PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of npgopennature.com homepage
Nature Communications
 
Nat Commun. 2010 April 12; 1(1): 1–12.
PMCID: PMC2892298
NIHMSID: NIHMS196876

Organogenesis relies on SoxC transcription factors for the survival of neural and mesenchymal progenitors

Abstract

During organogenesis, neural and mesenchymal progenitor cells give rise to many cell lineages, but their molecular requirements for self-renewal and lineage decisions are incompletely understood. In this study, we show that their survival critically relies on the redundantly acting SoxC transcription factors Sox4, Sox11 and Sox12. The more SoxC alleles that are deleted in mouse embryos, the more severe and widespread organ hypoplasia is. SoxC triple-null embryos die at midgestation unturned and tiny, with normal patterning and lineage specification, but with massively dying neural and mesenchymal progenitor cells. Specific inactivation of SoxC genes in neural and mesenchymal cells leads to selective apoptosis of these cells, suggesting SoxC cell-autonomous roles. Tead2 functionally interacts with SoxC genes in embryonic development, and is a direct target of SoxC proteins. SoxC genes therefore ensure neural and mesenchymal progenitor cell survival, and function in part by activating this transcriptional mediator of the Hippo signalling pathway.

Neural and mesenchymal progenitor cells arise in developing embryos from ectoderm, mesoderm and endoderm. As they actively self-renew, neural cells also give rise to all neuronal and glial cell types, whereas mesenchymal cells form stromal cells, osteoblasts, chondrocytes, adipocytes and myoblasts, among other cell types. These multipotent progenitor cells thereby have essential roles in organogenesis. They are still present in adult tissues, but are much less abundant than in embryonic tissues. They are then typically referred to as neural and mesenchymal stem cells. Evidence is increasing that they have key roles in normal tissue turnover and repair, and in the development of such diseases as cancers1,2,3. Active research is conducted worldwide to decipher the key features of these cells and their molecular regulation, not only to understand the basis of developmental, physiological and pathological processes but also because of the great promise that these cells could be used in therapies for many types of acquired and inherited diseases. However, many questions remain to be answered regarding the identity and regulation of these cells.

Sox genes form a family of 20 in mammals4,5. They code for transcription factors featuring a high-mobility-group DNA-binding domain closely related to that of the male sex-determining protein Sry. Many have been shown to have master roles in the fate determination of specific cell types. For instance, Sox2 specifies the identity of embryonic stem cells in concert with Oct3/4, Klf4 and c-Myc6; Sry and Sox9 specify Sertoli cell fate and differentiation7; Sox5, Sox6 and Sox9 function together to specify the fate and differentiation of chondrocytes8; and Sox18 specifies lymphatic endothelial cells9. The Sox family is divided into eight groups, A to H, according to protein identity. Sox4, Sox11 and Sox12 form the SoxC group10. They share a high degree of identity in the high-mobility-group domain, as well as in a group-specific transactivation domain11,12. Yet, sequence divergence within the latter domain explains that Sox11 is up to an order of magnitude more potent than Sox12 in activating reporter constructs in cultured cells, and that Sox4 exhibits an intermediate level of activity. Studies in mouse embryos have demonstrated that the three genes stand out by their high and concomitant expression in multipotent neural and mesenchymal progenitors11,12,13,14. As these cells differentiate, SoxC genes remain expressed only in a few cell lineages in a partially overlapping manner. Roles for SoxC genes in neural and mesenchymal progenitors are, however, yet to be demonstrated.

Previous functional studies have revealed that Sox4−/− mice die at embryonic day 14 (E14) from a heart outflow tract malformation referred to as common trunk, and from incomplete ventricular septation, but they seem normal otherwise15. Sox11−/− mice die shortly after birth, with heart malformations similar to, but less severe than, those of Sox4−/− mice14. They also exhibit internal organ malformations, including dysgenesis of the anterior eye segment, hypoplastic lungs and undermineralized bones and lack the spleen. Notably, the affected cell types have not been described in either mutant and the cellular and molecular mechanisms underlying these defects are unknown. Additional studies have shown that Sox4 is required to facilitate differentiation of T and B lymphocytes15,16, pancreatic β-cells17 and osteoblasts18, but the mechanisms remain unclear. Defects in the central or peripheral nervous system were not described in Sox4−/− and Sox11−/− mice, but gene knockdown experiments in the chicken embryo have suggested that Sox4 and Sox11 function in redundancy to promote pan-neuronal marker gene expression19. However, no data were provided in this study on Sox4 and Sox11 single-gene knockdowns to support the conclusion of gene redundancy. Sox12−/− mice are viable, fertile and do not exhibit any obvious defect12, leaving Sox12 as one of only two Sox genes with no known function in vivo.

Recent studies have shown upregulation of Sox4 or Sox11 in various types of cancers, including medulloblastomas20, gliomas21,22, non-B-cell lymphomas23 and prostate24 and colon cancer25. These genes have been reported to be indicators of either good or poor prognosis in cancer patients, and to have possible but yet unclear roles in metastatic invasion, cell survival, apoptosis and differentiation22,26,27,28.

This survey of literature reveals that the roles of SoxC genes are still poorly understood and likely to be context dependent. On the basis of their strong and overlapping expression in neural and mesenchymal progenitors, we hypothesized that SoxC genes have important functions in these cells that were not apparent in single knockout experiments because of gene redundancy. We tested this hypothesis by generating mouse embryos lacking increasing numbers of SoxC alleles in a global or cell-type-specific manner. We find that the three genes are redundantly required for successful organogenesis. They primarily control survival of neural and mesenchymal progenitors and function at least in part by activating the gene for Tead2, a transcriptional mediator of the Hippo pathway.

Results

SoxC genes fulfil key roles in organogenesis

We tested the possibility that the three SoxC genes exert important redundant functions in vivo by generating mice harbouring all combinations of SoxC-null alleles. We used a previously described Sox4 conditional null allele29 (Sox4fl) in combination with a new Sox11 conditional null allele (Sox11fl; Supplementary Fig. S1) and a new Sox12-null allele (Sox12; Supplementary Fig. S2). We recombined the conditional alleles in the germ line of male and female breeders using PrmCre30 and Zp3Cre31 transgenes, respectively, and thereby obtained embryos containing wild-type and/or SoxC-null alleles (Supplementary Fig. S3).

