Search tips
Search criteria 


Logo of wtpaEurope PMCEurope PMC Funders GroupSubmit a Manuscript
J Neurosci. Author manuscript; available in PMC 2010 July 20.
Published in final edited form as:
PMCID: PMC2880491

α2-adrenoceptor blockade accelerates the neurogenic, neurotrophic, and behavioral effects of chronic antidepressant treatment


Slow-onset adaptive changes that arise from sustained antidepressant treatment, such as enhanced adult hippocampal neurogenesis and increased trophic factor expression, play a key role in the behavioral effects of antidepressants. α2-adrenoceptors contribute to the modulation of mood and are potential targets for the development of faster acting antidepressants. We investigated the influence of α2-adrenoceptors on adult hippocampal neurogenesis. Our results indicate that α2-adrenoceptor agonists, clonidine and guanabenz, decrease adult hippocampal neurogenesis through a selective effect on the proliferation, but not the survival or differentiation, of progenitors. These effects persist in dopamine β-hydroxylase knockout (Dbh −/−) mice lacking norepinephrine, supporting a role for α2-heteroceptors on progenitor cells, rather than α2-autoreceptors on noradrenergic neurons that inhibit norepinephrine release. Adult hippocampal progenitors in vitro express all the α2-adrenoceptor subtypes, and decreased neurosphere frequency and BrdU incorporation indicate direct effects of α2-adrenoceptor stimulation on progenitors. Further, co-administration of the α2-adrenoceptor antagonist yohimbine with the antidepressant imipramine significantly accelerates effects on hippocampal progenitor proliferation, the morphological maturation of newborn neurons, and the increase in expression of brain derived neurotrophic factor and vascular endothelial growth factor implicated in the neurogenic and behavioral effects of antidepressants. Finally, short duration (7 day) yohimbine and imipramine treatment results in robust behavioral responses in the novelty suppressed feeding test, which normally requires 3 weeks of treatment with classical antidepressants. Our results demonstrate that α2-adrenoceptors, expressed by progenitor cells, decrease adult hippocampal neurogenesis, while their blockade speeds up antidepressant action, highlighting their importance as targets for faster acting antidepressants.

Keywords: norepinephrine, neural stem cell, imipramine, adult hippocampal neurogenesis, BDNF, VEGF, depression, yohimbine

Depression is a prevalent psychiatric disorder, and current antidepressant medications share the major drawback of a delayed onset of therapeutic action (Thompson, 2002). While the mechanisms underlying this time lag are poorly understood, slow-onset adaptive changes in cortico-limbic brain regions like the hippocampus are hypothesized to contribute to the delayed beneficial effects of antidepressants (Sahay and Hen, 2007; Krishnan and Nestler, 2008). Hippocampal plasticity induced in response to chronic antidepressant treatment occurs both at the cellular level, through an increase in adult hippocampal neurogenesis (Malberg et al., 2000), and at the molecular level, via increased expression of trophic factors like brain derived neurotrophic factor (BDNF) (Nibuya et al., 1995) and vascular endothelial growth factor (VEGF) (Warner-Schmidt and Duman, 2007). The neurogenic changes following chronic antidepressant treatment involve both increased progenitor proliferation and morphological maturation of newborn neurons (Wang et al., 2008). These molecular and cellular adaptations arise only after 2-3 weeks of sustained antidepressant administration, and are demonstrated to play an important role in the behavioral effects of antidepressants (Shirayama et al., 2002; Santarelli et al., 2003; Airan et al., 2007; Warner-Schmidt and Duman, 2007). Treatments that would hasten the onset of these adaptive changes are of particular interest, as they may serve to identify putative rapid action antidepressants.

A slow recovery is not an inherent feature of depression, as electroconvulsive seizure therapy and combination drug treatments are reported to exhibit faster clinical effects (Daly et al., 2001; Blier, 2003). Amongst the targets for adjunct drug therapy is the α2-adrenoceptor (Blier, 2003). Clinical evidence indicates that co-administration of the α2-adrenoceptor antagonist yohimbine with an antidepressant hastens improvement in mood, and antidepressants that exhibit preferential α2-adrenoceptor antagonism like mirtazapine can exhibit faster therapeutic effects (Quitkin et al., 2001; Carpenter et al., 2002; Sanacora et al., 2004). Further, chronic antidepressant treatments have been demonstrated to desensitize and/or downregulate the α2-adrenoceptor, an effect speculated to play an important role in determining the speed of antidepressant action (Esteban et al., 1999; Andrade and Sudha, 2000). Several studies indicate enhanced α2-adrenoceptor mRNA, binding density or function in animal models of depression, and in postmortem studies of major depression (Fulford et al., 1994; Callado et al., 1998; Garcia-Vallejo et al., 1998; Garcia-Sevilla et al., 1999; Ribas et al., 2001). While preclinical and clinical studies implicate α2-adrenoceptors in both the pathogenesis and treatment of depression, thus far little is known about how α2-adrenoceptors regulate key adaptive plastic processes such as adult hippocampal neurogenesis that are thought to play an important role in antidepressant efficacy.

The present study was carried out to assess the influence of α2-adrenoceptors on adult hippocampal neurogenesis using in vivo and in vitro approaches. Further, we addressed whether adjunct α2-adrenoceptor antagonist treatment with an antidepressant accelerates the onset of adaptive changes such as increased hippocampal neurogenesis and enhanced trophic factor expression, and whether this translates into faster behavioral effects of antidepressant treatment in animal models. Our results underscore the importance of the α2-adrenoceptor as a target for the development of faster acting antidepressants.

Materials and Methods


Adult male Wistar rats (250-300 gm, 2 months of age) bred in the TIFR animal colony were used in the present study. Animals were group housed and maintained on a 12 hour light-dark cycle with access to food and water ad libitum. For dispersed hippocampal progenitor culture studies, adult Wistar rats were used, and for the neurosphere assays, Wistar rat pups (7 day) were used. For the Dopamine beta-hydroxylase (Dbh) knockout experiments, adult Dbh +/− and Dbh −/− mice, maintained on a mixed 129/SvEv and C57BL/6J background and generated as previously described (Thomas et al., 1995; Thomas and Palmiter, 1998) were used. Pregnant Dbh +/− mice were given the adrenergic receptor agonists, isoproterenol and phenylephrine (20 μg/ml each) + vitamin C (2 mg/ml) from E9.5-E14.5, and L-3,4-dihydroxyphenylserine (DOPS; 2 mg/ml + vitamin C 2 mg/ml) from E14.5-birth in their drinking water to rescue the embryonic lethality associated with the Dbh −/− mutation. Dbh +/− mice were used as controls because they have normal norepinephrine/epinephrine levels and are phenotypically indistinguishable from Dbh +/+ mice (Thomas et al., 1995; Thomas and Palmiter, 1998; Szot et al., 1999). Since no sex differences in hippocampal neurogenesis were observed, female Dbh +/− and Dbh −/− mice were used in this study. For the α2A and α2C-adrenoceptor knockout studies, adult male mutant mice generated as previously described (Altman et al., 1999; Hein et al., 1999) were used. The α2AC knockout mice were generated through crossing the single-knockout strains (Hein et al., 1999). For all mouse studies, animals 3-6 months of age were used and genotypes were confirmed using PCR. All animal procedures were carried out in accordance with the NIH Guide for the Care and Use of Laboratory Animals and were approved by the TIFR Institutional Animal Ethics committee, Animal Ethics Committee of the University of Queensland, the Emory University Animal Care and Use Committee, or the University of Freiburg, and appropriate government authorities.

Drug treatments and BrdU labeling paradigms

To study the influence of α2-adrenoceptor stimulation, the α2-adrenoceptor agonists, clonidine (1 mg/kg, Sigma, USA) or guanabenz (2 mg/kg, Sigma) were used. To address the effects of α2-adrenoceptor blockade, the α2-adrenoceptor antagonists, yohimbine (2 mg/kg, Sigma) or RX811059 (2-ethoxy-idazoxan, 2.5 mg/kg, Sigma) were used. For the antidepressant studies, animals received treatment with the tricyclic antidepressant imipramine (20 mg/kg, Sigma). The vehicle used in this study was 0.9% saline, with the exception of yohimbine, for which it was 10% DMSO. The choice of drug doses was based on previous studies (Dursun and Handley, 1993; Garcia-Vallejo et al., 1998; Bortolozzi and Artigas 2003; Gobert et al., 2003; Sairanen et al., 2005; Nair et al., 2006) and all drugs were administered via intraperitoneal (i.p.) injection.

To study the influence of α2-adrenoceptor stimulation or blockade on the proliferation of adult hippocampal progenitors, animals received two different treatment regimes (acute and chronic). In the acute treatment regime, rats received a single injection of the α2-adrenoceptor drugs (clonidine, guanabenz, yohimbine or RX811059) or vehicle, followed 45 minutes later by a single injection of the mitotic marker 5-bromo-2′-deoxyuridine (BrdU, 200 mg/kg; Sigma) and were sacrificed 2 hours later (n = 6/group; each experiment had its individual vehicle group). In the chronic treatment regime, rats received treatment with the α2-adrenoceptor drugs (clonidine, guanabenz, or yohimbine) or vehicle once daily for seven days. On the last day of treatment, 2 hours after drug or vehicle administration, animals received a single injection of BrdU (200 mg/kg) and were sacrificed 24 hours later (n = 5-6/group; each experiment had its individual vehicle group). To address whether the effects of α2-adrenoceptor stimulation on hippocampal progenitor proliferation could be prevented by prior α2-adrenoceptor blockade, animals were divided into four experimental groups (vehicle/vehicle, vehicle/clonidine, yohimbine/vehicle and yohimbine/clonidine, n = 10/group; yohimbine/vehicle group, n = 6). The two injections were separated by thirty minutes. BrdU was administered 45 minutes after the last injection and the animals were sacrificed 2 hours later.

