PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Cell Physiol. Author manuscript; available in PMC 2010 June 17.
Published in final edited form as:
PMCID: PMC2887298
NIHMSID: NIHMS208369

Alpha-1 Adrenergic Receptor Transactivates Signal Transducer and Activator of Transcription-3 (Stat3) through Activation of Src and Epidermal Growth Factor Receptor (EGFR) in Hepatocytes

Abstract

Hepatocytes express adrenergic receptors (ARs) that modulate several functions, including liver regeneration, hepatocyte proliferation, glycogenolysis, gluconeogenesis, synthesis of urea and fatty acid metabolism. Adrenergic hepatic function in adults is mainly under the control of α1-ARs; however, the mechanism through which they influence diverse processes remains incompletely understood. This study describes a novel α1-AR-mediated transactivation of signal transducer and activator of transcription-3 (Stat3) in primary and transformed hepatocytes. Treatment of primary rat hepatocytes with the α1-AR agonist, phenylephrine (PE), induced a rapid phosphorylation of Stat3. PE also increased Stat3 phosphorylation, DNA binding and transcription activity in transformed human hepatocellular carcinoma cells (Hep3B). The PE-induced Stat3 phosphorylation, DNA binding and reporter activity were completely blocked by the selective α1-AR antagonist, prazosin. In addition, transfection of Hep3B cells with human α1B-AR expression vector also enhanced Stat3 phosphorylation and reporter activity. Moreover, overexpression of RGS2, a protein inhibitor of Gq/11 signaling, blocked PE-induced Stat3 phosphorylation and reporter activity. The observations that PE induced the formation of c-Src-Stat3 binding complex and phosphorylation of epidermal growth factor receptor (EGFR) and that inhibiting Src and EGFR prevented PE-induced Stat3 activation indicate the involvement of Src and EGFR. Taken together, these observations demonstrate a novel α1-AR-mediated Stat3 activation that involves Gq/11, Src and EGFR in hepatic cells.

Keywords: alpha1-adrenergic receptor, signal transducer and activator of transcription-3, hepatocyte, epidermal growth factor receptor, phenylephrine

INTRODUCTION

The liver constitutes a unique, multicellular organ whose functions are crucial for the overall physiology of humans. The natural catecholamines bind to adrenergic receptors (AR) in hepatic cells and regulate a wide variety of such functions including modulation of carbohydrate, lipid, and amino acid metabolism. Adult hepatocytes express both α1 and β2-ARs, with distinct functions and signaling pathways(Exton, 1980). It addition to its role in metabolism, hepatic α1-AR is also involved in regulation of hepatocyte proliferation and liver regeneration after hepatic injury or partial hepatectomy(Cruise et al., 1985; Cruise et al., 1987; Michalopoulos and DeFrances, 2005; Michalopoulos and DeFrances, 1997). For example, norepinephrine is one of the several substances that increase in the plasma following partial hepatectomy(Cruise et al., 1987; Michalopoulos and DeFrances, 2005; Michalopoulos and DeFrances, 1997). α1-AR agonists including phenylephrine have been shown to enhance hepatocyte proliferation in the presence of epidermal growth factor (EGF) or hepatocyte growth factor (HGF)(Cruise et al., 1985; Cruise et al., 1987; Cruise and Michalopoulos, 1985; Knopp et al., 1997; Lindroos et al., 1991; Michalopoulos and DeFrances, 1997; Spector et al., 1997). Norepinephrine also increases synthesis of HGF in fibroblasts(Broten et al., 1999) and catecholamines also increase synthesis of EGF from Brunner’s glands of the duodenum(Olsen et al., 1985). In view of all these direct and indirect effects enhancing hepatocyte proliferation after partial hepatectomy, it is not surprising that blockade of the α1-AR abolishes DNA synthesis for the first 24 hours after partial hepatectomy(Cruise et al., 1987). Recent work also suggests that norepinephrine may be a trophic factor for hepatic stellate cells and that it may also be produced by the stellate cells, acting in an autocrine manner (Oben et al., 2004; Sancho-Bru et al., 2006). All of these findings underscore the importance of norepinephrine as a regulator of liver regeneration and the complexity of pathways involved in these regulatory processes need to be better understood.

α1-ARs belong to the seven transmembrane domain G protein-coupled receptor superfamily and include three subtypes (α1A, α1B, and α1D), all of which couple to Gq/11 and regulate phospholipase C(Bylund et al., 1994; Hieble et al., 1995; Minneman and Esbenshade, 1994). Activation of α1-AR by catecholamine leads to activation of phosphoinositide-specific phospholipase C and generation of inositol-1,4,5-trisphosphate and diacylglycerol, which mediate the activation of protein kinase C and intracellualr Ca2+ release, respectively. This classical mechanism is thought to mediate α1-AR effect in different cells including hepatocytes. Additionally, α1-AR has also been linked to other intracellular cascades in several extrahepatic cell types, including activation of phospholipase A2(Xing and Insel, 1996), phospholipase D(Ruan et al., 1998) and MAP kinases(Williams et al., 1998), production of reactive oxygen species and activation of NADPH oxidase(Xiao et al., 2002). These responses appear to be tissue- and cell type-specific and it remains obscure whether alternative signaling mechanisms are involved in hepatic α1-AR actions.

In the liver, Stat3 (signal transducer and activator of transcription-3) has been shown to play a key role in acute phase response, protection against liver injury, promotion of liver regeneration, glucose homeostasis, and hepatic lipid metabolism(Gao, 2005). Stat3 in the liver is mainly activated by IL-6 and its related cytokines, IL-22, IL-10, EGF, HGF, and hepatitis B and C viral proteins(Gao, 2005; Gong et al., 2001; Schaper et al., 1997; Waris et al., 2001). Disruption of the Stat3 gene impairs liver regeneration(Li et al., 2002) and causes insulin resistance associated with increased hepatic expression of gluconeogenic genes(Inoue et al., 2004). Overexpression of constitutively activated Stat3 reduces blood glucose, plasma insulin concentrations and hepatic glucogeogenic gene expression in diabetic mice(Inoue et al., 2004) and protects against Fas-induced fulminant hepatitis via redox-dependent and-independent mechanisms(Haga et al., 2003). Mice with disruption of IL-6 show impaired liver regeneration(Cressman et al., 1996; Sakamoto et al., 1999) and are susceptible to liver injury induced by carbon tertrachloride(Kovalovich et al., 2000), Fas(Kovalovich et al., 2001) and ethanol(Hong et al., 2002). These finding suggest that IL-6/Stat3 signaling plays an important role in liver regeneration and protection against liver injury. In addition, treatment with IL-6 or overexpression of constitutively activated Stat3 in vivo ameliorates fatty liver disease(Hong et al., 2004; Inoue et al., 2004), indicating that IL-6/Stat3 signaling is also involved in fatty acid metabolism. Furthermore, activation of Stat3 and subsequent induction of anti-apoptotic and proliferation associated genes appear to contribute to the hepatoprotective and mitogenic effect of IL-22 in the liver(Radaeva et al., 2004).