Sox4+/− and Sox11+/− mice were indistinguishable from wild-type littermates, as reported14,15. In contrast, Sox4+/−11+/− mice died on birth, similar to Sox11−/− littermates (Fig. 1a, Supplementary Fig. S4 and Supplementary Table S1). Both types of mice displayed an incomplete septation of the heart ventricles. In addition, the aorta and pulmonary arteries were distinct in Sox4+/−11+/− mice but both originated in the right ventricle. They were fused in Sox11−/− mice and also originated in the right ventricle (Fig. 1b, Supplementary Fig. S4 and Supplementary Table S1). These two types of outflow tract malformations are known as double-outlet right ventricle and common trunk, respectively, and reflect endocardial ridge dysgenesis with variable severity. Both mouse types also had similar skeletal malformations: hypoplastic sternebrae, unfused lumbar vertebral bodies and hypomineralized skull (Fig. 1c,d and Supplementary Fig. S4). About 50% Sox11−/− and Sox4+/−11+/− mice had omphalocele. All Sox11−/− mice were asplenic, and about 60% Sox4+/−11+/− mice were hyposplenic. All Sox11−/− newborns had microphthalmia and open eyelids and 40% had a cleft palate, cleft lips and a kinked tail, whereas no Sox4+/−11+/− littermates had these defects (Supplementary Table S1). Sox4+/−11+/− mice thus exhibited a subset of the pleiotropic malformations of Sox11−/− mice, and these malformations were generally milder.

Figure 1
SoxC genes functionally interact with each other in multiple developmental processes.

Sox12−/− mice looked normal and were viable and fertile, as described12. Interestingly, however, inactivating Sox12 worsened the disease phenotype of Sox4+/−11+/− mice. Many Sox4+/−11+/−12−/− mice had an arterial common trunk, and all had aggravated sternal and vertebral malformations, compared with Sox4+/−11+/− littermates (Fig. 1e–h Supplementary Fig. S5 and Supplementary Table S1).

Sox4+/−11−/− mice died in utero between E14.5 and E16.5, with an arterial common trunk and hypoplastic myocardium and semilunar valves (Supplementary Fig. S6). They had many other underdeveloped organs as well, such as eyes, lungs and skeleton, and were thus more severely affected than Sox4+/−11+/− and Sox11−/− mice.

Sox4+/−11−/− and Sox4−/−11−/− embryos died around E10.5. At E9.5, Sox4−/−11−/− embryos were similar, but more affected than Sox4+/−11−/− littermates. They were tiny and unturned (Fig. 2a–c). The heart primordia had not fused. The neural tube was thin, undulated and rostrally open. Limbs were failing to bud, and somites were rudimentary. These embryos thus arrested their development around E8.5. Sox4−/−11−/−12−/− littermates were slightly more affected (Fig. 2d).

Figure 2
SoxC genes are necessary in early organogenesis.

The fact that phenotypic severity increased in parallel with the number of SoxC-deleted alleles demonstrates that the three genes functionally interact with each other to fulfil key roles in organogenesis.

SoxC genes control neural and mesenchymal cell survival

To identify the original nature of the defects of Sox4−/−11−/−12−/− embryos, we first examined the expression pattern of SoxC genes in wild-type embryos when these mutants start failing (Supplementary Fig. S7). We found all three genes expressed throughout most embryonic structures, indicating that these genes could directly control most organogenetic processes.

We then analysed the expression of genes involved in cell lineage determination and embryo patterning in Sox4−/−11−/− embryos. We found that neural tube markers were properly expressed along the dorsoventral (Pax7, Ptc1, Shh) and anteroposterior axes (Otx2, Fgf8, HoxB9) (Fig. 3a,b). Similarly, notochord (Shh, Brachyury), sclerotome (Pax1), lateral/ventral mesoderm (Bmp4), myotome (Myf5) and dermomyotome (Pax7) markers and regulatory genes were also normally expressed (Fig. 3a).

Figure 3
Embryo axial patterning and tissue specification are not affected by SoxC inactivation.

We next analysed cell death and proliferation. TdT-mediated dUTP nick end labeling assays revealed a drastic increase in cell death in the neural tube, branchial arches and somites of E9.5 Sox4−/−11−/− embryos (Fig. 4a). To rule out that cell death was a consequence of global embryo failure, we specifically inactivated Sox4 and Sox11 in specific cell types (Fig. 4b–e). Neuronal-specific inactivation using a Brn4Cre32 transgene resulted in a strong and selective increase in cell death in the neural tube (Fig. 4b). Similarly, specific inactivation in the neural crest using a Wnt1Cre33 transgene did not prevent cell delamination from the neural tube and migration into specific sites in the embryos, as proven by cell tracking with the Rosa26lacZ Cre reporter34, but led to massive cell death in branchial arches (Fig. 4c). Specific inactivation in limb bud mesenchyme using a Prx1Cre transgene35 resulted in a large increase in cell death in this tissue (Fig. 4d). Furthermore, inactivation in primary limb bud cells using Cre adenoviral infection also resulted in increased cell death (Fig. 4f).

Figure 4
SoxC genes are required for neural and mesenchymal cell survival.

Phospho-histone-3 immunostaining and 5-bromodeoxyuridine (BrdU) incorporation assays showed a significant reduction in cell proliferation in the neural tube, branchial arches and somites of Sox4−/−11−/− embryos (Fig. 5a). In contrast, specific inactivation of Sox4 and Sox11 in these structures in vivo or in corresponding primary cells in vitro did not alter cell proliferation (Fig. 5b–e).

Figure 5
The rate of cell proliferation is reduced in Sox4−/−11−/− embryos, not in conditional mutants.

We conclude that SoxC genes are not needed for embryo patterning and cell lineage specification, but are required for cell survival in such tissues as neural tube, branchial arch, somite and limb bud. Effects on cell proliferation are likely to be secondary. At the time of analysis, most cells in these tissues are at the neural and mesenchymal progenitor stages. Their high-level expression of SoxC genes strongly suggests that the genes function in a cell-autonomous manner. Furthermore, widespread death of progenitors likely caused the catastrophic failure of SoxC mutant embryos.

