PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of aacPermissionsJournals.ASM.orgJournalAAC ArticleJournal InfoAuthorsReviewers
 
Antimicrob Agents Chemother. 2010 June; 54(6): 2699–2703.
Published online 2010 April 5. doi:  10.1128/AAC.01624-09
PMCID: PMC2876422

Molecular Characterization of β-Lactamase Genes and Their Genetic Structures in Acinetobacter Genospecies 3 Isolates in Taiwan[down-pointing small open triangle]

Abstract

The genetic structure of β-lactamases in Acinetobacter genospecies 3 (AG3) isolates in Taiwan was studied to analyze their high rates of resistance to β-lactams, including carbapenems (57.9%). blaIMP-1 and blaIMP-8 were located in a class 1 integron. blaOXA-58 was bracketed by ISAba3. A novel TnpF-like integrase gene was identified upstream of blaVEB-3. Adjacent to the 5′ sequence of the blaADC gene, folE was identified. Four new Acinetobacter-derived cephalosporinase (ADC) enzymes were found, which clustered phylogenetically with published AG3 ADC proteins.

Acinetobacter genospecies 3 (AG3), belonging to the A. calcoaceticus-A. baumannii complex, exists in the natural environment and the clinical setting. It was reported to be the most frequently isolated Acinetobacter species in Hong Kong, Sweden, and Ireland (3, 4, 32). Carbapenem-resistant or multidrug-resistant (MDR) AG3 has been found globally in the past decade (3, 12, 18, 20, 36).

In Acinetobacter spp., β-lactamases are the most common contributors to resistance to extended-spectrum cephalosporins and carbapenems, including extended-spectrum β-lactamases (ESBL), metallo-β-lactamases (MBL), carbapenem-hydrolyzing class D β-lactamases (CHDL), and Acinetobacter-derived cephalosporinases (ADC) (24, 27). Mobile genetic elements, including insertion sequences (IS) and integrons, may contribute to β-lactamase overproduction and dissemination (26, 31). Several carbapenemases (IMP-1, IMP-4, VIM-2, OXA-23, and OXA-58) and versatile AmpC cephalosporinases (ADC-12 to ADC-23) have been found in AG3 (2, 3, 12, 20, 22, 36) but with few studies on their genetic support to elucidate possible transmission mechanisms.

Nineteen AG3 clinical isolates were collected from three hospitals in Taiwan from 1999 to 2007 and were identified using the API 32GN kit (bioMerieux, Marcy-l'Etoile, France) and recA and rpoB sequencing (15, 16). Sixteen distinct pulsotypes were identified among the isolates, and each blood isolate displayed a different pulsotype, indicating nonclonal relatedness.

The MICs of antimicrobials were determined using the broth microdilution method, except the MIC of sulbactam, which was determined with agar dilution method (5). More than half of AG3 isolates were resistant to the β-lactams tested (57.9 to 94.7%), including carbapenems (57.9%), and all were susceptible to sulbactam, tigecycline, and colistin (Table (Table1).1). Fifteen isolates (78.9%) were resistance to ≥3 classes of antibiotics that were potentially effective against the Acinetobacter spp. and were classified as MDR AG3 (9). In this study, sulbactam, tigecycline, and colistin reveal their roles as effective agents for AG3, which is similar to the situation for carbapenem-resistant A. baumannii (19).

TABLE 1.
Antimicrobial susceptibility testing results for Acinetobacter genospecies 3 isolates from three medical centers in Taiwand

