. [PubMed]
  • Bernacki SH, Nelson AL, Abdullah L, Sheehan JK, Harris A, Davis CW, Randell SH. Mucin gene expression during differentiation of human airway epithelia in vitro. MUC4 and MUC5B are strongly induced. Am J Respir Cell Mol Biol. 1999;20:595–604. [PubMed]
  • Bobek LA, Tsai H, Biesbrock AR, Levine MJ. Molecular cloning, sequence, and specificity of expression of the gene encoding the low molecular weight human salivary mucin (MUC7) J Biol Chem. 1993;268:20563–20569. [PubMed]
  • Bramwell ME, Wiseman G, Shotton DM. Electron-microscopic studies of the CA antigen, epitectin. J Cell Sci. 1986;86:249–261. [PubMed]
  • Burchell J, Wang D, Taylor-Papadimitriou J. Detection of the tumor-associated antigens recognized by the monoclonal antibodies HMFG-1 and 2 in serum from patients with breast cancer. Int J Cancer. 1984;34:763–768. [PubMed]
  • Carraway KL, Ramsauer VP, Haq B, Carothers Carraway CA. Cell signaling through membrane mucins. Bioessays. 2002;25:66–71. [PubMed]
  • Carson DD, DeSouza MM, Kardon R, Zhou X, Lagow E, Julian J. Mucin expression and function in the female reproductive tract. Hum Reprod Update. 1998;4:459–464. [PubMed]
  • Chen J, Zhao YH, Kalaslavade TB, Hamati E, Nehrke K, Le AD, Ann DK, Wu R. Genome-wide search and identification of a novel gel-forming mucin MUC19/Muc19 in glandular tissues. Am J Respir Cell Mol Biol. 2004;30:155–165. [PubMed]
  • Corfield AP, Carroll D, Myerscough N, Probert CS. Mucins in the gastrointestinal tract in health and disease. Front Biosci. 2001;6:D1321–1357. [PubMed]
  • DeSouza MM, Lagow E, Carson DD. Mucin functions and expression in mammalian reproductive tract tissues. Biochem Biophys Res Commun. 1998;247:1–6. [PubMed]
  • Dufosse J, Porchet N, Audie JP, Guyonnet-Duperat V, Laine A, Van-Seuningen I, Marranchi S, Degand P, Aubert JP. Degenerate 87-base-pair tandem repeats create hydrophilic/hydrophobic alternating domains in human mucin peptides mapped to 11p15. Biochem J. 1993;293:329–337. [PubMed]
  • Durrant LG, Jacobs E, Price MR. Production of monoclonal antibodies recognising the peptide core of MUC2 intestinal mucin. Eur J Cancer. 1994;30A:355–363. [PubMed]
  • Ellingham RB, Myerscough N, Gout, II, Berry M, Corfield AP. Soluble mucins in human aqueous tears. Biochem Soc Trans. 1997;25:12S. [PubMed]
  • Eriksen GV, Carlstedt I, Uldbjerg N, Ernst E. Cervical mucins affect the motility of human spermatozoa in vitro. Fertil Steril. 1998;70:350–354. [PubMed]
  • Finkbeiner WE, Carrier SD, Teresi CE. Reverse transcription-polymerase chain reaction (RT-PCR) pheontypic analysis of cell cultures of human tracheal epithelium, tracheobronchial glands, and lung carcinomas. Am J Respir Cell Mol Biol. 1993;9:547–556. [PubMed]
  • Franke FE, Kraus S, Eiermann C, Pauls K, Lalani EN, Bergmann M. MUC1 in normal and impaired spermatogenesis. Mol Hum Reprod. 2001;7:505–512. [PubMed]
  • Gendler SJ. MUC1, the renaissance molecule. J Mammary Gland Biol Neoplasia. 2001;6:339–353. [PubMed]