SoxC genes function upstream of Tead2

To identify how SoxC genes mediate their functions, we screened RNA isolated from Sox4fl/fl11fl/fl primary limb bud cells treated with Cre- or LacZ-expressing adenovirus in gene expression microarrays. As SoxC proteins are transcriptional activators, we focused on genes downregulated in SoxC mutant cells. Expression of 38 genes was downregulated at least twofold (Supplementary Table S2). Tead2 figured in the top 10 and we chose to focus on this gene because it is the only one known to promote cell survival during organogenesis. Tead2 and its family members encode transcription factors that associate with YAP and TAZ coactivators to mediate cell survival and proliferation downstream of the Hippo signalling pathway36. This pathway intrinsically controls organ size in development and tumour growth. Tead2-null mice occasionally show a neural tube closure defect37, but are otherwise normal. Inactivation of Tead2, however, aggravates the phenotype of Tead1-null mice and results in an embryo phenotype strikingly similar to that of SoxC-null embryos38. We confirmed that expression of Tead2, but not expression of its family members, was significantly downregulated in SoxC mutant embryos, primary limb bud cells and undifferentiated osteoblasts, using real-time reverse transcription–PCR and RNA hybridization in situ (Fig. 6a–c and Supplementary Fig. S8a–d). We then determined whether Tead2 downregulation could contribute to the phenotype of SoxC mutants. We found that Tead2−/−Sox4+/−11+/− embryos had a significantly higher incidence of heart double-outlet right ventricle and ventricular septation defects than Tead2−/− and Sox4+/−11+/− littermates and also had more severe and more frequent vertebral malformations (Fig. 6d,e). A gradual increase in the incidence of mesenchymal cell death was measured around the notochord of E11.5 embryos, as progressively more Tead2 and SoxC alleles were deleted (Fig. 6f). This rise in cell death was specific to the lumbar region, and thus likely explains the increased severity and occurrence of lumbar vertebral malformations seen in Tead2/SoxC compound mutants. We next tested whether forced expression of Tead2 would be sufficient to rescue the cell death phenotype caused by SoxC inactivation. We found that exogenous expression of wild-type Tead2 in undifferentiated primary osteoblasts was insufficient to prevent cell death on SoxC inactivation, but that a constitutively active form of Tead2, obtained by fusing Tead2 with the YAP transactivation domain39, was able to fully rescue this phenotype (Fig. 6g). Together, these data thus strongly suggest that SoxC genes control cell survival upstream of Tead2 and the Hippo pathway.

Figure 6
Tead2 is expressed and functions downstream of the SoxC genes.

Tead2 is a direct target of SoxC proteins

To test whether Tead2 is a direct target of SoxC proteins, we first searched for putative regulatory regions in the form of highly conserved, non-coding, non-repetitive sequences within and around Tead2 (Fig. 7a). The only regions fitting these criteria were a 105 bp sequence encompassing the promoter and first exon (referred to as PE1), and a 500 bp sequence in the middle of the first intron (InS). We constructed reporter genes and found that each SoxC protein robustly activated reporters containing both InS and PE1 sequences in transiently transfected Cos1 cells (Fig. 7b,c). Sequence analysis revealed two putative Sox-binding sites in PE1, and three in InS (Fig. 7a,d). Sox4 efficiently bound to all but one of these sites in an electrophoretic mobility shift assay (Fig. 7e). Mutations that specifically abolished Sox4 binding in electrophoretic mobility shift assay also reduced reporter transactivation, strongly suggesting that SoxC proteins directly activate these reporters (Fig. 7c). To test whether these factors directly transactivate Tead2 in vivo, we performed a chromatin immunoprecipitation assay in C3H-10T1/2 mesenchymal cells expressing FLAG-Sox proteins. A FLAG antibody specifically precipitated PE1- and InS-containing chromatin fragments in FLAG-SoxC-expressing cells. Interestingly, an RNA polymerase II antibody specifically precipitated PE1-containing chromatin fragments only from FLAG-SoxC-expressing cells (Fig. 7f). These data thus demonstrate that Tead2 is a direct target of SoxC proteins.

Figure 7
SoxC proteins directly activate Tead2.

Discussion

This study revealed that the three SoxC genes largely work in redundancy to fulfil essential functions from the onset of mouse organogenesis. They have a primary role in ensuring survival of early neural and mesenchymal cells, the progenitors of many cell lineages, and they function at least in part by directly targeting the gene for Tead2, a transcription factor involved in mediating the intrinsic organ growth function of the Hippo signalling pathway (Fig. 8).

Figure 8
Model for the roles of SoxC genes in organogenesis.

Previous studies showed that Sox4−/− mice die at E14 from heart malformations15. Sox11−/− mice on the other hand die at birth with many hypoplastic or malformed organs14, whereas Sox12−/− mice are viable and look normal12. Sox4 and Sox11 were reported to function in redundancy to promote differentiation of neuronal cells in the chicken embryo, but no data were provided to demonstrate this redundancy19. This study is thus the first to demonstrate that Sox12 has functions in vivo and that the three SoxC genes function redundantly in a multitude of developmental processes. On comparing mice with all combinations of SoxC-null alleles, we deduced that the dosage of SoxC alleles is critical for many of their functions and that each gene contributes to this dosage with a different weight. Inactivation of Sox12 slightly aggravates the phenotype of Sox4+/−11+/− and Sox4−/−11−/− embryos, but has otherwise no consequence, indicating that Sox12 provides minor contribution. We have not formally ruled out that the Sox12 protein may be present at a low level compared with Sox4 and Sox11 in wild-type mice. However, our previous observations11,12 that the levels of the three SoxC RNAs are similar in most expression sites and that the Sox12 protein is a weak transactivator in vitro support the proposition that the minor contribution of Sox12 in vivo is due to the low transcriptional competence of its protein product. The aggravation of the phenotype of Sox4+/−11+/− mutants on inactivation of Sox12 also rules out that Sox12 quenches the activity of its relatives by competing with them for target gene binding without providing comparable transactivation. We showed that Sox4+/−11+/− mice are born with a subset of the defects of Sox11−/− mice and that these defects are often milder than those of Sox11−/− mice. In contrast, Sox4−/−11+/− embryos are more affected than Sox4+/−11−/− embryos in early organogenesis and are almost as severely affected as Sox4−/−11−/− embryos. Thus, Sox4 has more weight in early functions and Sox11 in later functions. The differences between the two genes could be due to differences in expression levels or to differences in protein activities according to molecular contexts.