The β-lactamases and resistance determinants were detected by PCR (8, 13, 14, 20, 28, 30, 31, 34, 35), including Ambler class A ESBL genes (blaTEM, blaSHV, blaCTX-M, blaVEB, and blaPER), Amber class B MBL genes (blaIMP, blaVIM, blaGIM, blaSPM, and blaSIM), an Amber class C AmpC β-lactamase genes (blaADC), Amber class D carbapenemase genes (blaOXA-23-like, blaOXA24-like, blaOXA-51-like, and blaOXA-58-like), integrase genes (intI1, intI2, and intI3), IS elements (ISAba1, ISAba2, ISAba3, and IS18), transposase genes, and a putative replicase gene, repAci1. IS1008 was studied using the primers ATGGCATCAGCTATCGTG and CCTGTGCTCAATATCTACTGGA, and the putative TnpF-like integrase gene, identified in this study, was investigated with the primers GCAGACAGCTCTATCGTTAAAG and TTTGTATCACCTTCCTGCTG. The PCR amplification results showed that one isolate contained blaVEB (isolate 3), 11 harbored both blaIMP (10 had IMP-1 and 1 had IMP-8) and blaOXA-58-like, and all had blaADC. Twelve isolates (63.2%) harbored the class 1 integron but none had the class 2 or 3 integron. Eleven isolates (57.9%) had insertion sequence ISAba1, 3 (15.8%) had ISAba2, 18 (94.7%) had ISAba3, 2 (10.5%), had IS18, and 14 (73.7%) had IS1008. repAci1 was detected in one blaOXA-58-like-positive isolate and one blaOXA-58-like-negative isolate. The TnpF-like integrase gene was identified only in the blaVEB-positive isolate. The concomitant presence of MBL and CHDL was detected in 11 AG3 isolates (Table (Table2)2) that had been found in 1 A. baumannii strain in Taiwan and 2 in Greece (13, 33). Having both MBL and CHDL may not be rare in Acinetobacter, and its clinical impact is yet to be studied.

TABLE 2.
Characteristics of IMP/OXA-58-coproducing Acinetobacter genospecies 3 isolates examined in the present studya

Sequence analysis of integron PCR products revealed that 11 isolates had blaIMP-aac6-II-aadA4 and/or dfrA1-orfC cassettes (Table (Table2),2), and 1 carried the aphA15-aadA1 cassette (isolate 3). The blaADC genes were PCR amplified with the primers FolE-F (CGTGCGGCTAAAGCTTT) and ADC-AG3-R (TTATTTCTTTATTGCATTYARYAC), designed from the A. baumannii strain AB0057 folE (1) and AG3 blaADC sequences (2). Four novel ADC enzymes (ADC-41 to -44) were identified and clustered (17) with 13 other AG3 ADC proteins (except ADC-5). Thirteen isolates (68.4%) had ADC-18, two had ADC-43, and the other four each had ADC-22, ADC-41, ADC-42, or ADC-44.

The genetic environment of the β-lactamase genes was sought by PCR mapping and plasmid random cloning (Fig. (Fig.1).1). The blaIMP-1 and blaIMP-8 genes are located in a class 1 integron and followed by the aminoglycoside-resistant genes aac6-II and aadA4 (Fig. (Fig.1A),1A), which appears to be a common genetic structure in Acinetobacter species (13, 36). Comobilization of the two classes of antimicrobial resistance genes by the same integron suggests the possibility of selecting carbapenem resistance by aminoglycoside use. The blaOXA-58 gene in AG3 is bracketed by ISAba3 (Fig. (Fig.1B),1B), which is structurally similar to previous reports for several different Acinetobacter genospecies (22) and A. baumannii on the plasmid pABIR (37). The prokaryotic type 1 GTP cyclohydrolase folE gene, associated with sulfonamide resistance in bacteria (7), was identified in the 5′-adjacent sequence of the ADC gene (Fig. (Fig.1C1C).

FIG. 1.
Schematic representation of the genetic structure of β-lactamases identified in Acinetobacter genospecies 3 isolates. The open reading frames of identified gene are shown as arrows, with the direction of transcription indicated by arrowheads and ...