Thus, evidence is compelling that both α1-AR and Stat3 importantly regulate various physiological functions in the liver. In this report, we describe a novel link between the α1-AR and Stat3 signaling pathways in primary and transformed hepatocytes. Our findings show that activation of α1-AR by its selective agonist, phenylephrine, induced Stat3 phosphorylation, DNA binding and transcription activity, which were completely blocked by the selective α1-AR antagonist, prazosin. Accordingly, transfection of human α1B-AR expression vector also enhanced Stat3 phosphorylation and reporter activity. Furthermore, our data provide evidence for the involvement of Gq/11, c-Src and EGFR in α1-AR-mediated Stat3 activation in hepatic cells.

MATERIALS AND METHODS

Materials

Minimum essential medium (MEM), fetal bovine serum, glutamine, antibiotics and the Lipofectamine plus reagent and Lipofectamine 2000 reagent were purchased from Invitrogen (Carlsbad, CA). Phenylephrine hydrochloride (α1-adrenergic agonist), isoproterenol hydrochloride (β-adrenergic agonist), prazosin hydrochloride (α1-adrenergic antagonist) and pertussis toxin were purchased from Sigma (St Louis, MO). Recombinant murine IL-6 and human IL-6 were from Inclone System (Somerville, NJ). The Src-family tyrosine kinase inhibitor 4-Amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine (PP2) and the EGFR tyrosine kinase inhibitor AG 1478 were purchased from Calbiochem (San Diego, CA). The antibodies against Stat3, EGFR, c-Src, PARP were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The antibodies against phospho-Stat3 (Tyr705) or (Ser727), phospho-EGFR (Tyr845), (Tyr992) or (Tyr1068) were purchased from Cell Signaling (Beverly, MA). Adrenergic receptor α1B expression plasmid, adrenergic receptor β2 expression plasmid and RGS2 expression plasmid were purchased from UMR cDNA Resource Center (Rolla, MO). Translucent STAT3(1)-Luc reporter vector which is designed to measure transcriptional activity of Stat3 and pCRE-Luc reporter vector which is designed to measure transcriptional activity of cAMP response element (CRE) were purchased from Panomics (Redwood City, CA). Horseradish peroxidase-linked streptavidin and chemiluminescence detection reagents were purchased from Amersham Pharmacia Biotech Inc (Piscataway, NJ).

Preparation of rat primary hepatocytes

Rat hepatocytes were isolated from male Fisher 344 rats (Harlan, Indianapolis, IN) using the modified two-step collagenase perfusion technique as previously described (Runge et al., 2000; Seglen, 1976). Freshly isolated hepatocytes of >90% viability, as assessed by trypan blue exclusion, were placed on rat-tail collagen I-coated culture dishes or plates in Williams’ E medium supplemented with 5% calf serum. The cells were incubated at 37°C (5% CO2) and checked for adherence of monolayers after 2 to 4 hours. Once adhered, the cells were subjected to treatment with phenylephrine, prazosin, PP2, or AG1478 as indicated in the text.

Hepatocyte DNA Synthesis

To determine in vitro DNA synthesis, 1 μCi [3H]thymidine (PerkinElmer, Boston) was added to the cultured hepatocytes in each well of 6-well plates. The cells were treated with specific reagents as indicated in the text. After overnight incubation, the hepatocytes were harvested and [3H]thymidine incorporation wasmeasured using a scintillation counter(Wang et al., 1998).

Culture of Hep3B cells and transfection assays

The human hepatoma cell line, Hep 3B, was cultured according to our previously described methods (Han et al., 2006b; Leng et al., 2003). The cells were cultured in EMEM supplemented with 10% fetal bovine serum, 2 mM L-glutamine. The culture plates were maintained at 37°C in a humidified CO2 incubator. For transient transfection assays, the cultured cells were transfected with the α1B-AR expression plasmid, β2-AR expression plasmid, RGS2 expression plasmid, or pcDNA control plasmid using Lipofectamine plus reagent.

Luciferase reporter assay

The cells were seeded at a concentration achieving 80% confluence in 12-well plates eighteen hours before transfection. The cells were transiently co-transfected with 0.2 μg/per well translucent Stat3(1)-Luc reporter vector or pCRE-Luc reporter vector with or without 0.1 μg of a plasmid containing a cytomegalovirus promoter-driven β-galactosidase gene (pIEP-Lacz). After transfection, the cells were treated with specific reagents as indicated. The cell lysates were then obtained with 1X reporter lysis buffer (Promega). The luciferase activity was assayed in a Berthold AutoLumat LB 953 luminometer (Nashua, NH) by using the luciferase assay system from Promega. β-Galactosidase activity was determined as recommended (Promega), using a 96-well multiplate reader with SOFTMAX software (Molecular Devices). The relative luciferase activity was calculated after normalized to either β-galactosidase activity or cellular proteins. All values are expressed as –fold induction relative to basal activity.

Preparation of cellular protein

At the end of each indicated treatment, the cells were scraped off the plates and centrifuged, washed twice with cold phosphate-buffered saline (PBS) containing 0.5 mM PMSF and 10μg/ml leupeptin and resuspended in 5-fold volume of hypotonic buffer consisting of 50 mM HEPES pH 7.55, 1 mM EDTA, 1 mM DTT, protease inhibitor cocktail tablets (Roche Diagnostics GmbH) and phosphatase inhibitor. After sonication, the whole cell lysate was collected by centrifugation at the speed of 16,000 × g at 4°C for 10 minutes to remove cell debris and stored in aliquots at −20°C until use. The protein concentrations in the cell extracts were determined by the Bio-Rad protein assay (Bio-Rad, CA) using BSA as a standard.