We found that SoxC-null embryos are normal until E8.5, which demonstrates that SoxC genes are dispensable for embryo development through gastrulation. These embryos thus differ from Sox2-null embryos, which die around E3.5, because Sox2 is required to maintain the pluripotent cells of the epiblast and extraembryonic ectoderm that later give rise to all embryonic and trophoblast cell types, respectively40. Epiblast pluripotent cells are used to derive embryonic stem cells in culture, and the latter have been shown to express Sox4 and Sox1141. Interestingly, Sox4 was shown to directly control Sox2 expression downstream of transforming growth factor-β signalling in glioma-initiating stem cells in vitro42. However, we did not find a change in Sox2 expression in primary limb bud cell microarray experiments. In addition, SoxC-null embryos would die as early as Sox2-null embryos, should the SoxC proteins critically control Sox2 expression in early embryos. SoxC proteins might thus control Sox2 expression in specific contexts, but not in the early embryo.

We showed that SoxC-null embryos arrest in development at E8.5. This is when wild-type mouse embryos turn, fuse the heart primordia, close the neural tube, begin overt organogenesis and start to grow very rapidly. Neural and mesenchymal progenitor cells have central roles in many of these processes. Their massive death and reduced rate of proliferation in SoxC-null embryos are thus sufficient to account for the failure of these embryos to undergo organogenesis. Many distinct organs are affected in SoxC partial mutants, but failure to form or hypoplasia is a common feature. All defects could thus have the same origin, that is, a reduction in the number of progenitor cells. The high expression level of SoxC genes in neural and mesenchymal cells, and our observation that cell death also occurs when the genes are specifically inactivated in these cells, strongly suggests that SoxC genes function in a cell-autonomous manner.

The demonstration that SoxC genes are necessary for neural and mesenchymal cell survival raises the question of whether they are master regulators. This appellation would require SoxC genes to be sufficient for cell self-renewal as well, including cell identity, survival and proliferation. This cannot be tested easily in early embryos, in which cell death is minimal andmaintaining cells at a progenitor stage would be as detrimental as losing them. However, the results of recent studies are consistent with master roles for SoxC proteins. For instance, overexpression of Sox4 in glial cells in transgenic mice was shown to be sufficient to maintain the cells at an early stage43,44. Silencing of SOX4 was shown to induce apoptosis of prostate cancer cells in vitro, whereas stable expression in non-transformed prostate cells enabled colony formation in soft agar, supporting the notion that SOX4 might be both needed and sufficient for cell self-renewal24. SoxC genes may thus be master regulators in neural and mesenchymal progenitors in the same way as Sox2 is a master regulator for embryonic stem cells, and as other Sox genes are master regulators in differentiated cell lineages. This supports the concept that Sox genes fulfil critical functions in all cell types, whether pluripotent, multipotent or unipotent. Essential roles in neural and mesenchymal cells do not exclude the possibility that SoxC genes also control cell fate in differentiated cell lineages later. Many Sox genes, including Sox2, have indeed been shown to have distinct roles in more than one cell type, by cooperating with different partners in different cell types45. In fact, Sox4 was shown to promote B- and T-cell expansion and differentiation15,16; Sox4 and Sox11 control pan-neuronal differentiation in the central nervous system19, and Sox4+/− mice develop osteopenia in adulthood, possibly because of defects in osteoblast proliferation, differentiation and mineralization18.

At present, the only gene that has been convincingly demonstrated to be a SoxC direct target is Tubb319. It was validated through expression changes in vivo and in vitro, and through DNA-binding and transactivation assays in vitro. However, chromatin immunoprecipitation data were not provided to definitively demonstrate that SoxC proteins bind Tubb3 in live cells. Other studies proposed additional SoxC targets on the basis of expression changes on SoxC knockdown or overexpression in vitro, and on the basis of Sox consensus sites in promoter regions, but these studies lacked in vivo validation46. Our search for SoxC targets led to Tead2. We showed that Tead2 expression closely matches SoxC expression in wild-type embryos and is significantly downregulated in SoxC mutant embryos and cultured cells. SoxC proteins also bind Tead2 in vivo through conserved elements in the promoter and first intron, and these sites are necessary for SoxC-dependent transactivation of reporter genes. Furthermore, we showed that Tead2 functionally interacts with SoxC genes in vivo and that expression of a constitutively active form of Tead2 is sufficient to prevent cell death on SoxC inactivation in vitro. These data thus identify Tead2 as one of the few direct targets of SoxC proteins currently known in neural cells and as a first one in mesenchymal cells.

We selected Tead2 from a list of genes downregulated in SoxC mutant cells because of its implication as a transcriptional mediator of the Hippo signalling pathway. Similar to SoxC genes, this pathway is implicated in the intrinsic control of organ and cancer growth36. Moreover, Tead1/2-null mice fail in development at the same time as SoxC mutants, with no impairment in embryo patterning and cell lineage specification, but with decreased cell survival and proliferation. Of the four Tead genes, however, only Tead2 expression was downregulated in SoxC mutants. Together with the fact that Tead2-null mice are not as severely affected as SoxC mutants37, these data imply that SoxC proteins, similar to master genes, must control other important genes that are yet to be identified. Our microarray screening revealed that the expression level of many other genes was altered in SoxC mutants. However, the relevance of their expression changes is unknown, as the functions of these genes remain elusive. The fact that only a constitutively active form of Tead2, and not the wild-type protein, was able to rescue the cell death fate of SoxC-null cells in vitro suggests that the cells did not have enough YAP/TAZ coactivator available in the nucleus to associate with exogenous Tead2. As YAP/TAZ are phosphorylated and subsequently degraded in the cytoplasm downstream of Hippo signalling, it is possible that SoxC proteins control more signalling components than Tead2 in the Hippo pathway to allow YAP/TAZ to translocate into the nucleus and activate gene transcription in cooperation with Tead2. Our microarray screening experiment did not reveal gene expression changes for other Hippo signalling components, but it is possible that some of these components remain unknown or that SoxC proteins control protein activity rather than the gene expression of other Hippo signalling components.

Neural and mesenchymal progenitor cells have important roles beyond development in adult tissue homeostasis and repair, and in such diseases as cancers. The same is certainly true for SoxC genes, the upregulation and likely involvement of which in various types of cancers have been profusely documented. It is thus anticipated that the results of this study will inspire and help future studies to further elucidate the molecular control of embryonic neural and mesenchymal progenitors, the molecular control of neural and mesenchymal adult stem cells and the functions of SoxC genes in these cells.