  • Gendler SJ, Burchell JM, Duhig T, Lamport D, White R, Parker M, Taylor-Papadimitriou J. Cloning of partial cDNA encoding differentiation and tumor-associated mucin glycoproteins expressed by human mammary epithelium. Proc Natl Acad Sci USA. 1987;84:6060–6064. [PubMed]
  • Gendler SJ, Spicer AP. Epithelial mucin genes. Annu Rev Physiol. 1995;57:607–634. [PubMed]
  • Gipson I, Argueso P. The role of mucins in the function of the corneal and conjunctival epithelia. Int Rev Cytol. 2003;231:1–49. [PubMed]
  • Gipson IK. Mucins of the human endocervix. Frontiers Bio Sci. 2001;6:D1245–D1255. [PubMed]
  • Gipson IK, Ho SB, Spurr-Michaud SJ, Tisdale AS, Zhan Q, Torlakovic E, Pudney J, Anderson DJ, Toribara NW, Hill JA., 3rd Mucin genes expressed by human female reproductive tract epithelia. Biol Reprod. 1997;56:999–1011. [PubMed]
  • Gipson IK, Hori Y, Argueso P. Character of ocular surface mucins and their alteration in dry eye disease. Ocul Surf. 2004;2:131–148. [PubMed]
  • Gipson IK, Moccia R, Spurr-Michaud S, Argüeso P, Gargiulo AR, Hill JAI, Offner GD, Keutmann HT. The amount of MUC5B mucin in cervical mucus peaks at midcycle. J Clin Endocrinol Metabol. 2001;86:594–600. [PubMed]
  • Gipson IK, Spurr-Michaud S, Argueso P, Tisdale A, Ng TF, Russo CL. Mucin gene expression in immortalized human corneal-limbal and conjunctival epithelial cell lines. Invest Ophthalmol Vis Sci. 2003;44:2496–2506. [PubMed]
  • Gipson IK, Spurr-Michaud S, Moccia R, Zhan Q, Toribara N, Ho SB, Gargiulo AR, Hill JA., 3rd MUC4 and MUC5B transcripts are the prevalent mucin messenger ribonucleic acids of the human endocervix. Biol Reprod. 1999;60:58–64. [PubMed]
  • Gipson IK, Yankauckas M, Spurr-Michaud SJ, Tisdale AS, Rinehart W. Characteristics of a glycoprotein in the ocular surface glycocalyx. Invest Ophthalmol Vis Sci. 1992;33:218–227. [PubMed]
  • Gold DV, Lew K, Maliniak R, Hernandez M, Cardillo T. Characterization of monoclonal antibody PAM4 reactive with a pancreatic cancer mucin. Int J Cancer. 1994;57:204–210. [PubMed]
  • Gum JR, Byrd JC, Hicks JW, Toribara NW, Lamport DTA, Kim YS. Molecular cloning of human intestinal mucin cDNAs. Sequence analysis and evidence for genetic polymorphism. J Biol Chem. 1989;264:6480–6487. [PubMed]
  • Gum JR, Hicks JW, Swallow DM, Lagace RL, Byrd JC, Lamport DTA, Siddiki B, Kim YS. Molecular cloning of cDNAs derived from a novel human intestinal mucin gene. Biochem Biophysic Res Communic. 1990;171:407–415. [PubMed]
  • Gum JR, Jr., Crawley SC, Hicks JW, Szymkowski DE, Kim YS. MUC17, a novel membrane-tethered mucin. Biochem Biophys Res Commun. 2002;291:466–475. [PubMed]
  • Guyonnet Duperat V, Audie J-P, Debailleul V, Laine A, Buisine M-P, Galiegue-Zouitina S, Pigny P, Degand P, Aubert J-P, Porchet N. Characterization of the human mucin gene MUC5AC: a consensus cysteine-rich domain for 11p15 mucin genes? Biochem J. 1995;305:211–219. [PubMed]
  • Higuchi T, Orita T, Nakanishi S, Katsuya K, Watanabe H, Yamasaki Y, Waga I, Nanayama T, Yamamoto Y, Munger W, et al. Molecular cloning, genomic structure, and expression analysis of MUC20, a novel mucin protein, up-regulated in injured kidney. J Biol Chem. 2004;279:1968–1979. [PubMed]