Preparation of nuclear protein

The nuclear proteins from control or stimulated cells were extracted with the Nuclear Extraction Kit from Chemicon International (Temecula, CA) according to the manufacturer’s instructions. Briefly, the cultured cells were washed and scraped into phosphate-buffered solution and centrifuged at 4,500 rpm for 5 min. The pelleted cells were suspended in cytoplasmic lysis buffer at approximately 5 times the packed cell volume and lysed by gentle pipetting. Nuclei were recovered by centrifugation at 8000 × g for 20 minutes. The nuclear proteins were extracted by gentle resuspension of the nuclei at approximately 2 times the packed nuclear volume of Nuclear Extraction Buffer, followed by 30 minutes of platform rotation. The nuclear protein suspension was cleared by centrifugation at 16,000 × g for 5 minutes. The supernatants were collected and frozen at −80°C. All buffers contained DTT, protease inhibitor cocktail and phosphatase inhibitor. All the steps were carried out on ice or at 4°C. The protein concentrations in the nuclear extracts were measured by the Bio-Rad protein assay (Bio-Rad, CA) using BSA as a standard.

Immunoblotting

30 μg of either cellular or nuclear proteins were subjected to SDS-PAGE on 4–20% Tris-glycine gels (Invitrogen, CA) for Stat3, phosph-Stat3 and β-actin; or on 6% Tris-glycine gels (Invitrogen, CA) for EGFR, phosph-EGFR, and PARP. The separated proteins were electrophoretically transferred onto the nitrocellulose membranes (BioRad, CA). Nonspecific binding was blocked with PBS-T (0.5% Tween 20 in PBS) containing 5% non-fat milk for 1 hr at room temperature. The membranes were then incubated overnight at 4°C with individual primary antibodies in PBS-T containing 1% non-fat milk at the dilutions specified by the manufacturers. Antibodies against phospho-EGFR (Tyr845), (Tyr992) and (Tyr1068) were utilized for EGFR phosphorylation. Antibodies against phospho-Stat3 (Tyr705) and (Ser727) were utilized for Stat3 phosphorylation. Following three washes with PBS-T, the membranes were then incubated with the horseradish peroxidase-conjugated secondary antibodies at 1:10,000 dilution in PBS-T containing 1% non-fat milk for 1 hour at room temperature. The membranes were then washed 3 times with PBS-T and the protein bands were visualized with the ECL Western blotting detection system according to the manufacturer’s instructions.

Biotinylated oligonucleotide precipitation assays

These experiments were performed as previously described (Han et al., 2006a; Hata et al., 2000). The sequences of biotinylated oligonucleotides corresponding to Stat3 binding site are forward: 5′-TGCTTCCCGAATTCCCGAATTCCCGAATTCCCGAATTCCCGAATTCCCGAACG T-3′; and reverse: 5′-ACGTTCGGGAAT TCGGGAATTCGGGAATTCGGGAATTCGGGAATTCGGGAAGCA-3′. The 5′-biotinylated oligonucleotides were synthesized by Sigma-Genosys (Woodland, Texas). Cellular extracts were prepared as described above. Binding reactions in nuclear extracts were carried out at 4°C for 16 hours with 1 μg biotinylated double-strand oligonucleotides and 10 μg poly(dl-dC).poly(dl-dC). The DNA-bound proteins were precipitated using ImmunoPure streptavidin-agarose beads (Pierce, Rockford, IL) at 4°C for 1 hour and subjected to detect Stat3 by western blotting.

Binding of Src to Stat3

The binding complexes of Src and Stat3 were determined by immunoprecipitation and western blot. Serum starved cells were treated with phenylephrine in the presence or absence of prazosin as indicated in the text. Cellular extracts were prepared for immunoprecipitation with antibody against c-Src. The immunoprecipitants were then subjected to SDS-PAGE and Western blotting to detect Stat3.

RESULTS

Activation of α1-AR by phenylephrine induces Stat3 phosphorylation, DNA binding and transcription in hepatocytes

We first determined the effect of the α1-AR ligand, phenylephrine (PE), on Stat3 phosphorylation in rat primary hepatocytes. The isolated cells were utilized for experiments within 6 hours to prevent the possibility of AR down-regulation during prolonged culture. As shown in Figure 1A and B, activation of α1-AR by PE induced the phosphorylation of Stat3 in primary hepatocytes, which was observed 15 minutes after treatment. A similar effect was also observed in transformed hepatocytes (Hep3B) (Figure 1C and D). The phenylephrine-induced Stat3 phosphorylation was inhibited by co-treatment with prazosin, a selective α1-AR antagonist in both primary and transformed hepatocytes (Figure 1E and F). The level of Stat3 phosphorylation in PE-treated cells was approximately 40–50% of that in IL-6 treated cells (Figure 2A and B).

Figure 1Figure 1
Phenylephrine, a selective α1-AR agonist, induces the phosphorylation of Stat3 in hepatocytes. This effect is blocked by prazosin, a selective α1-AR antagonist
Figure 2
The effect of phenylephrine versus IL-6 on Stat3 phosphorylation

Transient transfection and reporter activity assay was next performed to determine the effect of α1-AR ligand activation on Stat3 transcription activity. As shown in Figure 3A, PE induced the binding of Stat3 to its DNA response element in Hep3B cells, as determined by the biotinylated chromatin immunoprecipitation assay. Accordingly, PE treatment also increased the Stat3-mediated luciferase reporter activity in these cells (Figure 3B). Both the Stat3 DNA binding and reporter activity induced by PE treatment were blocked by the α1-AR antagonist, prazosin. These findings suggest that Stat3 is a downstream signaling molecule of α1-AR.

Figure 3
Phenylephrine increases Stat3 DNA binding and transcription activity; the effect is blocked by prazosin

Overexpression of α1B-AR, but not β2-AR, increases Stat3 phosphorylation and transcription

We next performed transfection experiments to determine the direct effect of α1-AR overexpression on Stat3 activation in transformed hepatocytes. As shown in Figure 4, Hep3B cells transfected with α1B-AR showed increased Stat3 phosphorylation as well as increased Stat3 transcription activity. Phenylephrine treatment of α1B-AR overexpressing cells only marginally increased Stat3 reporter activity when compared with vehicle treatment of α1B-AR overexpressing cells, which is likely due to autoactivation of the transfected receptor. The specificity of α1B-AR transfection is further verified by the observation that transfection with β2-AR enhanced the CRE (cAMP response element) reporter activity but not Stat3 reporter activity (Figure 4). These findings provide further molecular evidence for the activation of Stat3 by α1-AR.