Dbh mutant mice were utilized to address whether the effects of α2-adrenoceptor agonists on adult hippocampal progenitor proliferation involve stimulation of inhibitory α2-autoreceptors or α2-heteroceptors on target neurons. Because Dbh −/− mice lack endogenous norepinephrine, any effect of α2-adrenoceptor agonists in these mice must be mediated by α2-heteroceptors. Dbh +/− and Dbh −/− mice received treatment with guanabenz (2 mg/kg) or vehicle once daily for seven days. On the last day of treatment, 2 hours after drug or vehicle administration, animals received a single injection of BrdU (200 mg/kg) and were sacrificed 24 hours later (n = 5-6/group). To address the role of individual α2-adrenoceptor subtypes on adult hippocampal progenitor proliferation, α2A, α2C and α2AC knockout and wild-type control mice received a single administration of BrdU (100 mg/kg) and were sacrificed 2 hours later (n = 4-5/group).

To determine the influence of α2-adrenoceptor stimulation or blockade on the survival and differentiation of adult hippocampal progenitors, drug-naive rats first received BrdU (200 mg/kg) once daily for three consecutive days. Five days following the last BrdU treatment, a timepoint at which BrdU positive cells are likely to be postmitotic (Cameron and McKay, 2001), rats received treatment with the α2-adrenoceptor agonist clonidine, the α2-adrenoceptor antagonist yohimbine and respective vehicle treatment once daily for 21 days and were sacrificed 24 hours after the final drug treatment (n = 4-6/group). To assess effects of α2-adrenoceptor stimulation on hippocampal progenitor maturation at earlier time-points post BrdU labeling, drug-naive animals first received BrdU (100 mg/kg) twice daily for two consecutive days followed by a single BrdU injection on the third day. Treatment with the α2-adrenoceptor agonist, guanabenz, commenced the day after the final BrdU injection and continued for seven consecutive days. Animals were sacrificed 24 hours after the final vehicle/guanabenz treatment (n = 4/group).

To address the influence of α2-adrenoceptor blockade on the behavioral and neurogenic effects of the antidepressant imipramine, rats were divided into four treatment groups: Vehicle/Vehicle, Yohimbine/Vehicle, Vehicle/Imipramine, Yohimbine/Imipramine (n = 10/group). The two injections were spaced apart by thirty minutes. All four groups received the above described drug treatment regime for 7 or 21 days. Two hours after the last drug treatment animals were tested for their behavior in the novelty suppressed feeding (NSF) test. The NSF test is reported to be responsive to chronic administration of classical antidepressants for 2-3 weeks (Bodnoff et al., 1988; Santarelli et al., 2003). Following the NSF test, animals were injected with BrdU (200 mg/kg i.p.) and were sacrificed 24 hours later to address effects on progenitor proliferation using BrdU immunohistochemistry and immature neuron numbers using DCX immunohistochemistry. Further, a group of animals that received the above treatment regime for 14 days was also used to address effects on endogenous markers of hippocampal neurogenesis (n = 6/group). An additional group of animals (n = 6/group) from the 7 day drug treatment regime were sacrificed 28 days after the final BrdU treatment to study differentiation of BrdU-labeled hippocampal progenitors into neurons or glia. To address whether the 7 day combined drug treatment regime influences hippocampal progenitor maturation, drug-naive animals first received BrdU (100 mg/kg) twice daily for two consecutive days followed by a single BrdU injection on the third day. Animals were divided into the four treatment groups as described above and received the 7 day drug treatment paradigm with Yohimbine and Imipramine and were sacrificed 24 hours after the final treatment (n = 5/group).

To address the effects of a short duration (7 days) combined treatment with yohimbine and imipramine on gene expression in the hippocampus, animals received vehicle or yohimbine injections followed 30 minutes later by vehicle or imipramine treatment as described above, and were sacrificed 2 hours after the last injection (n = 4/group). To assess the influence of a short duration (7 days) treatment with yohimbine and imipramine on norepinephrine levels in the hippocampus, animals received vehicle or yohimbine injections followed 30 minutes later by vehicle or imipramine treatment as described above (n = 6/group).

Dispersed adult hippocampal progenitor cultures

Dissociated adult hippocampal progenitor cell cultures were generated from adult male Wistar rats (2 months) based on a previously described method (Palmer et al., 1999) and cells were cultured in DMEM/F-12 with N2 supplement (Gibco, USA) and 40 ng/ml FGF-2 (R&D Systems, USA) on poly-ornithine (Sigma) and laminin (Sigma) coated tissue culture plates. Hippocampal progenitors were plated in 16-well poly-ornithine and laminin coated Labtek chamber slides (Nunc, USA) at a density of 5 × 105 cells/well. To address the influence of α2-adrenoceptor stimulation or blockade on hippocampal progenitor proliferation, cells were exposed for 24 hours to growth medium with or without clonidine (10, 50 and 100 μM) or yohimbine (10, 50 and 100 μM). Cells were then exposed to a pulse of BrdU (40 μM, Sigma) for 2 hours and were fixed by exposure to 4% paraformaldehyde (PFA) for 15 minutes prior to further processing. In vitro drug doses were selected based on prior literature (Ortego and Coca-Prados, 1998; Han et al., 2007). To examine the expression of α2A, α2B and α2C-adrenoceptor subtypes in hippocampal progenitors, total RNA was isolated from the dispersed hippocampal progenitor cultures (Oligotex Direct RNA kit, Qiagen, USA) and PCR was performed on reverse transcribed cDNA using specific forward and reverse primers. The primer sequences (DNA Technology, Denmark) for α2A, α2B, α2C and β–actin were based on prior literature (Faber et al., 2001; Mori et al., 2002).

Neurosphere assay

7-day-old Wistar pups were sacrificed under isoflurane induced anaesthesia and hippocampi were dissected out into HEPES-buffered Eagle's medium. Hippocampal tissue was minced, treated with 0.1% trypsin-EDTA for 5 minutes at 37°C, and digestion was stopped by adding trypsin inhibitor (0.014% w/v, Sigma). Tissue was triturated to obtain a single cell suspension and cells were plated at 1000 cells/well in a 96-well plate and cultured in NeuroCult NSC basal medium with proliferation supplements (StemCell Technologies, Vancouver, Canada), 2% bovine serum albumin (Gibco), 2 μg/ml heparin (Sigma), epidermal growth factor (20ng/ml, BD Biosciences, Australia) and basic fibroblast growth factor (10ng/ml, Roche, USA). Cells were treated with clonidine (100 μM), guanabenz (10 μM), or yohimbine (10 μM) for the duration of the experiment. In vitro drug doses were selected based on prior literature (Ortego and Coca-Prados, 1998; Dunbar et al., 2006; Han et al., 2007). In each experiment, 20 wells were plated per treatment group and the experiment was repeated three times. The number of neurospheres (> 100 μm) obtained per well was counted after 10 days in culture.

Immunohistochemistry and immunofluorescence

Animals were sacrificed through transcardial perfusion with 4% PFA and serial coronal sections (50 μm) through the rostro-caudal extent of the hippocampus were generated on a vibratome. Sections were processed for BrdU, Proliferating cell nuclear antigen (PCNA) or Doublecortin (DCX) immunohistochemistry as described previously (Kulkarni et al., 2002, Jha et al., 2006). In brief, BrdU immunohistochemistry involved DNA denaturation and acid hydrolysis followed by overnight incubation with anti-BrdU antibody (mouse anti-BrdU, 1:500, Boehringer Mannheim, USA; rat anti-BrdU, 1:500, Accurate Biochemicals, USA) prior to treatment with secondary antibody (biotinylated anti-mouse IgG or anti-rat IgG, 1:500, Vector Laboratories, USA or Cy3-conjugated anti-mouse IgG, 1:1000, Molecular Probes, USA). For PCNA immunohistochemistry, sections were subjected to antigen retrieval in 0.1M PB at 80 °C for half an hour prior to blocking and overnight incubation with mouse anti-PCNA (1:250, Chemicon, USA) followed by incubation with biotinylated horse anti-mouse secondary antibody (1:250, Vector) for 2 hours. For DCX immunohistochemistry, sections were incubated with goat anti-DCX antibody (1:250, Santa Cruz Biotechnology, USA) overnight followed by incubation with a biotinylated rabbit anti-goat secondary antibody (1:500, Vector) for 2 hours. For NeuroD immunohistochemistry, sections were incubated with goat anti-NeuroD antibody (1:250, Santa Cruz Biotechnology) overnight followed by incubation with a biotinylated rabbit anti-goat secondary antibody (1:500, Vector) for 2 hours. Signal amplification was performed using a Vectastain Elite Avidin-Biotin system (Vector) and was visualized using diaminobenzidine (Sigma) as a substrate.

For double label immunofluorescence, sections subjected to DNA denaturation and acid hydrolysis were exposed to the following combinations of antibodies: (1) mouse anti-BrdU (1:500, Roche) and goat anti-calretinin (1:250; Chemicon), (2) mouse anti-BrdU (1:500, Roche) and goat anti-DCX (1:250; Santacruz Biotechnology) overnight at room temperature. Sections were incubated with a cocktail of secondary antibodies: biotinylated anti-mouse IgG (1:250, Vector) and rhodamine conjugated anti-goat IgG (1:250, Molecular Probes) prior to incubation with fluorescein-conjugated streptavidin (1:500, Amersham, UK) for 1 hour.

For triple label immunofluorescence, sections subjected to DNA denaturation and acid hydrolysis were exposed to a cocktail of antibodies: rat anti-BrdU (1:200, Accurate Biochemicals, USA), mouse anti-neuronal nuclei (NeuN; 1:1000; Chemicon, USA) and rabbit anti-glial fibrillary acidic protein (GFAP; 1:500; Sigma) overnight at room temperature. Sections were incubated with a cocktail of secondary antibodies: biotinylated anti-rat IgG (1:500, Chemicon), rhodamine conjugated anti-mouse IgG (1:500, Chemicon) and Cy-5 conjugated anti-rabbit IgG (1:500, Chemicon) for 2 hours, followed by incubation with fluorescein-conjugated streptavidin (1:500, Amersham, UK) for 1 hour.