Methods

Mice

Mouse Sox11 and Sox12 conditional null alleles were obtained by flanking the gene coding sequences with loxP sites (Supplementary Figs. S1 and S2). Targeting vectors were constructed using SvEv129 genomic DNA. The frt-neor-frt-loxP neomycin-resistance cassette47 and MC1tkpA thymidine kinase cassette48 were previously described. Routine genotyping of mice was carried out by PCR. Sox11+ and Sox11fl+ allele-specific segments were amplified using the primers FPA (TTCGTGATTGCAACAAAGGCGGAG) and RPA (GCTCCCTGCAGTTTAAGAAATCGG). A Sox11fl− allele-specific segment was amplified using primers FPB (AGAGAGCGAGAAATCAAGCGAGTG) and RPB (CTGCCGACGTCTTTCAGACTTCAA). For the Sox12+ allele, the primers were FPA (CCTTCTTGCGCATGCTTGATGCTT) and RP (GGAAATCAAGTTTCCGGCGACCAA), and for the Sox12 allele, the primers were FPB (ATGCAAATGCTGAGTTCTCTGCCC) and RP. All PCR reactions were carried out in standard buffer supplemented with 2 mM MgCl2, with 35 cycles of 94 °C for 15 s, 65 °C for 75 s and 72 °C for 90 s, followed by a final extension step at 72 °C for 7 min. PCR for Sox12+ and Sox12 was carried out in standard buffer supplemented with 2.75 mM MgCl2 and 5% dimethylsulphoxide, respectively. All other alleles and transgenes were previously described. Control and mutant mice were analysed as littermates on a 129xB6 hybrid genetic background.

Whole-mount embryo procedures

5-bromo-4-chloro-3-indolyl-β-d-galactoside staining and skeletal preparations were performed as described49. Scanning electron microscopy was carried out following a standard procedure and embryos were analysed on a JOEL JSM 5310 scanning electron microscope using JOEL Orion image acquisition and handling controls. RNA in situ hybridization was carried out using digoxygenin-labelled riboprobes. Embryos were fixed for 2 h in 2% paraformaldehyde in 0.1% Tween-20 in PBS (PBST), digested for 10 min with 10 μg ml−1 proteinase-K in PBST and postfixed for 20 min in 2% paraformaldehyde in PBST. Prehybridization was performed for 6 h at 65 °C before adding 1 μg ml−1 of probe and hybridizing for 18–24 h. After posthybridization washes, embryos were blocked in 20% decomplemented goat serum, 2% BM-blocking reagent (Roche) in 0.1 M maleic acid, pH 7.5, 0.15 M NaCl, 0.1% Tween-20 for 3 h, and then probed with a 1/2,000 dilution of alkaline phosphatase-conjugated antidigoxygenin antibody (Roche) for 18–24 h at 4 °C. For chromogenic detection, embryos were incubated in 250 μg ml−1 nitroblue tetrazolium and 125 mM 5-bromo-4-chloro-3-indolyl phosphate. The reaction was stopped by washing abundantly with 10 mM Tris-HCl pH7.5, 0.15 M NaCl, 0.1% Tween-20.

Procedures on paraffin sections

Whole embryos or specific organs were fixed in 4% paraformaldehyde in PBS for at least 12 h at 4 °C, dehydrated, embedded in paraffin, cut into 7 μm-thick sections and stained either with haematoxylin and eosin Y or with Alcian blue and nuclear fast red. RNA in situ hybridization of paraffin-embedded embryo sections was carried out using [35S]-rUTP-labelled RNA probes as described50.

Procedures on frozen sections

For BrdU analysis of cell proliferation, pregnant dams were injected intraperitoneally with BrdU solution (Invitrogen, # 00-0103) at 0.1 ml g−1 of body weight 45 min before being killed. Embryos were fixed for 20 min in 4% paraformaldehyde in PBS and embedded in OCT medium (Sakura Technologies). Cryosections of 10 μm thickness were obtained. TdT-mediated dUTP nick end labeling assay was performed using the ApopTag kit (Chemicon, S7010). For immunostaining, sections were incubated with 0.5 μg ml−1 anti-BrdU FITC-conjugated antibody (BD Bioscience) or antiphospho-histone-3 Ser10 rabbit polyclonal antibodies (Cell Signaling Technologies) for 18 h at 4 °C. AlexaFluor 488-conjugated anti-rabbit antibody (Invitrogen) was used as secondary antibody for phospho-histone-3 immunodetection. Sections were mounted in DAPI-containing Vectashield medium (Vector Labs).

Image acquisition

Embryos were photographed using a Nikon SMZ1500 microscope equipped with C-W10_20 lenses and a Spot Insight digital camera. Sections were analysed with an Olympus BX50 microscope equipped with Olympus Uplanapo ×10, 0.40-numerical aperture and Olympus Uplanapo 20×, 0.70-numerical aperture infinity-corrected (effective numerical aperture, 0.17) lenses. Images were captured with a Polaroid DMC2 digital camera.

Primary culture and adenovirus infection of limb bud cells

Limb buds from E11.5 embryos were dissociated in 0.25% trypsin-EDTA for 10 min at 37 °C. Cells were passed through a 40 μm nylon cell strainer and cultured in DMEM containing 10% FCS. Sox4 and Sox11 were inactivated by treating limb bud cells with 100 plaque-forming unit per cell Cre recombinase-expressing adenovirus (Iowa University) for 24 or 48 h. Control cells were infected with LacZ-expressing adenovirus (Iowa University).

Transfection and adenovirus infection of osteoblasts

Calvaria from 2-day-old Sox4fl/fl11fl/fl12−/− mice were digested in 0.1 mg ml−1 collagenase P and 0.25% trypsin for 1 h at 37 °C. Cells were passed through a 40 μm nylon cell strainer and cultured for 48 h in MEM containing 10% FCS and then replated at 3×105 cells/10 cm2 dish in the same medium, which keeps osteoblasts at a precursor stage51. After 16 h, mixtures of 500 ng of pLVX-Amcyan1-C1 vector (Clontech); 500 ng of Sox4 expression plasmid or pOZ retroviral vector encoding no protein, wild-type Tead2 or a Tead2/YAP fusion protein39; and 3 μl of FuGENE6 (Roche) were added to the cells. After 12 h, cells were infected with AdeCre or AdelacZ.