Figure 4
Overexpression of α1B-adrenergic receptor, but not β2-adrenergic receptor, increases Stat3 phosphorylation

Inhibition of Gq/11 signaling by RGS2 prevents phenylephrine-induced Stat3 phosphorylation and transcription

Since α1-AR is coupled to Gq/11, further experiments were performed to determine whether overexpression of RGS2, which inhibits Gq/11 signaling, would alter α1-AR-mediated Stat3 activation. RGS2 is a member of the protein family termed Regulators of G-protein Signaling (RGS), which regulate G protein coupled receptors through binding Gα-GTP to increase the rate of GTP hydrolysis and rapidly terminate responses; RGS2 selectively inhibits Gαq/11 and thus blocks the function of Gαq/11-coupled receptors including α1-AR. As shown in Figure 5A and B, RGS2 overexpression in Hep3B cells inhibited PE-induced Stat3 phosphorylation and transcription activity. In parallel control experiments, RGS2 overexpression did not affect isoproterenol-induced CRE reporter activity, a process mediated by Gs activation (Figure 5C). Furthermore, pretreatment with pertussis toxin, which inhibits Gi, also had no effect on PE-induced Stat3 transcription activity (Figure 5D). These results suggest the involvement of pertussis toxin-insensitive Gq/11in α1-AR-mediated Stat3 activation.

Figure 5
RGS2 overexpression blocks PE-induced Stat3 phosphorylation and transcription activity

Activation of α1-AR by phenylephrine enhances Src binding to Stat3

Further experiments were carried out to identify the possible down-stream molecules that mediate Stat3 activation in our system. Since Src can bind and activate Stat3 in other cells, we performed immunoprecipitation and western blot analysis to determine whether α1-AR might influence Src-association with Stat3. As shown in Figure 6, low level of Src-Stat3 binding complex is detected under basal conditions; activation of α1-AR by PE enhanced Src binding to Stat3 (the protein levels of Stat3 and Src were not altered). The PE-induced Src-Stat3 binding was completely blocked by cotreatment with prazosin. These results suggest that Src is a down-stream target of α1-AR that may regulate Stat3 activity in hepatocytes. The importance of Src in α1-AR-induced Stat3 activation is further supported by the observation that PE-induced Stat3 phosphorylation, DNA binding and transcription activity were blocked by the Src inhibitor, PP2 (Figure 8).

Figure 6
PE increases the binding of c-Src to Stat3 and the effect is blocked by prazosin
Figure 8Figure 8
The phenylephrine-induced Stat3 phosphorylation, DNA binding and transcription activity are inhibited by the Src inhibitor, PP2, and the EGFR kinase inhibitor, AG1478

Activation of α1-AR by phenylephrine induces the phosphorylation of EGFR

Since EGFR is a key receptor tyrosine kinase that is involved in Stat3 activation, we next examined whether EGFR might be involved in α1-AR-induced Stat3 activation in hepatocytes. As shown in Figure 7, treatment of primary and transformed hepatocytes with phenylephrine induced a rapid phosphorylation of EGFR (within 15 minutes). The PE-induced Stat3 phosphorylation was blocked by the EGFR kinase inhibitor, AG1478, in both primary hepatocytes and Hep3B cells (Figure 8A and B). Similarly, the PE-induced Stat3 DNA binding and transcription activity were also blocked by the AG1478 (Figure 8C and D). These findings suggest the involvement of EGFR in α1-AR-induced Stat3 activation.

Figure 7Figure 7
PE induced the phosphorylation of EGFR in hepatocytes

Hepatocyte DNA synthesis is inhibited by prazosin, PP2 and AG1478

To further determine the role of α1-AR-mediated signaling in hepatocyte proliferation, the effect of prazosin, PP2 and AG1478 on [3H]thymidine incorporation was examined in rat primary hepatocytes. As shown in Figure 9, rat hepatocytes treated with PE alone showed only slight increase of [3H]thymidine incorporation (by approximately 20%); this phenomenon has been previously documented (maximal mitogenic effect is achieved when the hepatocytes are treated with α1-AR agonists plus EGF or HGF) (Cruise et al., 1985; Cruise et al., 1987; Cruise and Michalopoulos, 1985; Knopp et al., 1997; Lindroos et al., 1991; Michalopoulos and DeFrances, 1997; Spector et al., 1997). It is of note that rat hepatocytes treated with prazosin, PP2 or AG1478 showed significantly decreased DNA synthesis when compared with cells treated with vehicle or PE. These findings, along with the previous reports, further indicate the role of α1-AR, Src and EGFR in hepatocyte proliferation.

Figure 9
Rat hepatocyte DNA synthesis was inhibited by prazosin, PP2 and AG1478

DISCUSSION

The central and peripheral actions of catecholamines are mediated by several AR subtypes, which control a variety of functions. Based on their pharmacology, structure and signaling mechanisms, the ARs are classified as α1, α2, and β, and each class is further subdivided into three subtypes. These receptors belong to the family of seven transmembrane domain receptors, coupled to G proteins(Bylund et al., 1992; Bylund et al., 1994; Minneman, 1988). Classically, one signaling pathway has been associated with each AR type as follows. α1-ARs are coupled to Gq/11protein, phospholipase C activation and increase of intracellular calcium. α2-ARs are coupled to Gi protein, causing inhibition of adenylyl cyclase and decreased cAMP production. β-ARs are coupled to Gs protein, thus increasing adenylyl cyclase activity and cAMP levels. On the other hand, studies have also shown that each AR type may activate signaling pathways other than classical ones in various cells and tissues.

α1-AR plays an important role in the sympatho-adrenal response to stress, such as peripheral vasoconstriction, increased cardiac contractility and hepatic glycogenolysis. Besides such short term effects, α1-AR also modulates the growth of a number of cells, including hepatocytes(Cruise et al., 1985; Cruise et al., 1987; Cruise and Michalopoulos, 1985; Spector et al., 1997), cardiomyocytes(Boluyt et al., 1997; Sah et al., 1996), vascular smooth muscle cells(Chen et al., 1995; Hu et al., 1996), and fibroblasts(Allen et al., 1991). In addition, activation of α1-AR has also been implicated in uncontrolled cell growth and malignant transformation, as exemplified by focus formation and disordered growth of Rat-1 fibroblasts transfected with the α1B-AR and enhanced tumor formation when the transfected cells were inoculated into nude mice(Allen et al., 1991). However, the mechanisms by which α1-ARs regulate diverse cellular functions remain to be further defined. Our findings in this study establish Stat3 as a novel α1-AR downstream target in hepatic cells. This conclusion is based on the following observations: (1) the α1-AR agonist phenylephrine induced Stat3 phosphorylation in primary and transformed hepatocytes; (2) phenylephrine treatment increased Stat3 binding to its DNA response element; (3) phenylephrine treatment increased Stat3 transcription activity; (4) transfection with human α1B-AR expression vector enhanced Stat3 phosphorylation and reporter activity; and (5) the phenylephrine-induced Stat3 phosphorylation, DNA binding and reporter activity were blocked by the selective α1-AR antagonist, prazosin. In this context, it is worth mentioning that two other GPCRs, prostaglandin E2and angiotensin II receptors, have also been implicated in Stat3 phosphorylation in cells of bile duct origin(Han et al., 2006a) and vascular smooth muscle cells(Liang et al., 1999).