  • Hilkens J, Ligtenberg MJL, Vos HL, Litvinov SV. Cell membrane-associated mucins and their adhesion-modulating property. Trends Biochem Sci. 1992;17:359–363. [PubMed]
  • Ho SB, Niehans GA, Lyftogt C, Yan P-S, Cherwitz DL, Gum ET, Dahiya R, Kim YS. Heterogeneity of mucin gene expression in normal and neoplastic tissues. Cancer Res. 1993;53:641–651. [PubMed]
  • Ho SB, Roberton AM, Shekels LL, Lyftogt CT, Niehans GA, Toribara NW. Expression cloning of gastric mucin cDNA and localization of mucin gene expression. Gastroenterology. 1995;109:735–747. [PubMed]
  • Hori Y, Spurr-Michaud S, Russo C, Argueso P, Gipson I. Differential regulation of membrane-associated mucins in the human ocular surface epithelium. Invest Ophthalmol Vis Sci. 2004;45:114–122. [PubMed]
  • Inatomi T, Spurr-Michaud S, Tisdale AS, Gipson IK. Human corneal and conjunctival epithelia express MUC1 mucin. Invest Ophthalmol Vis Sci. 1995;36:1818–1827. [PubMed]
  • Jeffery PK, Li D. Airway mucosa: secretory cells, mucus and mucin genes. Eur Respir J. 1997;10:1655–1662. [PubMed]
  • Jumblatt MM, McKenzie RW, Jumblatt JE. MUC5AC mucin is a component of the human precorneal tear film. Invest Ophthalmol Vis Sci. 1999;40:43–49. [PubMed]
  • Komatsu M, Carraway CA, Fregien NL, Carraway KL. Reversible disruption of cell-matrix and cell-cell interactions by overexpression of sialomucin complex. J Biol Chem. 1997;272:33245–33254. [PubMed]
  • Lagow E, DeSouza MM, Carson DD. Mammalian reproductive tract mucins. Hum Reprod Update. 1999;5:280–292. [PubMed]
  • Lan MS, Batra SK, Qi WN, Metzgar RS, Hollingsworth MA. Cloning and sequencing of a human pancreatic tumor mucin cDNA. J Biol Chem. 1990;265:15294–15299. [PubMed]
  • Lau KM, LaSpina M, Long J, Ho SM. Expression of estrogen receptor (ER)-alpha and ER-beta in normal and malignant prostatic epithelial cells: regulation by methylation and involvement in growth regulation. Cancer Res. 2000;60:3175–3182. [PubMed]
  • Leroy X, Ballereau C, Villers A, Saint F, Aubert S, Gosselin B, Porchet N, Copin MC. MUC6 is a marker of seminal vesicle-ejaculatory duct epithelium and is useful for the differential diagnosis with prostate adenocarcinoma. Am J Surg Pathol. 2003;27:519–521. [PubMed]
  • Ligtenberg MJL, Buijs F, Yos HL, Hilkens J. Suppression of cellular aggregation of high levels of episialin. Cancer Res. 1992;52:2318–2324. [PubMed]
  • Linsley PS, Ochs V, Laska S, Horn D, Ring DB, Frankel AE, Brown JP. Elevated levels of a high molecular weight antigen detected by antibody W1 in sera from breast cancer patients. Cancer Res. 1986;46:5444–5450. [PubMed]
  • Meezaman D, Charles P, Daskal E, Polymeropoulos MH, Martin BM, Rose MC. Cloning and analysis of cDNA encoding a major airway glycoprotein, human tracheobronchial mucin (MUC5) J Biol Chem. 1994;269:12932–12939. [PubMed]
  • Moniaux N, Escande F, Porchet N, Aubert JP, Batra SK. Structural organization and classification of the human mucin genes. Front Biosci. 2001;6:D1192–1206. [PubMed]