Cell Counting Analysis

All cell counting analysis was performed on coded sections by an experimenter blind to the study code. Quantitation of BrdU-positive cell numbers in tissue sections was carried out using a previously described modified, unbiased stereology protocol (Malberg et al., 2000) on a Zeiss Axioskop microscope. Sections spanned the rostro-caudal extent of the hippocampus and every fifth hippocampal section was processed for BrdU quantitation (10 sections/animal). BrdU-positive cells within dentate gyrus (DG) were counted as being in the subgranular zone (SGZ) / granule cell layer (GCL) when they were directly touching the SGZ or within it. The total number of BrdU-positive cells per SGZ/GCL was estimated by multiplying the total number of BrdU-positive cells counted by the section periodicity (5) and results are expressed as the total number of BrdU-positive cells per SGZ/GCL. Quantitation of PCNA positive cells followed the same approach described above for BrdU-quantitation. To determine DCX or NeuroD positive cell number in the hippocampus, the number of DCX or NeuroD positive cells in the DG were quantitated (four to six sections/animal) and results were expressed as the number of DCX or NeuroD positive cells per section. Further, we also examined the morphological status of DCX-positive cells by categorizing them as (1) DCX-positive cells without tertiary dendrites or (2) DCX-positive cells with complex tertiary arbors (Wang et al., 2008). Quantitation of both DCX-positive cell number and morphological category was performed using a Zeiss Axioskop at a magnification of 400X.

To address effects on the maturation of hippocampal progenitors, the percentage of BrdU-positive cells that colocalized with the markers calretinin or DCX was determined using confocal microscopy. A minimum of 60 (BrdU/calretinin) or 30 (BrdU/DCX) BrdU-positive cells from each animal (4 sections, 500 μm apart) were analyzed using z-plane confocal sectioning with 1 μm steps on a Biorad MRC1024 to confirm colocalization of BrdU with calretinin or DCX. To study progenitor differentiation into NeuN-positive neurons or GFAP positive glia, the percentage of BrdU-positive cells that colocalized with NeuN or GFAP was assessed. A minimum of 30 BrdU-positive cells from each animal (8 sections, 250 μm apart) were analyzed using z-plane sectioning with 0.5μm steps on a Biorad MRC1024 confocal microscope to confirm colocalization with either NeuN or GFAP.

Quantitation of the numbers of BrdU-positive cells in adult rat hippocampal progenitor cultures was done using an epifluorescent Zeiss microscope by an experimenter blind to the treatment conditions. The percentage of DAPI-positive cells per field that were labeled with BrdU was determined. The number of BrdU-positive cells for the proliferation experiment was counted in more than 600 cells/well (3 random, non-overlapping individual fields per well) and 3 wells were scored per treatment condition.

In situ hybridization and Autoradiogram quantitation

In situ hybridization was carried out as previously described (Nair et al., 2007). In brief, 14 μm cryostat cut coronal sections were fixed, acetylated and dehydrated prior to storage at −70 °C. Rat BDNF, VEGF, fibroblast growth factor-2 (FGF-2), VGF (not an acronym), activity regulated cytoskeletal protein (Arc) and cyclic AMP response element binding protein (CREB) cRNA probes were generated from either transcription competent plasmids or PCR generated templates. Plasmids for BDNF, FGF-2, VGF, Arc and CREB were kindly provided by Dr. Julie Lauterborn (University of California, Irvine), Dr. Sondra Bland (University of Colorado, Boulder), Dr. Shubha Tole (Tata Institute of Fundamental Research, Mumbai), Dr. Oswald Steward (John Hopkins University, Baltimore) and Dr. Ronald Duman (Yale University, New Haven) respectively. The VEGF template for VEGF exon 3 was PCR generated using a forward primer with a T3 site and a reverse primer with a T7 site (Forward primer: AATTAACCCTCACTAAAGGGTCCAATTGAGACCCTGGTG; Reverse primer: TAATACGACTCACTATAGGGCCATAGTGACGTTGCTCTCCG). cRNA probes were transcribed using 35S-labeled UTP (Amersham, Buckinghamshire, UK) and slides were incubated with 35S-UTP labeled riboprobes at a concentration of 2 × 106 cpm/150 ul in hybridization buffer. Post hybridization, slides were subjected to RNAse A (20 μg/ml) treatment at 45 °C for 30 min, followed by stringent washes in decreasing concentrations of SSC. Slides were air dried and exposed to Hyperfilm β-max (Amersham, UK) for 1-2 weeks. Autoradiograms were analyzed using the Macintosh-based Scion Image software (Scion, USA). To correct for non-linearity 14C standards were used for calibration. The dentate gyrus granule cell region was analyzed and an equivalent area was outlined for each sample. Optical density measurements from both sides of 3–4 individual sections from each animal were analyzed, from which the mean value was calculated. Sense riboprobes or a ribonuclease A pretreatment wash (40 μg/ml at 37°C for 30 min) did not yield any significant hybridization (data not shown) confirming the specificity of signal.

Novelty suppressed feeding test

To address the influence of α2-adrenoceptor blockade on the behavioral effects of the antidepressant imipramine, animals were subjected to the novelty suppressed feeding paradigm, which has been previously reported to demonstrate differences in behavior following chronic, but not acute, antidepressant treatment (Bodnoff et al., 1988; Santarelli et al., 2003). Rats in the four different treatment groups, vehicle/vehicle, yohimbine/vehicle, vehicle/imipramine and yohimbine/imipramine were tested on day 7 and day 21 of treatment in two distinct experiments. Food was withdrawn 48 hours prior to the test with water available ad libitum. The test was performed in a black rectangular box of dimensions (52 × 48 × 32 cm) kept in a dark room. Food pellets were placed in the center of the box on a small elevated platform that was brightly illuminated. At the start of the test rats were placed in a dark corner of the box facing the wall and were observed for a period lasting 5 minutes. The latency to feed was determined and animals that did not approach the food pellet were given a score of 300 sec equaling the entire duration of the test. At the end of the test animals were transferred to their home cages with food available, and their food consumption was measured for 30 minutes.

Biochemical detection of norepinephrine

To assess the levels of norepinephrine in the hippocampus following combined treatment with yohimbine and imipramine for seven days, high performance liquid chromatography (HPLC) was used. Following sacrifice 24 hours after the final treatment, hippocampi were rapidly dissected out and frozen in liquid nitrogen. Homogenates were generated through sonication of hippocampi in 0.1M perchloric acid followed by centrifugation at 15,000 rpm for 10min at 4°C. Supernatants were processed for determination of norepinephrine. Levels of norepinephrine were determined with a fluorometric detection method for HPLC analysis as described previously (Lakshmana and Raju, 1997) using purified norepinephrine (Sigma) as a standard.

Statistical analysis

Results were subjected to statistical analysis using the statistical software Prism (Graphpad, USA). Experiments with two groups were analyzed for differences using the unpaired Student's t-test, with significance determined at p < 0.05. Experiments with three groups or more were subjected to statistical analyses using One-way or Two-way Analysis of Variance (ANOVA) with significance determined at p values < 0.05, followed by the Bonferroni post-hoc test for group comparisons. The Two-way ANOVA was used to assess interaction effects between two factors namely: (1) α2-adrenoceptor antagonist, yohimbine and α2-adrenoceptor agonist, clonidine, (2) Genotype (Dbh) and α2-adrenoceptor agonist, guanabenz, and (3) the antidepressant, imipramine and the α2-adrenoceptor antagonist, yohimbine.


α2-adrenoceptor stimulation decreases adult hippocampal progenitor proliferation in vivo

Acute (single injection- Fig. 1) or chronic (once daily injections for 7 days- Supplementary Fig. 1) treatments with the α2-adrenoceptor agonists, guanabenz or clonidine, resulted in a significant decline in the proliferation of adult hippocampal progenitors, assessed using the mitotic marker BrdU. BrdU-positive cells were predominantly localized to the subgranular zone (SGZ) (Fig. 1B) lining the border of the granule cell layer (GCL) and the hilus. Analysis of the numbers of BrdU-positive cells in the SGZ, using unbiased stereological approaches, revealed a significant decline of 34% and 38% in BrdU-positive cell number after acute guanabenz (Fig. 1C) or acute clonidine (Fig. 1C) treatment respectively. Chronic treatments with guanabenz or clonidine (Supplementary Fig. 1) resulted in a 45% and 32% decline in the numbers of BrdU-positive cells in the SGZ respectively. To corroborate the effects of α2-adrenoceptor stimulation on adult hippocampal progenitor proliferation observed with BrdU, we also examined the effect of acute clonidine treatment on an endogenous marker of cell division, proliferating cell nuclear antigen (PCNA). Acute clonidine treatment resulted in a significant decline (35%) in the number of PCNA-positive cells within the SGZ (Supplementary Fig. 1).

Figure 1
α2-adrenoceptor stimulation decreases the proliferation of adult hippocampal progenitors. Rats received acute treatment with the α2-adrenoceptor agonists guanabenz or clonidine, or the α2-adrenoceptor antagonist yohimbine as described ...

Next, we addressed whether pretreatment with the α2-adrenoceptor antagonist, yohimbine, would block the effects of clonidine on hippocampal progenitor proliferation. Pretreatment with yohimbine completely blocked the clonidine-induced decline in BrdU-positive cell number observed within the SGZ (Supplementary Fig. 1). Two-way ANOVA revealed a significant yohimbine × clonidine interaction [F(1,26) = 11.59, p = 0.0022]. Further, to assess whether α2-adrenoceptor blockade itself influences adult hippocampal progenitor proliferation, animals received acute treatments with the α2-adrenoceptor antagonists, yohimbine or RX811059. Acute treatment with either of the α2-adrenoceptor antagonists did not alter the number of BrdU-positive cells within the SGZ (Fig. 1C) (SGZ BrdU-positive cell number: Vehicle = 1215.83 ± 140.60, RX811059 = 1315 ± 155; p > 0.05, Results are the mean ± SEM, p > 0.05, Student's t-test). In addition, chronic treatment with yohimbine also did not change the number of BrdU positive cells in the SGZ (Supplementary Fig. 1).