Although different α1-AR subtypes are expressed in the liver of different species(Deighan et al., 2004; Garcia-Sainz et al., 1995), they apparently serve the same functions. In this study we observed that overexpression of RGS2, which inhibits Gq/11 signaling, blocked α1-AR-induced Stat3 phosphorylation and reporter activity. These findings suggest the involvement of Gq/11 in α1-AR -induced Stat3 activation and are consistent with the documented coupling of all α1-AR subtypes to Gq/11. The specific effect of RGS2 in our system is further supported by the observations that RGS2 overexpression did not affect isoproterenol-induced CRE reporter activity (which is mediated by Gs activation) and that pertussis toxin (which inhibits Gi) had no effect on α1-AR-induced Stat3 activation.

We observed that the Hep3B cells transfected with α1B-AR showed increased Stat3 activation in the absence of PE. The exact mechanism underlying this phenomenon is not clear and remains speculative at this time. In general, the function of transfected receptors including α1-AR depends on a number of factors, such as the cellular environment, association with other proteins (including G proteins), receptor level and localization, the internalization, recycling or degradation of the receptor, and the presence or absence of agonists/antagonists, among others(Hein and Michel, 2007; Perez, 2007). Thus, it is conceivable that some of the above factors might influence the activation of transfected receptors. Given that certain cellular proteins are known to bind α1B-AR but not other Ars(Hein and Michel, 2007; Hirasawa et al., 2001; Perez, 2007), it is possible that they might affect the activity of transfected α1B-AR but not β-2 AR. In addition, since oligomerization of α1B-AR is known to affect its function(Lopez-Gimenez et al., 2007), cellular conditions affecting this process might also influence its activation.

c-Src is a member of a family of cytoplasmic tyrosine kinases that have several domains including a catalytic domain, a regulatory domain, and SH2 and SH3 binding domains(Thomas and Brugge, 1997). Activated c-Src is capable of interacting with and activating several substrates including Stat3(Bromberg et al., 1999; Turkson et al., 1999; Yu et al., 1995). Our data in this study document the involvement of Src in α1-AR induced Stat3 activation in hepatic cells. This assertion is supported by the following observations: (1) activation of α1-AR induces the formation of Src-Stat3 binding complex; (2) inhibition of α1-AR prevents Src binding to Stat3; (3) Src inhibition blocks α1-AR-induced Stat3 phosphorylation; (4) Src inhibition prevents α1-AR -induced binding of Stat3 to its DNA response element; and (5) Src inhibition attenuates α1-AR-induced Stat3 reporter activity. These findings are consistent with the previous studies showing that α1-AR activates Src in other cells (Rybin et al., 2007; Yamauchi et al., 2002) and that G proteins are able to directly bind Src, leading to its activation(Ma et al., 2000). However, detailed mechanisms by which α1-AR or other G proteins activate Src remain to be further investigated.

Stat3 is normally activated in a regulated fashion when protein ligands bind their specific cell-surface receptors and activate tyrosine kinases(Calo et al., 2003; Levy and Darnell, 2002). It becomes activated by phosphorylation on a single tyrosine residue, dimerizes through reciprocal SH2-phosphotyrosine interaction and accumulates in the nucleus, where it binds DNA and direct transcription of target genes. Growth factor receptors with intrinsic tyrosine kinase activity, such as epidermal growth factor receptor (EGFR) and cMet (the receptor for hepatocyte growth factor) also have been shown to cause Stat3 activation in some cells (Boccaccio et al., 1998; Lo et al., 2005; Schaper et al., 1997). Our results in this study suggest that EGFR is involved in α1-AR-induced Stat3 activation in hepatic cells, which is based on the following observations: (1) activation of α1-AR induces a rapid phosphorylation of EGFR in primary and transformed hepatocytes, which coincides with Stat3 phosphorylation; (2) inhibition of EGFR prevents α1-AR-induced Stat3 phosphorylation; (3) inhibition of EGFR blocks α1-AR-mediated Stat3 DNA binding; and (4) inhibition of EGFR blocks α1-AR-induced Stat3 reporter activity. These findings are consistent with the observations that EGFR is transactivated by Gq-coupled(Gschwind et al., 2001) as well as Gs-couple(Bertelsen et al., 2004) receptors. However, it remains to be further defined whether α1-AR transactivates EGFR through activation of Src or release of EGFR ligand in hepatic cells. Given that activation of α1-AR induces Src-Stat3 binding and that Stat3 is a downstream target of EGFR, it is possible that Src may serve as EGFR downstream effector to mediate hepatic cell function, although the possibility of Src-induced EGFR activation cannot be excluded. Since the concentration of EGFR and Src inhibitors used in our system is relatively high (10–25 μM), further studies are needed to determine the precise role of EGFR and Src in α1-AR-mediated effects and the mechanisms for their actions.

Nguyen and Gao (Nguyen and Gao, 1999) showed that PE inhibits IL-6 activation of STAT3 in hepatic cells by a p42/44 mitogen-activated protein kinase-dependent mechanism, although the authors did not address whether αl-AR activation alone might alter Stat3 activity. The focus of our current study is to examine the direct effect of αl-AR on Stat3 activation in transformed and primary hepatocytes. Our data indicate that activation of αl-AR by PE or overexpression induces Stat3 phosphorylation, DNA binding and transcription activity. However, since the level of Stat3 activation induced by PE is approximately half of that induced by IL-6 (Figure 2), it is not surprising that combinational utilization of PE and IL-6 may cause less Stat3 activation than treatment with IL-6 alone, as described by Nguyen and Gao in their study. Thus, the effect of αlAR on Stat3 activation may be influenced by other growth-regulatory signaling pathways, especially the status of IL-6 activation.

In summary, our results in this study demonstrate a novel α1-AR-mediated Stat3 activation in hepatic cells which involves activation of Gq/11, Src and EGFR. These findings provide an insight into some of the mechanisms through which norepinephrine may be acting directly on hepatocytes to enhance hepatocyte proliferation. However, a limitation of this study is the relative high concentration of phenylephrine employed and the modest increase of Stat3 activation by α1-AR in cultured hepatic cells. Therefore, further studies are warranted to determine the potential impact of α1-AR-mediated EGFR/Stat3 activation in liver injury and regeneration in vivo.