  • Moniaux N, Varshney GC, Chauhan SC, Copin MC, Jiain M, Wittel UA, Andiranifahanana M, Aubert JP, Batra SK. Generation and characterization of anti-MUC4 monoclonal antibodies reactive with normal and cancer cells in humans. J Histochem Cytochem. 2004;52:253–261. [PubMed]
  • N'Dow J, Pearson JP, Bennett MK, Neal DE, Robson CN. Mucin gene expression in human urothelium and in intestinal segments transposed into the urinary tract. J Urol. 2000;164:1398–1404. [PubMed]
  • Nelson JD, Havener VR, Cameron JD. Cellulose acetate impressions of the ocular surface. Dry eye states. Arch Ophthalmol. 1983;101:1869–1872. [PubMed]
  • Ness RB, Markovic N, Carlson CL, Coughlin MT. Do men become infertile after having sexually transmitted urethritis? An epidemiologic examination. Fertil Steril. 1997;68:205–213. [PubMed]
  • O'Connor JC, Julian J, Lim SD, Carson DD. MUC1 expression in human prostate cancer cell lines and primary tumors. Prostate Cancer Prostatic Dis. 2005;8:36–44. [PubMed]
  • Owen DH, Katz DF. A review of the physical and chemical properties of human semen and the formulation of a semen simulant. J Androl. 2005;26:459–469. [PubMed]
  • Paju A, Bjartell A, Zhang WM, Nordling S, Borgstrom A, Hansson J, Stenman UH. Expression and characterization of trypsinogen produced in the human male genital tract. Am J Pathol. 2000;157:2011–2021. [PubMed]
  • Pallesen LT, Berglund L, Rasmussen LK, Petersen TE, Rasmussen JT. Isolation and characterization of MUC15, a novel cell membrane-associated mucin. Eur J Biochem. 2002;269:2755–2763. [PubMed]
  • Pandey P, Kharbanda S, Kufe D. Association of the DF3/MUC1 breast cancer antigen with Grb2 and the Sos/Ras exchange protein. Cancer Res. 1995;55:4000–4003. [PubMed]
  • Perez-Vilar J, Hill RL. The structure and assembly of secreted mucins. J Biol Chem. 1999;274:31751–31754. [PubMed]
  • Pflugfelder SC, Liu Z, Monroy D, Li D-Q, Carvajal MC, Price-Schiavi SA, Idris N, Solomon A, Perez A, Carraway KL. Detection of sialomucin complex (MUC4) in human ocular surface epithelium and tear fluid. Invest Ophthalmol Vis Sci. 2000;41:1316–1326. [PubMed]
  • Porchet N, Nguyen VC, Duffosse J, Audie JP, Guyonnet-Duperat V, Gross MS, Denis C, Degand P, Bernheim A, Aubert JP. Molecular cloning and chromosomal localization of a novel human tracheo-bronchial mucin cDNA containing tandemly repeated sequences of 48 base pairs. Biochem Biophys Res Commun. 1991;175:414–422. [PubMed]
  • Pratt WS, Crawley S, Hicks J, Ho J, Nash M, Kim YS, Gum JR, Swallow DM. Multiple transcripts of MUC3: evidence for two genes, MUC3A and MUC3B. Biochem Biophys Res Commun. 2000;275:916–923. [PubMed]
  • Quin RJ, McGuckin MA. Phosphorylation of the cytoplasmic domain of the MUC1 mucin correlates with changes in cell-cell adhesion. Int J Cancer. 2000;87:499–506. [PubMed]
  • Reis CA, David L, Carvalho F, Mandel U, de Bolos C, Mirgorodskaya E, Clausen H, Sobrinho-Simoes M. Immunohistochemical study of the expression of MUC6 mucin and co-expression of other secreted mucins (MUC5AC and MUC2) in human gastric carcinomas. J Histochem Cytochem. 2000;48:377–388. [PubMed]