Apoptosis assay and cell-cycle analysis in cultured cells

Cultured cells were collected by digestion with trypsin-EDTA, and 5×105 cells were used per assay. For the apoptosis assay, cells were fixed with 1% paraformaldehyde for 2 h, washed with PBS and further fixed for 16 h in 70% ethanol at −20 °C. TdT-mediated dUTP nick end labeling (assay) staining was carried out with an Apo-BrdU kit (BD-Pharmingen). For osteoblasts co-transfected with Amcyan and Tead2 or Sox4 expression plasmids, the percentage of cells undergoing apoptosis was measured according to the ratio of cells positive for Amcyan only and cells positive for both Amcyan and BrdU. For cycle analysis, cells were fixed for 16 h in 70% ethanol at −20 °C and washed with PBS. After incubation with 0.1 mg ml−1 RNase A at 37 °C for 15 min, cells were stained with 25 μg ml−1 propidium iodide. Fluorescence-activated cell sorting was carried out using an LSRII instrument (BD Biosciences), and data were analysed using FlowJo software (Ashland).

RNA assays

Gene expression profiles were obtained from E11.5 limb bud cells cultured for 24 h in the presence of adenovirus. Total RNA was prepared using TRIzol (Invitrogen), followed by RNeasy columns (Qiagen) and treatment with 1 U of DNase I (Invitrogen) per μg RNA. Complementary RNA was generated and hybridized to Illumina MouseRef-8 v2 expression bead chips, according to the manufacturer's instructions. Genes differentially expressed by at least 1.5-fold in three independent experiments were identified using BeadStudio software (version3.0 from Illumina). For quantitative real-time reverse transcription–PCR, cDNA was synthesized using a Superscript III first-strand cDNA synthesis kit (Invitrogen) and amplified with gene-specific primers (Supplementary Table S3) using SYBR green PCR master mix (Applied biosystems) on an ABI PRISM 7900HT qPCR instrument(Applied Biosystems). PCR conditions were one cycle at 95 °C for 10 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. Relative mRNA levels were calculated using the 2−DDCT method52.

RNA probes

Sox4, Sox11 and Sox12 RNA probes were previously described11. The probes for Fgf853, Myf554, Shh55 and for Tead1, Tead3 and Tead456 were as described. The Bmp4 probe was a 1 kb fragment encompassing 5′ UTR and 5′ coding sequences in mouse cDNA (NM_007554). The HoxB9 probe encompassed nucleotides 980–1447 in mouse cDNA (NM_008270). The Otx2 probe encompassed nucleotides 562–1620 in the cDNA (NM_144841). The Pax1 probe encompassed nucleotides 358–675 in mouse cDNA (NM_008780). The Pax7 probe encompassed nucleotides 434–754 in mouse cDNA (NM_011039). The Ptc1 probe was the entire mouse cDNA sequence (NM_008957). The Tead2 probe encompassed nucleotides 1,130–1,816 in mouse cDNA (GenBank NM_011565).

Reporter assays

Mouse Tead2 sequences were amplified from genomic DNA using PCR primers designed with HindIII sites at the 5′ end, and cloned into the promoterless pA3luc plasmid54. Point mutations in Sox-binding sites were introduced by Stratagene Quick change mutagenesis. FLAG-Sox expression plasmids were previously published11. For transient transfection, 3×105 Cos-1 and C3H-10T1/2 cells were plated per 10 cm2 dish. Mixtures of 200 ng pSV2-betaGal plasmid, 200 ng Sox expression plasmid, 600 ng reporter plasmid and 3 μl FuGENE6 (Roche) were added to the cells 6 h after plating. Whole-cell extracts or chromatin was prepared 24 or 36 h later. Luciferase and β-galactosidase activities were assayed using the Dual-light combined reporter gene assay system (Applied Biosystems) and a Wallac victor 1,420 microplate reader (Perkin–Elmer). Reporter activities were normalized for transfection efficiency.

Electrophoretic mobility shift assay

This assay was performed as described11 using double-stranded oligonucleotide probes. Sequences of the oligonucleotides used to generate probes are shown in Supplementary Table S4.

Chromatin immunoprecipitation

Chromatin was prepared from C3H-10T1/2 cells transiently transfected with FLAG-Sox expression plasmids57. Briefly, 3×106 cells were crosslinked with 0.5% formaldehyde for 10 min, followed by addition of glycine at 125 mM. Chromatin was sheared by sonication to fragments averaging 400 bp in buffer containing 1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1 and protease inhibitor cocktail (Sigma). Chromatin containing 20 μg DNA was precleared with 15 μl protein G-coupled Dynal magnetic beads (Invitrogen), followed by immunoprecipitation with 4 μg anti-FLAG M2 antibody (Sigma) coupled to 15 μl protein G-coupled Dynal magnetic beads per experimental condition. Non-immune mouse IgG (Sigma) and monoclonal anti-RNA polymerase II antibody (Upstate) were used as controls. ATAACCACCTTCTCTCCTAGGGACC and TTGCCGGGAGCTTTGTTTGGGAAA primers were used to amplify the Tead2 PE1 region. AGATTAGAGATGTCCGTCTG and CTCCAATTTTGGACTCTTGA primers were used to amplify the Tead2 InS region. Col2a1 enhancer primers were as described58. PCR was carried out with one cycle at 94 °C for 3 min; 35 cycles at 94 °C for 30 s, 57 °C for 1 min and 72 °C for 1 min; and one cycle at 72 °C for 5 min.

Author contributions

P.B., A.P.-M. and E.S. were responsible for the experiments and wrote the paper; K.J.K., A.V. and M.L.D. provided Tead2 mutant mice and retroviral vectors; C.C. contributed technical and scientific help; and E.S., M.W. and V.L. directed the project and wrote the paper.

Additional information

How to cite this article: Bhattaram, P. et al. Organogenesis relies on SoxC transcription factors for the survival of neural and mesenchymal progenitors. Nat. Commun. 1:9 doi: 10.1038/ncomms1008 (2010).

Copyright: © 2010 Bhattaram, P. et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution and reproduction in any medium, provided the original author and source are credited.