α2-adrenoceptor stimulation induced decline in adult hippocampal progenitor proliferation persists in Dbh −/− mice

α2-adrenoceptors are coupled to Gi protein, inhibit adenylyl cyclase and exist both as presynaptic inhibitory autoreceptors that control norepinephrine release and as α2-heteroceptors on target neurons receiving noradrenergic input. Dbh −/− mice were used to distinguish whether the effects of α2-adrenoceptor stimulation on progenitor proliferation are mediated by α2-autoreceptors or heteroceptors. Because Dbh −/− mice lack norepinephrine, α2-adrenoceptor agonists cannot produce effects via autoreceptor modulation of norepinephrine release their only activity is via α2-heteroceptors (Szot et al., 2004). Chronic administration of the α2-adrenoceptor agonist, guanabenz, to Dbh −/− mice resulted in a significant decline in the number of BrdU-positive cells in the SGZ (Fig. 2). The extent of this significant decline in hippocampal progenitor proliferation was similar to that observed in Dbh +/− controls treated with guanabenz. Two-way ANOVA indicated no genotype × guanabenz interaction [F(1,13) = 0.07, p = 0.80]. The persistence of the guanabenz-induced impairment of hippocampal progenitor proliferation in Dbh −/− mice supports a role for α2-heteroceptors in vivo. However, it is not possible to rule out a role for other factors released by noradrenergic nerve terminals following α2-autoreceptor stimulation that may modulate hippocampal progenitor turnover.

Figure 2
α2-adrenoceptor stimulation induced decline in adult hippocampal progenitor proliferation persists in Dbh −/− mice. Dbh +/− and Dbh −/− mice received treatment with guanabenz or vehicle once daily for seven ...

Dbh −/− mice did not exhibit a baseline decrease in hippocampal progenitor proliferation as compared to Dbh +/− controls (Fig. 2B). This suggests that genetic loss of norepinephrine through postnatal development and adulthood does not produce a significant alteration in the proliferation of adult hippocampal progenitors, unlike the decline observed with pharmacological norepinephrine depletion in adult animals (Kulkarni et al., 2002), suggesting possible compensatory mechanisms (Weinshenker et al., 2002; Schank et al., 2006).

α2-adrenoceptor stimulation decreases proliferation of adult hippocampal progenitors in vitro

Given that the effects of α2-adrenoceptor agonists on hippocampal progenitor proliferation likely involve α2-heteroceptors, we next sought to address if adult hippocampal progenitors express α2-adrenoceptor subtypes and whether α2-adrenoceptor agonists modulate their proliferation in vitro. RT-PCR on nestin immunopositive, dispersed adult hippocampal progenitors in culture (Fig. 3A, B) demonstrated the mRNA expression of α2A, α2B and α2C-adrenoceptor subtypes (Fig. 3C). To examine the effects of α2-adrenoceptor stimulation on the proliferation of adult hippocampal progenitors in culture, progenitor cells were exposed to clonidine (10, 50 or 100 μM) for 24 hours prior to a BrdU pulse for 2 hours to determine the number of progenitors entering the S-phase of cell cycle. α2-adrenoceptor stimulation with clonidine led to a significant decrease in the numbers of BrdU-positive cells labeled in vitro (Fig. 3D-F). Similar to the in vivo results obtained with α2-adrenoceptor antagonists, hippocampal progenitors in vitro treated with yohimbine (10, 50 or 100 μM) did not exhibit any change in proliferation (data not shown).

Figure 3
α2-adrenoceptor stimulation decreases the proliferation of adult hippocampal progenitors in vitro in two culture models, dispersed adult hippocampal progenitor cultures and the Neurosphere assay. Nestin-immunopositive (A- Nestin, B - DAPI), dispersed ...

To further ascertain whether the α2-adrenoceptor agonist induced decline in hippocampal progenitor proliferation is mediated through a direct effect on hippocampal progenitors, we also performed the neurosphere assay (Fig. 3G). Exposure of neurosphere cultures to clonidine or guanabenz resulted in a significant reduction in neurosphere formation (Fig. 3H). While treatment with guanabenz resulted in a robust and significant (44%) decline in neurosphere formation, the percent decline induced by clonidine treatment, though significant, was relatively small (14%) (Fig. 3H). In contrast, treatment with yohimbine did not alter the numbers of neurospheres generated (Fig. 3H). Taken together, these results demonstrate that the direct stimulation of α2-adrenoceptors on hippocampal progenitors inhibits proliferation.

Adult hippocampal progenitor proliferation is unaffected in α2A, α2C and α2AC-adrenoceptor knockout mice

To address whether turnover of adult hippocampal progenitors is altered in α2-adrenoceptor subtype knockout mice, we examined the number of BrdU-positive cells in α2A−/−, α2C−/− and α2AC−/− mice. Total numbers of BrdU-positive cells in the SGZ of α2A, α2C and α2AC -adrenoceptor knockout mice were not different from those of wild-type controls (Table 1). Further, we examined the numbers of cells expressing doublecortin (DCX), an endogenous marker of immature newborn neurons, and observed no difference in the numbers of DCX-positive cells in α2A, α2C and α2AC-adrenoceptor knockout mice as compared to wild-type controls (Table 1).

Table 1
Proliferation of adult hippocampal progenitors and DCX-positive immature neuron number is not altered in α2A, α2C, and α2AC-adrenoceptor subtype knockout mice. Wild type, α2A, α2C, and α2AC-adrenoceptor ...

α2-adrenoceptor stimulation or blockade does not influence the survival and differentiation of adult hippocampal progenitors

To examine the influence of α2-adrenoceptor agonist or antagonist treatment on the survival and differentiation of adult hippocampal progenitors, drug-naive animals first received BrdU injections (Fig. 4A). Administration of either clonidine or yohimbine commenced 5 days post BrdU treatment and continued for 21 days (Fig. 4A). This particular BrdU labeling paradigm allows us to assess whether the post-mitotic survival, or differentiation, of a BrdU-labeled cohort of hippocampal progenitors is influenced by α2-adrenoceptor stimulation or blockade.

Figure 4
α2-adrenoceptor stimulation or blockade does not influence the survival and differentiation of adult hippocampal progenitors. Drug-naive rats first received BrdU injections followed by treatment with vehicle, clonidine or yohimbine for 21 days ...

The survival of hippocampal progenitors in the SGZ/GCL was unaffected by clonidine or yohimbine treatment, as the numbers of BrdU-positive cells that persist in the SGZ/GCL was unchanged in both the clonidine (Fig. 4B, C) and yohimbine (Fig. 4B, D) treated groups in comparison to their respective vehicle-treated controls. We then determined whether the differentiation of BrdU-positive progenitors in the SGZ/GCL into a neuronal (NeuN-immunopositive, Fig. 4G) or glial (GFAP-immunopositive, Fig. 4H) fate is influenced by α2-adrenoceptor stimulation or blockade. Confocal analysis with z-plane sectioning indicated no change in the percentage of BrdU-positive cells that acquired a neuronal or glial phenotype in vehicle versus clonidine (Fig. 4E), or yohimbine, treated groups (Fig. 4F). A majority of BrdU positive cells acquired a neuronal phenotype with far fewer numbers taking on a glial fate. BrdU-positive cells that did not colocalize with either NeuN or GFAP may represent as yet undifferentiated progenitors.

We also examined whether α2-adrenoceptor stimulation would influence earlier stages of maturation of hippocampal progenitors by addressing the percent colocalization of BrdU with DCX. Using a BrdU labeling paradigm (Supplementary Fig. 2) that did not involve a washout following BrdU administration to drug-naive animals, we carried out a short duration (7 day) treatment with the α2-adrenoceptor agonist, guanabenz. BrdU-DCX percent colocalization was unaltered following guanabenz treatment (Supplementary Fig. 2).

α2-adrenoceptor blockade accelerates antidepressant–induced adult hippocampal neurogenesis

To assess whether α2-adrenoceptor blockade accelerates the effects of antidepressant drugs on adult hippocampal progenitor proliferation, we examined the influence of combined treatment (7 or 21 days) with the α2-adrenoceptor antagonist yohimbine and the tricyclic antidepressant imipramine on BrdU-positive cell number in the SGZ/GCL (Fig. 5A). At 21 days, a time-point when antidepressant treatments have been previously reported to enhance BrdU-positive cell number (Malberg et al., 2000, Santarelli et al., 2003), we observed a significant increase in the number of BrdU positive cells in both the group that received only imipramine (Fig. 5F, G) and the group that received combined yohimbine and imipramine treatment (Fig. 5F, G). Two-way ANOVA analysis of the 21 day treatment experiment indicated no significant interaction of yohimbine × imipramine [F(1,12) = 1.22, p = 0.29]. In contrast, only the combined yohimbine and imipramine treated group showed a significant increase in the number of BrdU-positive cells in the SGZ at the 7 day time point (Fig. 5B, C). Two-way ANOVA revealed a significant yohimbine × imipramine interaction in the 7 day treatment experiment [F(1,20) = 20.99, p = 0.0002]. Imipramine treatment by itself for 7 days showed no significant effect on hippocampal progenitor proliferation (Fig. 5C). These results indicate that co-administration of yohimbine with imipramine shortens the duration of antidepressant treatment required to increase adult hippocampal progenitor proliferation.

Figure 5
α2-adrenoceptor blockade results in faster effects of the antidepressant imipramine on adult hippocampal progenitor proliferation. Rats received combined treatment with the α2-adrenoceptor antagonist, yohimbine and the antidepressant imipramine ...