Acknowledgments

Supported by the Cancer Research and Prevention Foundation grant (to CH) and the National Institutes of Health grants CA035373, CA103958 (to GKM) and CA102325 and CA106280 (to TW).

ABBREVIATIONS

AR
adrenergic receptor
CRE
cAMP response element
EGFR
epidermal growth factor receptor
GPCR
G protein-coupled receptor
RGS
regulator of G protein signaling
SH
src homology
Stat3
signal transducer and activator of transcription-3
PE
phenylephrine

References

  • Allen LF, Lefkowitz RJ, Caron MG, Cotecchia S. G-protein-coupled receptor genes as protooncogenes: constitutively activating mutation of the alpha 1B-adrenergic receptor enhances mitogenesis and tumorigenicity. Proc Natl Acad Sci U S A. 1991;88(24):11354–11358. [PubMed]
  • Bertelsen LS, Barrett KE, Keely SJ. Gs protein-coupled receptor agonists induce transactivation of the epidermal growth factor receptor in T84 cells: implications for epithelial secretory responses. J Biol Chem. 2004;279(8):6271–6279. [PubMed]
  • Boccaccio C, Ando M, Tamagnone L, Bardelli A, Michieli P, Battistini C, Comoglio PM. Induction of epithelial tubules by growth factor HGF depends on the STAT pathway. Nature. 1998;391(6664):285–288. [PubMed]
  • Boluyt MO, Zheng JS, Younes A, Long X, O’Neill L, Silverman H, Lakatta EG, Crow MT. Rapamycin inhibits alpha 1-adrenergic receptor-stimulated cardiac myocyte hypertrophy but not activation of hypertrophy-associated genes. Evidence for involvement of p70 S6 kinase. Circ Res. 1997;81(2):176–186. [PubMed]
  • Bromberg JF, Wrzeszczynska MH, Devgan G, Zhao Y, Pestell RG, Albanese C, Darnell JE., Jr Stat3 as an oncogene. Cell. 1999;98(3):295–303. [PubMed]
  • Broten J, Michalopoulos G, Petersen B, Cruise J. Adrenergic stimulation of hepatocyte growth factor expression. Biochem Biophys Res Commun. 1999;262(1):76–79. [PubMed]
  • Bylund DB, Blaxall HS, Iversen LJ, Caron MG, Lefkowitz RJ, Lomasney JW. Pharmacological characteristics of alpha 2-adrenergic receptors: comparison of pharmacologically defined subtypes with subtypes identified by molecular cloning. Mol Pharmacol. 1992;42(1):1–5. [PubMed]
  • Bylund DB, Eikenberg DC, Hieble JP, Langer SZ, Lefkowitz RJ, Minneman KP, Molinoff PB, Ruffolo RR, Jr, Trendelenburg U. International Union of Pharmacology nomenclature of adrenoceptors. Pharmacol Rev. 1994;46(2):121–136. [PubMed]
  • Calo V, Migliavacca M, Bazan V, Macaluso M, Buscemi M, Gebbia N, Russo A. STAT proteins: from normal control of cellular events to tumorigenesis. J Cell Physiol. 2003;197(2):157–168. [PubMed]
  • Chen L, Xin X, Eckhart AD, Yang N, Faber JE. Regulation of vascular smooth muscle growth by alpha 1-adrenoreceptor subtypes in vitro and in situ. J Biol Chem. 1995;270(52):30980–30988. [PubMed]
  • Cressman DE, Greenbaum LE, DeAngelis RA, Ciliberto G, Furth EE, Poli V, Taub R. Liver failure and defective hepatocyte regeneration in interleukin-6-deficient mice. Science. 1996;274(5291):1379–1383. [PubMed]
  • Cruise JL, Houck KA, Michalopoulos GK. Induction of DNA synthesis in cultured rat hepatocytes through stimulation of alpha 1 adrenoreceptor by norepinephrine. Science. 1985;227(4688):749–751. [PubMed]
  • Cruise JL, Knechtle SJ, Bollinger RR, Kuhn C, Michalopoulos G. Alpha 1-adrenergic effects and liver regeneration. Hepatology. 1987;7(6):1189–1194. [PubMed]
  • Cruise JL, Michalopoulos G. Norepinephrine and epidermal growth factor: dynamics of their interaction in the stimulation of hepatocyte DNA synthesis. J Cell Physiol. 1985;125(1):45–50. [PubMed]
  • Deighan C, Woollhead AM, Colston JF, McGrath JC. Hepatocytes from alpha1B-adrenoceptor knockout mice reveal compensatory adrenoceptor subtype substitution. Br J Pharmacol. 2004;142(6):1031–1037. [PMC free article] [PubMed]
  • Exton JH. Mechanisms involved in alpha-adrenergic phenomena: role of calcium ions in actions of catecholamines in liver and other tissues. Am J Physiol. 1980;238(1):E3–12. [PubMed]
  • Gao B. Cytokines, STATs and liver disease. Cell Mol Immunol. 2005;2(2):92–100. [PubMed]
  • Garcia-Sainz JA, Romero-Avila MT, Torres-Marquez ME. Characterization of the human liver alpha 1-adrenoceptors: predominance of the alpha 1A subtype. Eur J Pharmacol. 1995;289(1):81–86. [PubMed]
  • Gong G, Waris G, Tanveer R, Siddiqui A. Human hepatitis C virus NS5A protein alters intracellular calcium levels, induces oxidative stress, and activates STAT-3 and NF-kappa B. Proc Natl Acad Sci U S A. 2001;98(17):9599–9604. [PubMed]
  • Gschwind A, Zwick E, Prenzel N, Leserer M, Ullrich A. Cell communication networks: epidermal growth factor receptor transactivation as the paradigm for interreceptor signal transmission. Oncogene. 2001;20(13):1594–1600. [PubMed]
  • Haga S, Terui K, Zhang HQ, Enosawa S, Ogawa W, Inoue H, Okuyama T, Takeda K, Akira S, Ogino T, Irani K, Ozaki M. Stat3 protects against Fas-induced liver injury by redox-dependent and -independent mechanisms. J Clin Invest. 2003;112(7):989–998. [PMC free article] [PubMed]
  • Han C, Demetris AJ, Stolz DB, Xu L, Lim K, Wu T. Modulation of Stat3 activation by the cytosolic phospholipase A2alpha and cyclooxygenase-2-controlled prostaglandin E2 signaling pathway. J Biol Chem. 2006a;281(34):24831–24846. [PubMed]