Supplementary Material

Supplementary Figures and Tables:

Supplementary Figures S1-S8 and Supplementary Tables S1-S4

Acknowledgments

We thank H. Wang, P. Dy and A. Silvester for expert technical assistance; J. Jensen, T. Sakai, J.A. Drazba, P.W. Faber and C. Shemo for scientific and technical advice; R. Conlon, J. Martin Y. Mishina and H. Sasaki for in situ probes; and D. Driscoll, Y. Mishina, O. Reizes and A. Zhu for advice on the paper. This work was funded by NIH Grant AR54153 to V.L., DFG Grant SO251/3-1 to E.S. and an Arthritis Foundation postdoctoral fellowship to A.P.-M.

References

  • Bernardo M. E., Locatelli F. & Fibbe W. E. Mesenchymal stromal cells. Ann. NY Acad. Sci. 1176, 101–117 (2009). [PubMed]
  • Kuhn N. Z. & Tuan R. S. Regulation of stemness and stem cell niche of mesenchymal stem cells: implications in tumorigenesis and metastasis. J. Cell. Physiol. 222, 268–277 (2010). [PubMed]
  • Rogers C. D., Moody S. A. & Casey E. S. Neural induction and factors that stabilize a neural fate. Birth Defects Res. C Embryo Today 87, 249–262 (2009). [PMC free article] [PubMed]
  • Wegner M. From head to toes: the multiple facets of Sox proteins. Nucleic Acids Res. 27, 1409–1420 (1999). [PMC free article] [PubMed]
  • Lefebvre V., Dumitriu B., Penzo-Méndez A., Han Y. & Pallavi B. Control of cell fate and differentiation by Sry-related high-mobility-group box (Sox) transcription factors. Int. J. Biochem. Cell Biol. 39, 2195–2214 (2007). [PMC free article] [PubMed]
  • Takahashi K. & Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676 (2006). [PubMed]
  • Sekido R. & Lovell-Badge R. Sex determination and SRY: down to a wink and a nudge? Trends Genet. 25, 19–29 (2009). [PubMed]
  • Lefebvre V. & Smits P. Transcriptional control of chondrocyte fate and differentiation. Birth Defects Res. C Embryo Today 75, 200–212 (2005). [PubMed]
  • Francois M., Koopman P. & Beltrame M. SoxF genes: key players in the development of the cardio-vascular system. Int. J. Biochem. Cell. Biol. 42, 445–448 (2010). [PubMed]
  • Penzo-Méndez A. I. Critical roles for SoxC transcription factors in development and cancer. Int. J. Biochem. Cell Biol. 42, 425–428 (2010). [PMC free article] [PubMed]
  • Dy P. et al. . The three SoxC proteins—Sox4, Sox11 and Sox12—exhibit overlapping expression patterns and molecular properties. Nucleic Acids Res. 36, 3101–3117 (2008). [PMC free article] [PubMed]
  • Hoser M. et al. . Sox12 deletion in the mouse reveals nonreciprocal redundancy with the related Sox4 and Sox11 transcription factors. Mol. Cell Biol. 28, 4675–4687 (2008). [PMC free article] [PubMed]
  • Hargrave M. et al. . Expression if the Sox11 gene in mouse embryos suggests roles in neuronal maturation and epithelio-mesenchymal induction. Dev. Dyn. 210, 79–86 (1997). [PubMed]
  • Sock E. et al. . Gene targeting reveals a widespread role for the high-mobility-group transcription factor Sox11 in tissue remodeling. Mol. Cell Biol. 24, 6635–6644 (2004). [PMC free article] [PubMed]
  • Schilham M. W. et al. . Defects in cardiac outflow tract formation and pro-B-lymphocyte expansion in mice lacking Sox-4. Nature 380, 711–714 (1996). [PubMed]
  • Schilham M. W., Moerer P., Cumano A. & Clevers H. C. Sox-4 facilitates thymocyte differentiation. Eur. J. Immunol. 27, 1292–1295 (1997). [PubMed]
  • Wilson M. E. et al. . The HMG box transcription factor Sox4 contributes to the development of the endocrine pancreas. Diabetes 54, 3402–3409 (2005). [PubMed]
  • Nissen-Meyer L. S. et al. . Osteopenia, decreased bone formation and impaired osteoblast development in Sox4 heterozygous mice. J. Cell Sci. 120, 2785–2795 (2007). [PubMed]
  • Bergsland M., Werme M., Malewicz M., Perlmann T. & Muhr J. The establishment of neuronal properties is controlled by Sox4 and Sox11. Genes Dev. 20, 3475–3486 (2006). [PubMed]
  • Lee C. J., Appleby V. J., Orme A. T., Chan W. I. & Scotting P. J. Differential expression of SOX4 and SOX11 in medulloblastoma. J. Neurooncol. 57, 201–214 (2002). [PubMed]
  • Weigle B. et al. . Highly specific overexpression of the transcription factor SOX11 in human malignant gliomas. Oncol. Rep. 13, 139–144 (2005). [PubMed]
  • Hide T. et al. . Sox11 prevents tumorigenesis of glioma-initiating cells by inducing neuronal differentiation. Cancer Res. 69, 7953–7959 (2009). [PubMed]
  • Wang X. et al. . The subcellular Sox11 distribution pattern identifies subsets of mantle cell lymphoma: correlation to overall survival. Br. J. Haematol. 143, 248–252 (2008). [PubMed]
  • Liu P. et al. . Sex-determining region Y box 4 is a transforming oncogene in human prostate cancer cells. Cancer Res. 66, 4011–4019 (2006). [PubMed]
  • Andersen C. L. et al. . Dysregulation of the transcription factors SOX4, CBFB and SMARCC1 correlates with outcome of colorectal cancer. Br. J. Cancer 100, 511–523 (2009). [PMC free article] [PubMed]
  • Pramoonjago P., Baras A. S. & Moskaluk C. A. Knockdown of Sox4 expression by RNAi induces apoptosis in ACC3 cells. Oncogene 25, 5626–5639 (2006). [PubMed]
  • de Bont J. M. et al. . Differential expression and prognostic significance of SOX genes in pediatric medulloblastoma and ependymoma identified by microarray analysis. Neuro. Oncol. 10, 648–660 (2008). [PMC free article] [PubMed]
  • Pan X. et al. . Induction of SOX4 by DNA damage is critical for p53 stabilization and function. Proc. Natl. Acad. Sci USA 106, 3788–3793 (2009). [PubMed]