We also examined the effects of the above combined treatments for 7 or 21 days on the number of DCX-positive immature neurons in the SGZ/GCL. At 21 days, both the imipramine and combined yohimbine and imipramine treatment groups showed a significant increase in the number of DCX-positive cells/section (Fig. 5H, I). Two-way ANOVA revealed no significant yohimbine × imipramine interaction at 21 days [F(1,20) = 0.69, p = 0.42]. At 7 days, we did not observe a change in DCX-positive cell numbers in any of the groups (Fig. 5D, E). Although a change in DCX-positive cell number was not seen at 7 days after combined treatment, 14 days of yohimbine and imipramine co-administration resulted in a significant increase in DCX-positive cell number (14 Day combined yohimbine + imipramine experiment, Number of DCX positive cells/section: Control = 153.60 ± 16.02, Yohimbine = 154.43 ± 11.57, Imipramine = 154.60 ± 10.63, Yohimbine + Imipramine = 225.20 ± 14.96). Two-way ANOVA analysis indicated a significant yohimbine × imipramine interaction effect [F(1, 19) = 11.51, p = 0.0031] in the 14 day combined treatment experiment. The 14 day imipramine only treatment group did not show any change in DCX-positive cell number (Bonferroni post-hoc test, p>0.05). These results suggest that co-administration of yohimbine hastens the increase in immature neuron generation observed with imipramine treatment.

We next assessed whether short duration (7 days) combined yohimbine and imipramine treatment influenced the morphological maturation of DCX-positive immature neurons. DCX-positive neurons were subdivided into (1) those without tertiary dendrites (Fig. 6A), and (2) those bearing tertiary dendrites (Fig. 6B), as described previously (Wang et al., 2008). Combined treatment with yohimbine and imipramine for 7 days significantly enhanced the number of DCX-positive cells bearing complex, tertiary dendrites (Fig. 6C). Individual yohimbine or imipramine treatment had no significant effect on the morphology of DCX-positive cells (Fig. 6C). Two-way ANOVA indicated a significant yohimbine × imipramine interaction [F(1,15) = 7.52, p = 0.0151]. This effect was seen although no changes in DCX-positive cell number were observed with 7 day combined treatment (Fig. 5D, E), suggesting a shift in distribution of DCX-positive cells to those bearing a more complex morphology. Previous studies indicate that chronic (28 day), but not subchronic (5 day), antidepressant treatment enhances the dendritic maturation of immature newborn neurons (Wang et al., 2008). Our results indicate that combined yohimbine and imipramine administration shifts the effects of antidepressant treatment on morphological maturation to an earlier onset.

Figure 6
α2-adrenoceptor blockade accelerates the effect of the antidepressant imipramine on the morphological maturation of DCX positive cells and the number of NeuroD positive progenitors. Rats received combined treatment with the α2-adrenoceptor ...

We then addressed if the expression of NeuroD, a neurogenic transcription factor required for the survival and maturation of hippocampal progenitors (Gao et al., 2009), is altered in the SGZ following short duration yohimbine and imipramine treatment. The combined yohimbine and imipramine treated group showed a significant increase in the number of NeuroD-positive cells/section in the SGZ at the 7 day time point (Fig. 6D, E). Two-way ANOVA revealed a significant yohimbine × imipramine interaction [F(1,15) = 20.25, p = 0.0004]. Imipramine treatment by itself showed no significant effect on NeuroD positive cell number (Fig. 6E). A previous study indicates that chronic (14 day), but not subchronic (5 day), antidepressant treatment enhances NeuroD positive cell number in the SGZ/GCL (Larsen et al., 2007). Our results demonstrate that adjunct α2-adrenoceptor blockade accelerates the effects of imipramine on NeuroD positive progenitor number, and thus indicates that the increased numbers of hippocampal progenitors observed following combined treatment exhibit neuronal commitment.

To address if short duration yohimbine and imipramine treatment influences the developmental progression of newborn neurons we examined the percent colocalization of BrdU-positive cells with calretinin, a transient marker of immature neurons (Brandt et al., 2003). Drug-naive animals were subjected to a BrdU labeling paradigm (Supplementary Figure 3), following which they received 7 day combined yohimbine and imipramine treatment. Confocal analysis indicated a significant increase in the percent BrdU/calretinin colocalization in the combined yohimbine and imipramine treatment group, with no BrdU/calretinin colocalization observed in vehicle, yohimbine or imipramine treatment groups at this time point (Supplementary Figure 3). Two-way ANOVA indicated a significant yohimbine × imipramine interaction [F(1,16) = 6.77, p = 0.0019]. Taken together, the influence of combined yohimbine and imipramine treatment on DCX morphology, NeuroD positive cell number and BrdU/calretinin colocalization suggest that combination treatment influences the differentiation of newborn neurons within the adult hippocampal neurogenic niche.

To confirm whether the increase in BrdU-positive cell number that is observed with short duration (7 day) combined yohimbine and imipramine treatment results in eventual differentiation into neurons or glia, we carried out triple immunolabeling with BrdU, NeuN and GFAP. Confocal analysis revealed that most of the BrdU-positive cells 4 weeks later had differentiated into neurons with few taking on a glial phenotype. The percent distribution of BrdU cells that acquire a neuronal or glial fate was not altered across all the treatment groups at this time point (Fig. 7A, B).

Figure 7
Combined α2-adrenoceptor antagonist, yohimbine and antidepressant, imipramine treatment for 7 days results in an increase in adult hippocampal neurogenesis. Rats received BrdU at the end of the 7 days of combined treatment with yohimbine and imipramine, ...

Short duration combined yohimbine and imipramine treatment enhances hippocampal gene expression of BDNF, VEGF, FGF-2, VGF and Arc

As the next step we addressed whether short duration (7 day) combined yohimbine and imipramine treatment is sufficient to increase the hippocampal expression of trophic factors like BDNF, VEGF, and FGF-2 that are known to be enhanced only following longer duration (2-3 weeks) antidepressant treatment (Nibuya et al., 1995, Dias et al., 2003; Warner-Schmidt and Duman, 2007; Bachis et al., 2008). We also examined the influence of this treatment on the gene expression of the neuropeptide VGF, the immediate early gene Arc and the transcription factor CREB, which are regulated by chronic antidepressant treatment and contribute to antidepressant efficacy (Nibuya et al., 1996; Pei et al., 2003; Thakker-Varia et al., 2007; Molteni et al., 2008). We found that combined yohimbine and imipramine administration for 7 days resulted in a robust and significant increase (176 %) in BDNF mRNA in the dentate gyrus (DG) (Fig. 8A, B). Treatment with only yohimbine or imipramine for 7 days did not alter BDNF mRNA expression in the DG. Two-way ANOVA indicated a significant yohimbine × imipramine interaction [F(1,16) = 880.36, p < 0.0001]. 7 day combination treatment also significantly induced the mRNA expression of VEGF (79%; Fig. 8C, D) and FGF-2 (77%; Fig. 8E, F) in the DG. Yohimbine or imipramine treatments by themselves for 7 days did not alter VEGF or FGF-2 mRNA expression in the DG significantly. However, the two-way ANOVA analysis of the VEGF and FGF-2 data indicated no significant yohimbine × imipramine interaction [VEGF: F(1,13) = 0.66, p = 0.43; FGF-2: F(1,12) = 2.09, p = 0.17].

Figure 8
Short duration combined yohimbine and imipramine treatment for 7 days upregulates the mRNA expression of plasticity associated genes like BDNF, VEGF, FGF-2, VGF and Arc in the dentate gyrus. Rats received treatment with the α2-adrenoceptor antagonist, ...

Further, the short duration (7 day) combined treatment of yohimbine and imipramine significantly upregulated (30%) the mRNA expression of the neuropeptide VGF in the DG (Fig. 8G, H). 7 days of treatment with imipramine alone was also sufficient to induce a significant increase (19%) in VGF expression. Two-way ANOVA analysis of a yohimbine × imipramine interaction indicated a trend towards significance [F(1,12) = 3.89, p = 0.0721]. Interestingly, 7 day combined yohimbine and imipramine treatment also resulted in a highly robust increase (~5 fold) in the mRNA expression of the immediate early gene Arc within the DG (Fig. 8I, J). No change in Arc mRNA levels was observed with individual yohimbine or imipramine treatment for 7 days. Two-way ANOVA revealed a significant yohimbine × imipramine interaction [F(1,16) = 6894.33, p < 0.0001]. In contrast to the effects seen with trophic factors, the neuropeptide VGF and the immediate early gene Arc, combined yohimbine and imipramine treatment did not alter CREB mRNA expression in the DG (Fig. 8K, L).

To address whether short duration (7 day) combined yohimbine and imipramine treatment changes hippocampal norepinephrine levels we carried out HPLC analysis. Hippocampal levels of norepinephrine in all treatment groups were found to be indistinguishable from vehicle treated controls (Level of NE (ng/gm tissue weight) in the hippocampus: Vehicle = 303.57 ± 23.35, Yohimbine = 256.76 ± 10.99, Imipramine = 254.22 ± 13.68, Yohimbine + Imipramine = 257.30 ± 16.54).

α2-adrenoceptor blockade accelerates the behavioral effects of the antidepressant imipramine in the novelty suppressed feeding test

Given the effects of short duration (7 day) combined yohimbine and imipramine treatment on hippocampal neurogenesis and gene expression of plasticity associated genes, we asked whether this short duration combined treatment is also capable of inducing a behavioral response in the novelty suppressed feeding (NSF) test (Fig. 9A) that has been previously shown to be responsive to chronic (2-3 weeks), but not acute, antidepressant administration (Bodnoff et al., 1988; Santarelli et al., 2003). Following 21 days of treatment, we observed a significant reduction in the latency to feed in both the group that received just the antidepressant, imipramine, as well as the group that received the combination treatment with yohimbine and imipramine, with no significant effect of only yohimbine treatment (Fig. 9C). In contrast, we observed a significant reduction in the latency to feed only in the group that received a combination treatment with both yohimbine and imipramine in the short (7 days) duration experiment (Fig. 9B). Two-way ANOVA analysis of the 7 day experiment revealed a significant yohimbine × imipramine interaction [F(1,36) = 4.93, p = 0.0328]. To control for effects of drug treatments on appetite, we also assessed home cage food consumption immediately following the NSF test. Food consumption in the home-cage was found to be unaltered across all the treatment groups (Home cage food consumption -7 day experiment (gms/30 minutes): Vehicle = 5.14 ± 0.34, Yohimbine = 5.28 ± 0.25, Imipramine = 4.43 ± 0.62, Yohimbine + Imipramine = 4.54 ± 0.80). Taken together, these results suggest that a short duration (7 day) combination treatment with yohimbine and imipramine reduces the time lag to observe a behavioral response in the NSF test.