  • Han C, Michalopoulos GK, Wu T. Prostaglandin E2 receptor EP1 transactivates EGFR/MET receptor tyrosine kinases and enhances invasiveness in human hepatocellular carcinoma cells. J Cell Physiol. 2006b;207(1):261–270. [PubMed]
  • Hata A, Seoane J, Lagna G, Montalvo E, Hemmati-Brivanlou A, Massague J. OAZ uses distinct DNA- and protein-binding zinc fingers in separate BMP-Smad and Olf signaling pathways. Cell. 2000;100(2):229–240. [PubMed]
  • Hein P, Michel MC. Signal transduction and regulation: are all alpha1-adrenergic receptor subtypes created equal? Biochemical pharmacology. 2007;73(8):1097–1106. [PubMed]
  • Hieble JP, Bylund DB, Clarke DE, Eikenburg DC, Langer SZ, Lefkowitz RJ, Minneman KP, Ruffolo RR., Jr International Union of Pharmacology. X. Recommendation for nomenclature of alpha 1-adrenoceptors: consensus update. Pharmacol Rev. 1995;47(2):267–270. [PubMed]
  • Hirasawa A, Awaji T, Xu Z, Shinoura H, Tsujimoto G. Regulation of subcellular localization of alpha1-adrenoceptor subtypes. Life Sci. 2001;68(19–20):2259–2267. [PubMed]
  • Hong F, Kim WH, Tian Z, Jaruga B, Ishac E, Shen X, Gao B. Elevated interleukin-6 during ethanol consumption acts as a potential endogenous protective cytokine against ethanol-induced apoptosis in the liver: involvement of induction of Bcl-2 and Bcl-x(L) proteins. Oncogene. 2002;21(1):32–43. [PubMed]
  • Hong F, Radaeva S, Pan HN, Tian Z, Veech R, Gao B. Interleukin 6 alleviates hepatic steatosis and ischemia/reperfusion injury in mice with fatty liver disease. Hepatology. 2004;40(4):933–941. [PubMed]
  • Hu ZW, Shi XY, Lin RZ, Hoffman BB. Alpha1 adrenergic receptors activate phosphatidylinositol 3-kinase in human vascular smooth muscle cells. Role in mitogenesis. J Biol Chem. 1996;271(15):8977–8982. [PubMed]
  • Inoue H, Ogawa W, Ozaki M, Haga S, Matsumoto M, Furukawa K, Hashimoto N, Kido Y, Mori T, Sakaue H, Teshigawara K, Jin S, Iguchi H, Hiramatsu R, LeRoith D, Takeda K, Akira S, Kasuga M. Role of STAT-3 in regulation of hepatic gluconeogenic genes and carbohydrate metabolism in vivo. Nat Med. 2004;10(2):168–174. [PubMed]
  • Knopp J, Macho L, Fickova M, Zorad S, Kvetnansky R, Jaroscakova I. Insulin and catecholamines act at different stages of rat liver regeneration. Ann N Y Acad Sci. 1997;827:489–493. [PubMed]
  • Kovalovich K, DeAngelis RA, Li W, Furth EE, Ciliberto G, Taub R. Increased toxin-induced liver injury and fibrosis in interleukin-6-deficient mice. Hepatology. 2000;31(1):149–159. [PubMed]
  • Kovalovich K, Li W, DeAngelis R, Greenbaum LE, Ciliberto G, Taub R. Interleukin-6 protects against Fas-mediated death by establishing a critical level of anti-apoptotic hepatic proteins FLIP, Bcl-2, and Bcl-xL. J Biol Chem. 2001;276(28):26605–26613. [PubMed]
  • Leng J, Han C, Demetris AJ, Michalopoulos GK, Wu T. Cyclooxygenase-2 promotes hepatocellular carcinoma cell growth through Akt activation: evidence for Akt inhibition in celecoxib-induced apoptosis. Hepatology. 2003;38(3):756–768. [PubMed]
  • Levy DE, Darnell JE., Jr Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol. 2002;3(9):651–662. [PubMed]
  • Li W, Liang X, Kellendonk C, Poli V, Taub R. STAT3 contributes to the mitogenic response of hepatocytes during liver regeneration. J Biol Chem. 2002;277(32):28411–28417. [PubMed]
  • Liang H, Venema VJ, Wang X, Ju H, Venema RC, Marrero MB. Regulation of angiotensin II-induced phosphorylation of STAT3 in vascular smooth muscle cells. J Biol Chem. 1999;274(28):19846–19851. [PubMed]
  • Lindroos PM, Zarnegar R, Michalopoulos GK. Hepatocyte growth factor (hepatopoietin A) rapidly increases in plasma before DNA synthesis and liver regeneration stimulated by partial hepatectomy and carbon tetrachloride administration. Hepatology. 1991;13(4):743–750. [PubMed]
  • Lo HW, Hsu SC, Ali-Seyed M, Gunduz M, Xia W, Wei Y, Bartholomeusz G, Shih JY, Hung MC. Nuclear interaction of EGFR and STAT3 in the activation of the iNOS/NO pathway. Cancer Cell. 2005;7(6):575–589. [PubMed]
  • Lopez-Gimenez JF, Canals M, Pediani JD, Milligan G. The alpha1b-adrenoceptor exists as a higher-order oligomer: effective oligomerization is required for receptor maturation, surface delivery, and function. Mol Pharmacol. 2007;71(4):1015–1029. [PubMed]
  • Ma YC, Huang J, Ali S, Lowry W, Huang XY. Src tyrosine kinase is a novel direct effector of G proteins. Cell. 2000;102(5):635–646. [PubMed]
  • Michalopoulos GK, DeFrances M. Liver regeneration. Adv Biochem Eng Biotechnol. 2005;93:101–134. [PubMed]
  • Michalopoulos GK, DeFrances MC. Liver regeneration. Science. 1997;276(5309):60–66. [PubMed]
  • Minneman KP. Alpha 1-adrenergic receptor subtypes, inositol phosphates, and sources of cell Ca2+ Pharmacol Rev. 1988;40(2):87–119. [PubMed]
  • Minneman KP, Esbenshade TA. Alpha 1-adrenergic receptor subtypes. Annu Rev Pharmacol Toxicol. 1994;34:117–133. [PubMed]
  • Nguyen VA, Gao B. Cross-talk between alpha(1B)-adrenergic receptor (alpha(1B)AR) and interleukin-6 (IL-6) signaling pathways. Activation of alpha(1b)AR inhibits il-6-activated STAT3 in hepatic cells by a p42/44 mitogen-activated protein kinase-dependent mechanism. J Biol Chem. 1999;274(50):35492–35498. [PubMed]