  • Penzo-Méndez A., Dy P., Pallavi B. & Lefebvre V. Generation of mice harboring a Sox4 conditional null allele. Genesis 45, 776–780 (2007). [PubMed]
  • O'Gorman S., Dagenais N. A., Qian M. & Marchuk Y Protamine-Cre recombinase transgenes efficiently recombine target sequences in the male germ line of mice, but not in embryonic stem cells. Proc. Natl. Acad. Sci. USA 94, 14602–14607 (1997). [PubMed]
  • De Vries W. N. et al. . Expression of Cre recombinase in mouse oocytes: a means to study maternal effect genes. Genesis 26, 110–112 (2000). [PubMed]
  • Ahn K., Mishina Y., Hanks M. C., Behringer R. R. & Crenshaw E. B. III. BMPR-IA signaling is required for the formation of the apical ectodermal ridge and dorsal-ventral patterning of the limb. Development 128, 4449–4461 (2001). [PubMed]
  • Danielian P. S., Muccino D., Rowitch D. H., Michael S. K. & McMahon A. P. Modification of gene activity in mouse embryos in utero by a tamoxifen-inducible form of Cre recombinase. Curr. Biol. 8, 1323–1326 (1998). [PubMed]
  • Mao X., Fujiwara Y. & Orkin S. H. Improved reporter strain for monitoring Cre recombinase-mediated DNA excisions in mice. Proc. Natl. Acad. Sci. USA 96, 5037–5042 (1999). [PubMed]
  • Logan M. et al. . Expression of Cre Recombinase in the developing mouse limb bud driven by a Prxl enhancer. Genesis 33, 77–80 (2002). [PubMed]
  • Zhao B., Lei Q. -Y. & Guan K. -L. The Hippo-YAP pathway: new connections between regulation of organ size and cancer. Curr. Opin. Cell Biol. 20, 638–646 (2008). [PubMed]
  • Kaneko K. J., Kohn M. J., Liu C. & DePamphilis M. L. Transcription factor TEAD2 is involved in neural tube closure. Genesis 45, 577–587 (2007). [PMC free article] [PubMed]
  • Sawada A. et al. . Redundant roles of Tead1 and Tead2 in notochord development and the regulation of cell proliferation and survival. Mol. Cell. Biol. 28, 3177–3189 (2008). [PMC free article] [PubMed]
  • Vassilev A., Kaneko K. J., Shu H., Zhao Y. & DePamphilis M.L. TEAD/TEF transcription factors utilize the activation domain of YAP65, a Src/Yes-associated protein localized in the cytoplasm. Genes Dev. 15, 1229–1241 (2001). [PubMed]
  • Avilion A. A. et al. . Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev. 17, 126–140 (2003). [PubMed]
  • Masui S. et al. . Pluripotency governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem cells. Nat. Cell Biol. 9, 625–635 (2007). [PubMed]
  • Ikushima H. et al. . Autocrine TGF-beta signaling maintains tumorigenicity of glioma-initiating cells through Sry-related HMG-box factors. Cell Stem Cell 5, 504–514 (2009). [PubMed]
  • Hoser M. et al. . Prolonged glial expression of Sox4 in the CNS leads to architectural cerebellar defects and ataxia. J. Neurosci. 27, 5495–5505 (2007). [PubMed]
  • Potzner M. R. et al. . Prolonged Sox4 expression in oligodendrocytes interferes with normal myelination in the central nervous system. Mol. Cell. Biol. 27, 5316–5326 (2007). [PMC free article] [PubMed]
  • Kondoh H. & Kamachi Y. SOX-partner code for cell specification: Regulatory target selection and underlying molecular mechanisms. Int. J. Biochem. Cell. Biol. 42, 391–399 (2010). [PubMed]
  • Liao Y. -L. et al. . Identification of SOX4 target genes using phylogenetic footprinting-based prediction from expression microarrays suggests that overexpression of SOX4 potentiates metastasis in hepatocellular carcinoma. Oncogene 27, 5578–5589 (2008). [PubMed]
  • Cheah S. S. & Behringer R. R. Contemporary gene targeting strategies for the novice. Mol. Biotechnol. 19, 297–304 (2001). [PubMed]
  • Meyers E. N., Lewandoski M. & Martin G. R. An Fgf8 mutant allelic series generated by Cre- and Flp-mediated recombination. Nat. Genet. 18, 136–141 (1998). [PubMed]
  • Hogan B., Beddington R., Costantini F. & Lacy E. Manipulating the Mouse Embryo: A Laboratory Manual 2nd edn. 373–375 (Cold Spring Harbor Laboratory Press, 1994).
  • Albrecht U., Eichele G., Helms J. A. & Lu H. C. Visualization of Gene Expression Patterns by In Situ Hybridization. In Molecular and Cellular Methods in Developmental Toxicology (ed. Daston, G.P.) 23–48 (CRC Press, Boca Raton, FL, 1997).
  • Ducy P. et al. . A Cbfa1-dependent genetic pathway controls bone formation beyond embryonic development. Genes Dev. 13, 1025–1036. [PubMed]
  • Livak K. J. & Schmittgen T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)). Methods 25, 402–408 (2001). [PubMed]
  • Kuschert S., Rowitch D. H., Haenig B., McMahon A. P. & Kispert A. Characterization of Pax-2 regulatory sequences that direct transgene expression in the Wolffian duct and its derivatives. Dev. Biol. 229, 128–140 (2001). [PubMed]
  • Ott M. O., Bober E., Lyons G., Arnold H. & Buckingham M. Early expression of the myogenic regulatory gene, myf-5, in precursor cells of skeletal muscle in the mouse embryo. Development 111, 1097–1107 (1991). [PubMed]
  • Echelard Y. et al. . Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell 75, 1417–1430 (1993). [PubMed]
  • Sawada A. et al. . Tead proteins activate the Foxa2 enhancer in the node in cooperation with a second factor. Development 132, 4719–4729 (2005). [PubMed]
  • Caballero R. et al. . Combinatorial effects of splice variants modulate function of Aiolos. J. Cell Sci. 120, 2619–2630 (2007). [PubMed]
  • Han Y. & Lefebvre V. L-Sox5 and Sox6 drive expression of the aggrecan gene in cartilage by securing binding of Sox9 to a far-upstream enhancer. Mol. Cell Biol. 28, 4999–5013 (2008). [PMC free article] [PubMed]

Articles from NPG Open Access are provided here courtesy of Nature Publishing Group