Figure 9
α2-adrenoceptor blockade hastens the effects of the antidepressant imipramine on behavior in the novelty suppressed feeding (NSF) test. Rats received combined treatment with the α2-adrenoceptor antagonist, yohimbine and the antidepressant ...


The novel findings of our study are that α2-adrenoceptor stimulation decreases adult hippocampal neurogenesis, while simultaneous α2-adrenoceptor blockade and antidepressant treatment hastens effects on hippocampal neurogenesis, plasticity-associated gene expression, and depression-related behavior. Our results highlight the importance of α2-adrenoceptors as targets for rapid-action antidepressants.

Adult hippocampal neurogenesis encompasses progenitor proliferation, survival and differentiation resulting in newborn neuron integration into hippocampal circuitry (Ming and Song, 2005). The hippocampal neurogenic niche receives dense noradrenergic innervation, expresses all the different classes of adrenoceptors, and hippocampal progenitor proliferation is stimulated by norepinephrine (Nicholas et al., 1996; Kulkarni et al., 2002; Jhaveri and Bartlett, personal communication). Paradoxically, we found that α2-adrenoceptor stimulation in vivo decreases hippocampal progenitor proliferation. α2-adrenoceptors exist both as heteroceptors on target neurons receiving noradrenergic innervation, and as α2-autoreceptors that decrease norepinephrine release. Our in vitro and in vivo findings support a role for α2-heteroceptors in mediating the effects on adult hippocampal progenitor turnover. First, we provide evidence that dispersed adult hippocampal progenitors in culture express the α2-adrenoceptor subtypes, and exhibit decreased BrdU-incorporation following α2-adrenoceptor stimulation. Second, α2-adrenoceptor agonists significantly reduce neurosphere frequency in the neurosphere assay indicating a direct effect on the turnover of adult neural stem cells. Finally, our in vivo finding that this decreased proliferation persists in Dbh −/− mice indicates an effect on hippocampal progenitor proliferation via α2-heteroceptors. While α2-adrenoceptor stimulation selectively influences the proliferation, but not the survival or differentiation of hippocampal progenitors; α2-adrenoceptor blockade does not influence hippocampal neurogenesis. Our results differ from a previous study (Rizk et al., 2006) that reported enhanced progenitor survival following long duration treatment with the α2-adrenoceptor antagonist dexefaroxan. This discrepancy may be a consequence of differences in drug choice, dose, route of administration or treatment duration. We also did not observe any change in progenitor proliferation or immature neuron number in α2A, α2C and α2AC-adrenoceptor knockout mice. Taken together, our results indicate that α2-adrenoceptors exert a stimulation-induced, but not a basal tonic, inhibitory effect on adult hippocampal progenitor turnover.

Interestingly, α2-adrenoceptors are expressed within proliferative germinal zones, and their stimulation decreases DNA synthesis in the developing forebrain (Lidow and Rakic, 1994; Kreider et al., 2004) suggesting possible common mechanisms in the developing and adult brain. Given that cAMP-CREB signaling enhances adult hippocampal neurogenesis (Nakagawa et al., 2002), α2-adrenoceptor activation may decrease progenitor turnover through a Gi-mediated inhibition of adenylate cyclase. The mechanistic underpinnings of the effects of α2-adrenoceptors on adult hippocampal progenitors warrant further investigation.

Hippocampal volumetric loss is observed in recurrent major depression, and decreased neurogenesis reported in animal models of depression (Campbell et al., 2004; Sahay and Hen, 2007). Enhanced α2-adrenoceptor density and mRNA expression within limbic brain regions is observed in animal models of depression (Ribas et al., 2001; Flugge et al., 2003). Further, increased hippocampal α2-adrenoceptor binding (Meana et al., 1992; González et al., 1994) and prefrontal α2A-adrenoceptor immunoreactivity (Garcia-Sevilla et al., 1999) have been observed in postmortem studies of major depression. While it remains uncertain whether the changes in α2-adrenoceptor binding reflect alterations in terminal α2-autoreceptors or α2-heteroceptors in target fields, the mRNA expression changes indicate enhanced expression of α2-heteroceptors in limbic neurocircuitry following chronic stress. Our results suggest a possible role for α2-heteroceptors in the neurogenic decline observed in animal models of depression.

The “neurotrophic” and “neurogenic” hypotheses of depression posit a role for decreased trophic support and neurogenesis in the hippocampal damage observed in depression, and a contribution of antidepressant induced trophic factor expression and hippocampal neurogenesis to their therapeutic action (Sahay and Hen, 2007; Schmidt and Duman, 2007). It is noteworthy that the neurotrophic and neurogenic changes exhibit a slow onset, and parallel the time course required for the behavioral benefits of sustained antidepressant administration (Sahay and Hen, 2007; Schmidt and Duman, 2007). One of our most interesting and novel findings is that α2-adrenoceptor blockade accelerates the effects of chronic antidepressant treatment on hippocampal neurogenesis and trophic factor gene expression associated with faster behavioral effects.

Combined 7 day yohimbine and imipramine (Y+I) treatment significantly improved behavioral outcome in the NSF test, which is normally sensitive only to longer periods (3 weeks) of antidepressant treatment (Santarelli et al., 2003). Y+I treatment also increased hippocampal progenitor proliferation and NeuroD-positive neuroblast number within 7 days, an effect not observed with imipramine treatment alone. Further, a striking shift in the distribution of DCX-positive cells to those bearing complex, tertiary dendritic morphology was observed in the 7 day Y+I group. Enhanced BrdU/calretinin percent colocalization observed at 7 days in the Y+I group suggests an influence on the developmental progression of immature neurons. Taken together, our results indicate that simultaneous α2-adrenoceptor blockade hastens effects of antidepressant treatment on distinct aspects of adult hippocampal neurogenesis.

It is unlikely that increased progenitor proliferation contributes to the behavioral effects observed with 7 day Y+I treatment; rather our observation of effects on the morphological complexity of DCX-positive cells suggest that the integration of immature neurons into hippocampal neurocircuitry may be accelerated. It is tempting to speculate that this component of the neurogenic effects of 7 day Y+I treatment may contribute to the rapid rate of behavioral response. Future experiments are required to address whether 7 day Y+I treatment accelerates the differentiation, integration and recruitment of newborn neurons into hippocampal circuitry. Interestingly, 21 day Y+I treatment increased progenitor proliferation and DCX-positive cell number to a similar extent as imipramine treatment alone, suggesting that combined treatment may largely involve acceleration, rather than augmentation, of the neurogenic effects of imipramine.

Seven day Y+I treatment increased BDNF, VEGF and FGF-2 mRNA expression in the DG subfield, an effect not observed with imipramine treatment. The combined treatment also enhanced VGF expression, an effect also observed with imipramine treatment. The effects of Y+I do not appear simply additive, and suggest the possible recruitment of distinct signaling mechanisms. The robust increase in the expression of the activity-dependent gene Arc (Bramham et al., 2008) in the DG subfield indicates enhanced neuronal activity following Y+I treatment. It is interesting to note that enhanced DG activity as measured by voltage sensitive dye imaging has been previously strongly linked to antidepressant-induced neurogenic and behavioral responses (Airan et al., 2007). Neuronal activity is known to recruit latent stem/progenitor cells in the adult hippocampus, and enhance trophic factor expression (Gall and Lauterborn, 1997; Walker et al., 2008). Trophic factors could serve to link neuronal activity to structural plasticity in the hippocampal neurogenic niche. Our results also raise the strong possibility that non-cell autonomous effects via enhanced neuronal activity and trophic factor release may also contribute to the neurogenic effects of Y+I treatment. Further, BDNF, FGF-2, VEGF and VGF are implicated as key mediators of both the neurogenic and behavioral effects of antidepressants (Palmer et al., 1999; Warner-Schmidt et al., 2007; Bachis et al., 2008; Li et al., 2008; Thakker-Varia et al., 2008; Perez et al., 2009), and may play a critical role in mediating faster effects on neurogenesis and behavior with 7 day Y+I treatment.

Prior clinical literature has suggested the coadministration of α2-adrenoceptor antagonists with antidepressants as a therapeutic strategy to hasten antidepressant responses (Blier, 2003). The mode of action for these faster effects has been unclear. Our results suggest that adjunct α2-adrenoceptor antagonists accelerate the effects of antidepressant treatment on the slow-onset adaptive changes in neurogenesis and trophic factor expression that are thought to underlie the behavioral effects of antidepressants. Our findings support the view that structural remodeling and enhanced trophic support may be key events determining the latency in onset of antidepressant action. At present, we cannot distinguish whether blockade of α2-autoreceptors or heteroceptors, or a combination of both, contribute to the faster effects of Y+I treatment. It has been suggested that concomitant blockade of inhibitory presynaptic α2-autoreceptors would increase noradrenergic neurotransmission, whereas in the absence of such a blockade a desensitization/downregulation of presynaptic α2-adrenoceptors would have to precede an increase in noradrenergic neurotransmission, thus contributing to the delay in antidepressant action (Blier, 2003). It is possible that we observed faster effects with Y+I treatment due to the blockade of inhibitory α2-autoreceptors, or heteroceptors on serotonergic neurons, thus enhancing noradrenergic and serotonergic neurotransmission. Our failure to observe a change in hippocampal norepinephrine levels following 7 day Y+I treatment does not rule out possible autoreceptor effects, particularly since we measured tissue norepinephrine levels, which are not always correlated with extracellular norepinephrine that is available for signaling. Future studies using genetic perturbation approaches will be required to dissect out the contribution of α2-autoreceptors and heteroceptors to the faster effects of adjunct α2-adrenoceptor antagonist and antidepressant treatment.