  • Reis CA, David L, Nielsen PA, Clausen H, Mirgorodskaya K, Roepstorff P, Sobrinho-Simoes M. Immunohistochemical study of MUC5AC expression in human gastric carcinomas using a novel monoclonal antibody. Int J Cancer. 1997;74:112–121. [PubMed]
  • Ren J, Li Y, Kufe D. Protein kinase C delta regulates function of the DF3/MUC1 carcinoma antigen in beta-catenin signaling. J Biol Chem. 2002;277:17616–17622. [PubMed]
  • Rossi EA, McNeer RR, Price-Schiavi SA, Van den Brand JMH, Komatsu M, Thompson JF, Carraway CAC, Fregien NL, Carraway KL. Sialomucin complex, a heterodimeric glycoprotein complex. Expression as a soluble, secretable form in lactating mammary gland and colon. J Biol Chem. 1996;271:33476–33485. [PubMed]
  • Shankar V, Gilmore MS, Elkins RC, Sachdev GP. A novel human airway mucin cDNA encodes a protein with unique tandem-repeat organization. Biochem J. 1994;300:295–298. [PubMed]
  • Spurr-Michaud S, Argueso P, Gipson IK. Detection of multiple mucin species in human tear film samples. Invest Ophthalmol Vis Sci. 2004;45 E-abstract 3883.
  • Thornton D, Khan N, Sheehan D. Separation and identification of mucins and their glycoforms. In: Corfield AP, editor. Glycoprotein Methods and Protocols: The Mucins. Humana Press; Totowa: 2000. pp. 77–85.
  • Toribara NW, Ho SB, Gum E, Gum J, Jr., Lau P, Kim YS. The carboxyl-terminal sequence of the human secretory mucin, MUC6. J Biol Chem. 1997;272:16398–16403. [PubMed]
  • Toribara NW, Roberton AM, Ho SB, Kuo WL, Gum E, Siddiki B, Kim YS. Human gastric mucin: identification of a unique species by expression cloning. J Biol Chem. 1993;268:5879–5885. [PubMed]
  • Wesseling J, van der Valk SW, Vos HL, Sonnenberg A, Hilkens J. Episialin (MUC1) overexpression inhibits integrin-mediated cell adhesion to extracelllar matrix components. J Cell Biol. 1995;129:255–265. [PMC free article] [PubMed]
  • Williams SJ, McGuckin MA, Gotley DC, Eyre HJ, Sutherland GR, Antalis TM. Two novel mucin genes down-regulated in colorectal cancer identified by differential display. Cancer Res. 1999;59:4083–4089. [PubMed]
  • Williams SJ, Wreschner DH, Tran M, Eyre HJ, Sutherland GR, McGuckin MA. Muc13, a novel human cell surface mucin expressed by epithelial and hemopoietic cells. J Biol Chem. 2001;276:18327–18336. [PubMed]
  • Yamamoto M, Bharti A, Li Y, Kufe D. Interaction of the DF3/MUC1 breast carcinoma-associated antigen and beta-catenin in cell adhesion. J Biol Chem. 1997;272:12492–12494. [PubMed]
  • Yin BW, Dnistrian A, Lloyd KO. Ovarian cancer antigen CA125 is encoded by the MUC16 mucin gene. Int J Cancer. 2002;98:737–740. [PubMed]
  • Yin BW, Lloyd KO. Molecular cloning of the CA125 ovarian cancer antigen: Identification as a new mucin, MUC16. J Biol Chem. 2001;276:27371–27375. [PubMed]
  • Zhao H, Jumblatt JE, Wood TO, Jumblatt MM. Quantification of MUC5AC protein in human tears. Cornea. 2001;20:873–877. [PubMed]
  • Zrihan-Licht S, Baruch A, Elroy-Stein O, Keydar I, Wreschner DH. Tyrosine phosphorylation of the MUC1 breast cancer membrane proteins. Cytokine receptor-like molecules. FEBS Lett. 1994;356:130–136. [PubMed]