  • Oben JA, Roskams T, Yang S, Lin H, Sinelli N, Torbenson M, Smedh U, Moran TH, Li Z, Huang J, Thomas SA, Diehl AM. Hepatic fibrogenesis requires sympathetic neurotransmitters. Gut. 2004;53(3):438–445. [PMC free article] [PubMed]
  • Olsen PS, Poulsen SS, Kirkegaard P. Adrenergic effects on secretion of epidermal growth factor from Brunner’s glands. Gut. 1985;26(9):920–927. [PMC free article] [PubMed]
  • Perez DM. Structure-function of alpha1-adrenergic receptors. Biochemical pharmacology. 2007;73(8):1051–1062. [PMC free article] [PubMed]
  • Radaeva S, Sun R, Pan HN, Hong F, Gao B. Interleukin 22 (IL-22) plays a protective role in T cell-mediated murine hepatitis: IL-22 is a survival factor for hepatocytes via STAT3 activation. Hepatology. 2004;39(5):1332–1342. [PubMed]
  • Ruan Y, Kan H, Parmentier JH, Fatima S, Allen LF, Malik KU. Alpha-1A adrenergic receptor stimulation with phenylephrine promotes arachidonic acid release by activation of phospholipase D in rat-1 fibroblasts: inhibition by protein kinase A. J Pharmacol Exp Ther. 1998;284(2):576–585. [PubMed]
  • Runge D, Runge DM, Jager D, Lubecki KA, Beer Stolz D, Karathanasis S, Kietzmann T, Strom SC, Jungermann K, Fleig WE, Michalopoulos GK. Serum-free, long-term cultures of human hepatocytes: maintenance of cell morphology, transcription factors, and liver-specific functions. Biochem Biophys Res Commun. 2000;269(1):46–53. [PubMed]
  • Rybin VO, Guo J, Gertsberg Z, Elouardighi H, Steinberg SF. Protein kinase Cepsilon (PKCepsilon) and Src control PKCdelta activation loop phosphorylation in cardiomyocytes. J Biol Chem. 2007;282(32):23631–23638. [PMC free article] [PubMed]
  • Sah VP, Hoshijima M, Chien KR, Brown JH. Rho is required for Galphaq and alpha1-adrenergic receptor signaling in cardiomyocytes. Dissociation of Ras and Rho pathways. J Biol Chem. 1996;271(49):31185–31190. [PubMed]
  • Sakamoto T, Liu Z, Murase N, Ezure T, Yokomuro S, Poli V, Demetris AJ. Mitosis and apoptosis in the liver of interleukin-6-deficient mice after partial hepatectomy. Hepatology. 1999;29(2):403–411. [PubMed]
  • Sancho-Bru P, Bataller R, Colmenero J, Gasull X, Moreno M, Arroyo V, Brenner DA, Gines P. Norepinephrine induces calcium spikes and proinflammatory actions in human hepatic stellate cells. Am J Physiol Gastrointest Liver Physiol. 2006;291(5):G877–884. [PubMed]
  • Schaper F, Siewert E, Gomez-Lechon MJ, Gatsios P, Sachs M, Birchmeier W, Heinrich PC, Castell J. Hepatocyte growth factor/scatter factor (HGF/SF) signals via the STAT3/APRF transcription factor in human hepatoma cells and hepatocytes. FEBS Lett. 1997;405(1):99–103. [PubMed]
  • Seglen PO. Preparation of isolated rat liver cells. Methods Cell Biol. 1976;13:29–83. [PubMed]
  • Spector MS, Auer KL, Jarvis WD, Ishac EJ, Gao B, Kunos G, Dent P. Differential regulation of the mitogen-activated protein and stress-activated protein kinase cascades by adrenergic agonists in quiescent and regenerating adult rat hepatocytes. Mol Cell Biol. 1997;17(7):3556–3565. [PMC free article] [PubMed]
  • Thomas SM, Brugge JS. Cellular functions regulated by Src family kinases. Annu Rev Cell Dev Biol. 1997;13:513–609. [PubMed]
  • Turkson J, Bowman T, Adnane J, Zhang Y, Djeu JY, Sekharam M, Frank DA, Holzman LB, Wu J, Sebti S, Jove R. Requirement for Ras/Rac1-mediated p38 and c-Jun N-terminal kinase signaling in Stat3 transcriptional activity induced by the Src oncoprotein. Mol Cell Biol. 1999;19(11):7519–7528. [PMC free article] [PubMed]
  • Wang Z, Wang M, Carr BI. The inhibitory effect of interleukin 1beta on rat hepatocyte DNA synthesis is mediated by nitric oxide. Hepatology. 1998;28(2):430–435. [PubMed]
  • Waris G, Huh KW, Siddiqui A. Mitochondrially associated hepatitis B virus X protein constitutively activates transcription factors STAT-3 and NF-kappa B via oxidative stress. Mol Cell Biol. 2001;21(22):7721–7730. [PMC free article] [PubMed]
  • Williams NG, Zhong H, Minneman KP. Differential coupling of alpha1-, alpha2-, and beta-adrenergic receptors to mitogen-activated protein kinase pathways and differentiation in transfected PC12 cells. J Biol Chem. 1998;273(38):24624–24632. [PubMed]
  • Xiao L, Pimentel DR, Wang J, Singh K, Colucci WS, Sawyer DB. Role of reactive oxygen species and NAD(P)H oxidase in alpha(1)-adrenoceptor signaling in adult rat cardiac myocytes. Am J Physiol Cell Physiol. 2002;282(4):C926–934. [PubMed]
  • Xing M, Insel PA. Protein kinase C-dependent activation of cytosolic phospholipase A2 and mitogen-activated protein kinase by alpha 1-adrenergic receptors in Madin-Darby canine kidney cells. J Clin Invest. 1996;97(5):1302–1310. [PMC free article] [PubMed]
  • Yamauchi J, Hirasawa A, Miyamoto Y, Kokubu H, Nishii H, Okamoto M, Sugawara Y, Tsujimoto G, Itoh H. Role of Dbl’s big sister in the anti-mitogenic pathway from alpha1B-adrenergic receptor to c-Jun N-terminal kinase. Biochem Biophys ResCommun. 2002;296(1):85–92. [PubMed]
  • Yu CL, Meyer DJ, Campbell GS, Larner AC, Carter-Su C, Schwartz J, Jove R. Enhanced DNA-binding activity of a Stat3-related protein in cells transformed by the Src oncoprotein. Science. 1995;269(5220):81–83. [PubMed]