In conclusion, we demonstrate that α2-adrenoceptor stimulation decreases adult hippocampal neurogenesis, while concomitant α2-adrenoceptor blockade accelerates the neurogenic, neurotrophic and behavioral effects of chronic antidepressant treatment. The delayed onset of action of antidepressants is a major drawback for both treatment and compliance. Our results highlight the importance of α2-adrenoceptors in modulating the speed of antidepressant response, and motivate future research in the development of rapid-action antidepressants that target the α2-adrenoceptor.

Figure 10
Short duration (7 days) combined treatment with the α2-adrenoceptor antagonist, yohimbine and the antidepressant, imipramine treatment hastens the effects of antidepressant treatment on adult hippocampal progenitor proliferation, morphological ...

Supplementary Material



This work was supported by a Wellcome Trust Senior Overseas Fellowship in Biomedical sciences to VV (04082003114133). We acknowledge Dr. Ranjith Vijayakumar for technical assistance and Amrita Nair for assistance with the artwork. We thank Dainippon-Sumitomo Pharma Co. Ltd. (Osaka, Japan) for their generous donation of DOPS used to breed the Dbh −/− mice.


  • Airan RD, Meltzer LA, Roy M, Gong Y, Chen H, Deisseroth K. High-speed imaging reveals neurophysiological links to behavior in an animal model of depression. Science. 2007;317(5839):819–823. [PubMed]
  • Altman JD, Trendelenburg AU, MacMillan L, Bernstein D, Limbird L, Starke K, Kobilka BK, Hein L. Abnormal regulation of the sympathetic nervous system in alpha2A-adrenergic receptor knockout mice. Mol Pharmacol. 1999;56(1):154–161. [PubMed]
  • Andrade C, Sudha S. Electroconvulsive therapy and the alpha-2 noradrenergic receptor: Implications of treatment schedule effects. J ECT. 2000;16(3):268–278. [PubMed]
  • Bachis A, Mallei A, Cruz MI, Wellstein A, Mocchetti I. Chronic antidepressant treatments increase basic fibroblast growth factor and fibroblast growth factor-binding protein in neurons. Neuropharmacology. 2008;55(7):1114–1120. [PMC free article] [PubMed]
  • Blier P. The pharmacology of putative early-onset antidepressant strategies. Eur Neuropsychopharm. 2003;13:57–66. [PubMed]
  • Bodnoff SR, Suranyi-Cadotte B, Aitken DH, Quirion R, Meaney MJ. The effects of chronic antidepressant treatment in an animal model of anxiety. Psychopharmacology (Berl) 1988;95(3):298–302. [PubMed]
  • Bortolozzi A, Artigas F. Control of 5-hydroxytryptamine release in the dorsal raphe nucleus by the noradrenergic system in rat brain. Role of alpha-adrenoceptors. Neuropsychopharmacology. 2003;28(3):421–434. [PubMed]
  • Bramham CR, Worley PF, Moore MJ, Guzowski JF. The immediate early gene arc/arg3.1: regulation, mechanisms, and function. J Neurosci. 2008;28(46):11760–11767. [PMC free article] [PubMed]
  • Brandt MD, Jessberger S, Steiner B, Kronenberg G, Reuter K, Bick-Sander A, von der Behrens W, Kempermann G. Transient calretinin expression defines early postmitotic step of neuronal differentiation in adult hippocampal neurogenesis of mice. Mol Cell Neurosci. 2003;24(3):603–613. [PubMed]
  • Callado LF, MEana JJ, Grijalva B, Pazos A, Sastre M, Garcia-Sevilla JA. Selective increase in alpha-2A-adrenoceptor agonist binding sites in brains of depressed suicide victims. J Neurochem. 1998;70:1114–1123. [PubMed]
  • Cameron HA, McKay RD. Adult neurogenesis produces a large pool of new granule cells in the dentate gyrus. J Comp Neurol. 2001;435(4):406–417. [PubMed]
  • Campbell S, Marriott M, Nahmias C, Macqueen GM. Lower hippocampal volume in patients suffering from depression: a meta analysis. Am J Psychiatry. 2004;161:598–607. [PubMed]
  • Carpenter LL, Yasmin S, Price LH. A double-blind, placebo controlled study of antidepressant augmentation with mirtazapine. Biol Psychiatry. 2002;51:183–188. [PubMed]
  • Daly JJ, Prudic J, Devanand DP, Nobler MS, Lisanby SH, Peyser S, Roose SP, Sackeim HA. ECT in bipolar and unipolar depression: differences in speed of response. Bipolar Disord. 2001;3:95–104. [PubMed]
  • Dias BG, Banerjee SB, Duman RS, Vaidya VA. Differential regulation of brain derived neurotrophic factor transcripts by antidepressant treatments in the adult rat brain. Neuropharmacology. 2003;45(4):553–563. [PubMed]
  • Dunbar AY, Jenkins GJ, Jianmongkol S, Nakatsuka M, Lowe ER, Lau M, Osawa Y. Tetrahydrobiopterin protects against guanabenz-mediated inhibition of neuronal nitric-oxide synthase in vitro and in vivo. Drug Metab Dispos. 2006;34(9):1448–1456. [PubMed]
  • Dursun SM, Handley SL. The effects of alpha 2-adrenoceptor antagonists on the inhibition of 1-(2,5-dimethoxy-4-iodophenyl)-2-aminopropane (DOI)-induced head shakes by 5-HT1A receptor agonists in the mouse. Br J Pharmacol. 1993;109(4):1046–1052. [PMC free article] [PubMed]
  • Esteban S, Llado J, Sastre-Coll A, Garcia-Sevilla JA. Activation and desensitization by cyclic antidepressant drugs of α2-autoreceptors, α2-heteroreceptors and 5-HT1A-autoreceptors regulating monoamine synthesis in the rat brain in vivo. Naunyn-Schmiedeberg's Arch Pharmacol. 1999;360:135–143. [PubMed]
  • Faber JE, Yang N, Xin X. The structure of the coliphage HK022 Nun protein-lambda-phage boxB RNA complex. Implications for the mechanism of transcription termination. J Pharmacol Exp Ther. 2001;298(2):441–452. [PubMed]
  • Flügge G, van Kampen M, Meyer H, Fuchs E. Alpha2A and alpha2C-adrenoceptor regulation in the brain: alpha2A changes persist after chronic stress. Eur J Neurosci. 2003;17(5):917–928. [PubMed]
  • Fulford AJ, Butler S, Heal DJ, Kendall DA, Marsden CA. Evidence for altered α2-adrenoceptor function following isolation rearing in the rat. Psychopharmacology. 1994;116:183–190. [PubMed]
  • Gall C, Lauterborn J. The dentate gyrus: a model system for studies of neurotrophin regulation. Epilepsy Res Suppl. 1997;7:171–185. [PubMed]
  • Gao Z, Ure K, Ables JL, Lagace DC, Nave KA, Goebbels S, Eisch AJ, Hsieh J. Neurod1 is essential for the survival and maturation of adult-born neurons. Nat Neurosci. 2009;12(9):1090–1092. [PMC free article] [PubMed]
  • Garcia-Sevilla JA, Escriba PV, Ozaita A, La Harpe R, Walter C, Eytan A, Guimón J. Up-regulation of immunolabeled α2a-adrenoceptors, Gi coupling proteins and regulatory receptor kinases in the prefrontal cortex of depressed suicides. J Neurochem. 1999;72:282–291. [PubMed]
  • García-Vallejo P, Gómez FM, Infante C, Ginestal E, Giralt MT. Chronic variable stress induces supersensitivity of central alpha2-adrenoceptors which modulate the jaw-opening reflex in the rat. Brain Res. 1998;801(1-2):72–77. [PubMed]
  • Gobert A, Di Cara B, Cistarelli L, Millan MJ. Piribedil enhances frontocortical and hippocampal release of acetylcholine in freely moving rats by blockade of alpha 2A-adrenoceptors: a dialysis comparison to talipexole and quinelorane in the absence of acetylcholinesterase inhibitors. J Pharmacol Exp Ther. 2003;305(1):338–346. [PubMed]
  • González AM, Pascual J, Meana JJ, Barturen F, del Arco C, Pazos A, García-Sevilla JA. Autoradiographic demonstration of increased alpha 2-adrenoceptor agonist binding sites in the hippocampus and frontal cortex of depressed suicide victims. J Neurochem. 1994;63(1):256–265. [PubMed]
  • Han SK, Park JR, Park SA, Chun SW, Lee JC, Lee SY, Ryu PD, Park SJ. Noradrenaline inhibits substantia gelatinosa neurons in mice trigeminal subnucleus caudalis via alpha(2) and beta adrenoceptors. Neurosci Lett. 2007;411(2):92–97. [PubMed]
  • Hein L, Altman JD, Kobilka BK. Two functionally distinct alpha2-adrenergic receptors regulate sympathetic neurotransmission. Nature. 1999;402(6758):181–184. [PubMed]
  • Jha S, Rajendran R, Davda J, Vaidya VA. Selective serotonin depletion does not regulate hippocampal neurogenesis in the adult rat brain: differential effects of p-chlorophenylalanine and 5,7-dihydroxytryptamine. Brain Res. 2006;1075(1):48–59. [PubMed]
  • Kreider ML, Seidler FJ, Cousins MM, Tate CA, Slotkin TA. Transiently overexpressed α2-adrenoceptors and their control of DNA synthesis in the developing brain. Dev Brain Res. 2004;152:233–239. [PubMed]
  • Krishnan V, Nestler EJ. The molecular neurobiology of depression. Nature. 2008;455(7215):894–902. [PMC free article] [PubMed]
  • Kulkarni VA, Jha S, Vaidya VA. Depletion of norepinephrine decreases the proliferation, but does not influence the survival and differentiation, of granule cell progenitors in the adult rat hippocampus. Eur J Neurosci. 2002;16(10):2008–2012. [PubMed]
  • Lakshmana MK, Raju TR. An isocratic assay for norepinephrine, dopamine, and 5-hydroxytryptamine using their native fluorescence by high-performance liquid chromatography with fluorescence detection in discrete brain areas of rat. Anal Biochem. 1997;246(2):166–170. [PubMed]
  • Larsen MH, Rosenbrock H, Sams-Dodd F, Mikkelsen JD. Expression of brain derived neurotrophic factor, activity-regulated cytoskeleton protein mRNA, and enhancement of adult hippocampal neurogenesis in rats after sub-chronic and chronic treatment with the triple monoamine re-uptake inhibitor tesofensine. Eur J Pharmacol. 2007;555(2-3):115–121. [PubMed]
  • Li Y, Luikart BW, Birnbaum S, Chen J, Kwon CH, Kernie SG, Bassel-Duby R, Parada LF. TrkB regulates hippocampal neurogenesis and governs sensitivity to antidepressive treatment. Neuron. 2008;59(3):399–412. [PMC free article] [PubMed]
  • Lidow M, Rakic P. Unique profiles of the α1-, α2-, and β – adrenergic receptors in the developing cortical plate and transient embryonic zones of the rhesus monkey. J Neurosci. 1994;14:4064–4078. [PubMed]
  • Malberg JE, Eisch AJ, Nestler EJ, Duman RS. Chronic antidepressant treatment increases neurogenesis in adult rat hippocampus. J Neurosci. 2000;20(24):9104–9110. [PubMed]
  • Meana JJ, Barturen F, García-Sevilla JA. Alpha 2-adrenoceptors in the brain of suicide victims: increased receptor density associated with major depression. Biol Psychiatry. 1992;31(5):471–490. [PubMed]
  • Ming GL, Song H. Adult neurogenesis in the mammalian central nervous system. Annu Rev Neurosci. 2005;28:223–250. [PubMed]
  • Molteni R, Calabrese F, Mancini M, Racagni G, Riva MA. Basal and stress-induced modulation of activity-regulated cytoskeletal associated protein (Arc) in the rat brain following duloxetine treatment. Psychopharmacology (Berl) 2008;201(2):285–292. [PubMed]
  • Mori K, Ozaki E, Zhang B, Yang L, Yokoyama A, Takeda I, Maeda N, Sakanaka M, Tanaka J. Effects of norepinephrine on rat cultured microglial cells that express alpha1, alpha2, beta1 and beta2 adrenergic receptors. Neuropharmacology. 2002;43(6):1026–1034. [PubMed]
  • Nakagawa S, Kim J, Lee R, Malberg JE, Chen J, Steffen C, Zhang Y, Nestler EJ, Duman RS. Regulation of neurogenesis in adult mouse hippocampus by cAMP and the cAMP response element-binding protein. J Neurosci. 2002;22:3673–3682. [PubMed]
  • Nair A, Vadodaria KC, Banerjee SB, Benekareddy M, Dias BG, Duman RS, Vaidya VA. Stressor-specific regulation of distinct brain-derived neurotrophic factor transcripts and cyclic AMP response element-binding protein expression in the postnatal and adult rat hippocampus. Neuropsychopharmacology. 2007;32(7):1504–1519. [PubMed]
  • Nair SG, Gray SM, Ghitza UE. Role of food type in yohimbine- and pellet-priming-induced reinstatement of food seeking. Physiol Behav. 2006;88(4-5):559–566. [PMC free article] [PubMed]
  • Nibuya M, Morinobu S, Duman RS. Regulation of BDNF and trkB mRNA in rat brain by chronic electroconvulsive seizure and antidepressant drug treatments. J Neurosci. 1995;15(11):7539–7547. [PubMed]
  • Nibuya M, Nestler EJ, Duman RS. Chronic antidepressant administration increases the expression of cAMP response element binding protein (CREB) in rat hippocampus. J Neurosci. 1996;16(7):2365–2372. [PubMed]
  • Nicholas AP, Hokfelt T, Pieribone VA. The distribution and significance of CNS adrenoceptors examined with in situ hybridization. Trends Pharmacol Sci. 1996;17:245–255. [PubMed]
  • Ortego J, Coca-Prados M. Molecular identification and coexpression of galanin and GalR-1 galanin receptor in the human ocular ciliary epithelium: differential modulation of their expression by the activation of alpha2- and beta2-adrenergic receptors in cultured ciliary epithelial cells. J Neurochem. 1998;71(6):2260–2270. [PubMed]
  • Palmer TD, Markakis EA, Willhoite AR, Safar F, Gage FH. Fibroblast growth factor-2 activates a latent neurogenic program in neural stem cells from diverse regions of the adult CNS. J Neurosci. 1999;19(19):8487–8497. [PubMed]
  • Pei Q, Zetterström TS, Sprakes M, Tordera R, Sharp T. Antidepressant drug treatment induces Arc gene expression in the rat brain. Neuroscience. 2003;121(4):975–982. [PubMed]
  • Perez JA, Clinton SM, Turner CA, Watson SJ, Akil H. A new role for FGF2 as an endogenous inhibitor of anxiety. J Neurosci. 2009;29(19):6379–6387. [PMC free article] [PubMed]
  • Quitkin FM, Taylor BP, Kremer C. Does mirtazapine have a more rapid onset than SSRI's? J Clin Psychiatry. 2001;62:358–361. [PubMed]
  • Ribas C, Miralles A, Busquets X, Garcia-Sevilla JA. Brain α2-adrenoceptors in monoamine-depleted rats: increased receptor density, G coupling proteins, receptor turnover and receptor mRNA. Brit J Pharmacol. 2001;132:1467–1476. [PMC free article] [PubMed]
  • Rizk P, Salazar J, Raisman-Vozari R, Marien M, Ruberg M, Colpaert F, Debeir T. The alpha2-adrenoceptor antagonist dexefaroxan enhances hippocampal neurogenesis by increasing the survival and differentiation of new granule cells. Neuropsychopharmacology. 2006;31(6):1146–1157. [PubMed]
  • Sanacora G, Berman RM, Cappiello A, Oren DA, Kugaya A, Liu N, Gueorguieva R, Fasula D, Charney DS. Addition of the α2-antagonist yohimbine to fluoxetine: Effects on rate of antidepressant response. Neuropsychopharmacology. 2004;29:1166–1171. [PubMed]
  • Sahay A, Hen R. Adult hippocampal neurogenesis in depression. Nat Neurosci. 2007;10(9):1110–1115. [PubMed]
  • Sairanen M, Lucas G, Ernfors P, Castrén M, Castrén E. Brain-derived neurotrophic factor and antidepressant drugs have different but coordinated effects on neuronal turnover, proliferation, and survival in the adult dentate gyrus. J Neurosci. 2005;25(5):1089–1094. [PubMed]
  • Santarelli L, Saxe M, Gross C, Surget A, Battaglia F, Dulawa S, Weisstaub N, Lee J, Duman R, Arancio O, Belzung C, Hen R. Requirement of hippocampal neurogenesis for the behavioral effects of antidepressants. Science. 2003;301(5634):805–809. [PubMed]
  • Schank JR, Ventura R, Puglisi-Allegra S, Alcaro A, Cole CD, Liles LC, Seeman P, Weinshenker D. Dopamine beta-hydroxylase knockout mice have alterations in dopamine signaling and are hypersensitive to cocaine. Neuropsychopharmacology. 2006;31(10):2221–2230. [PubMed]
  • Schmidt HD, Duman RS. The role of neurotrophic factors in adult hippocampal neurogenesis, antidepressant treatments and animal models of depressive-like behavior. Behav Pharmacol. 2007;18(5-6):391–418. [PubMed]
  • Shirayama Y, Chen AC, Nakagawa S, Russell DS, Duman RS. Brain-derived neurotrophic factor produces antidepressant effects in behavioral models of depression. J Neurosci. 2002;22(8):3251–3261. [PubMed]
  • Szot P, Lester M, Laughlin ML, Palmiter RD, Liles LC, Weinshenker D. The anticonvulsant and proconvulsant effects of alpha2-adrenoreceptor agonists are mediated by distinct populations of alpha2A-adrenoreceptors. Neuroscience. 2004;126(3):795–803. [PubMed]
  • Szot P, Weinshenker D, White SS, Robbins CA, Rust NC, Schwartzkroin PA, Palmiter RD. Norepinephrine-deficient mice have increased susceptibility to seizure-inducing stimuli. J Neurosci. 1999;19(24):10985–10992. [PubMed]
  • Thakker-Varia S, Krol JJ, Nettleton J, Bilimoria PM, Bangasser DA, Shors TJ, Black IB, Alder J. The neuropeptide VGF produces antidepressant-like behavioral effects and enhances proliferation in the hippocampus. J Neurosci. 2007;27(45):12156–12167. [PMC free article] [PubMed]
  • Thomas SA, Matsumoto AM, Palmiter RD. Noradrenaline is essential for mouse fetal development. Nature. 1995;374(6523):643–646. [PubMed]
  • Thomas SA, Palmiter RD. Examining adrenergic roles in development, physiology, and behavior through targeted disruption of the mouse dopamine beta-hydroxylase gene. Adv Pharmacol. 1998;42:57–60. [PubMed]
  • Thompson C. Onset of action of antidepressants: results of different analyses. Hum Psychopharmacol. 2002;17(Suppl 1):S27–32. [PubMed]
  • Walker TL, White A, Black DM, Wallace RH, Sah P, Bartlett PF. Latent stem and progenitor cells in the hippocampus are activated by neural excitation. J Neurosci. 2008;28(20):5240–5247. [PubMed]
  • Wang JW, David DJ, Monckton JE, Battaglia F, Hen R. Chronic fluoxetine stimulates maturation and synaptic plasticity of adult-born hippocampal granule cells. J Neurosci. 2008;28(6):1374–1384. [PubMed]
  • Warner-Schmidt JL, Duman RS. VEGF is an essential mediator of the neurogenic and behavioral actions of antidepressants. Proc Natl Acad Sci U S A. 2007;104(11):4647–4652. [PubMed]
  • Weinshenker D, Miller NS, Blizinsky K, Laughlin ML, Palmiter RD. Mice with chronic norepinephrine deficiency resemble amphetamine-sensitized animals. Proc Natl Acad Sci U S A. 2002;99(21):13873–13877. [PubMed]