In A. baumannii, blaVEB-1 has been identified in cassette arrays of a class 1 integron with 3′-end conserved-segment (3′-CS) duplications in the French AYE strain (10), and blaVEB-1a is linked to ISCR2 in Argentinian strains (29). In a difference from the chromosome location reported previously (38), the plasmid location of blaVEB-3 in our isolate was identified using the I-CeuI mapping technique (28) and Southern hybridization of the plasmid. The upstream region of blaVEB-3 was cloned (21) and selected with 5 μg/ml ceftazidime (Sigma, St. Louis, MO). blaVEB-3 is located in a complex class 1 integron of 3′-CS duplications containing insertion sequence IS6100, the ISCR1 IS common region elements, and a novel integrase TnpF-like protein (Fig. (Fig.1D).1D). Furthermore, the TnpF-like integrase gene reveals as low a % G+C content (34.3%) as Acinetobacter (11), and its encoded protein exhibits high amino acid sequence identity to the TnpF protein from aquatic and soil bacteria. The TnpF-like integrase carried by the AG3 plasmid may provide a route for horizontal gene transfer between clinical and environmental strains.

Our results suggest that AG3 may obtain the antibiotic resistance genes, especially β-lactamase genes, from clinical or environmental Acinetobacter spp. through different gene acquisition mechanisms that include integrons, IS elements, and a novel integrase.

Nucleotide sequence accession numbers.

The nucleotide sequences of our reported ADC-type enzymes were deposited in GenBank under the accession numbers FJ744160 (ADC-41), FJ744161 (ADC-42), FJ744162 (ADC-43), and FJ744163 (ADC-44). The genetic surrounding sequences of β-lactamase genes identified were assigned the accession numbers GQ864268 (blaIMP), FJ744165 (blaOXA-58), FJ744164 (blaADC), and GQ926879 (blaVEB-3).

Acknowledgments

We are grateful to the microbiology laboratories of Taichung Veterans General Hospital, Kaohsiung Medical University Hospital, and Kaohsiung Municipal Hsiao-Kang Hospital for providing the isolates used in this study.

The National Health Research Institute and National Science Council (NSC 98-2314-B-037-042-MY3) supported this project.

No author has a conflict of interest to declare regarding the funding agencies and commercial companies. The funding agencies had no role in the design and conduct of the study, data analysis and interpretation, and preparation, review, and approval of the manuscript.

Footnotes

[down-pointing small open triangle]Published ahead of print on 5 April 2010.

REFERENCES

1. Adams, M. D., K. Goglin, N. Molyneaux, K. M. Hujer, H. Lavender, J. J. Jamison, I. J. MacDonald, K. M. Martin, T. Russo, A. A. Campagnari, A. M. Hujer, R. A. Bonomo, and S. R. Gill. 2008. Comparative genome sequence analysis of multidrug-resistant Acinetobacter baumannii. J. Bacteriol. 190:8053-8064. [PMC free article] [PubMed]
2. Beceiro, A., A. Perez, F. Fernandez-Cuenca, L. Martinez-Martinez, A. Pascual, J. Vila, J. Rodriguez-Bano, J. M. Cisneros, J. Pachon, and G. Bou. 2009. Genetic variability among ampC genes from Acinetobacter genomic species 3. Antimicrob. Agents Chemother. 53:1177-1184. [PMC free article] [PubMed]
3. Boo, T. W., F. Walsh, and B. Crowley. 2009. Molecular characterization of carbapenem-resistant Acinetobacter species in an Irish university hospital: predominance of Acinetobacter genomic species 3. J. Med. Microbiol. 58:209-216. [PubMed]
4. Chu, Y. W., C. M. Leung, E. T. Houang, K. C. Ng, C. B. Leung, H. Y. Leung, and A. F. Cheng. 1999. Skin carriage of acinetobacters in Hong Kong. J. Clin. Microbiol. 37:2962-2967. [PMC free article] [PubMed]
5. Clinical and Laboratory Standards Institute. 2009. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, vol. 29, no. 2. Approved standard M07-A8. Clinical and Laboratory Standards Institute, Wayne, PA.
6. Clinical and Laboratory Standards Institute. 2009. Performance standards for antimicrobial susceptibility testing, vol. 29, no. 3. Approved standard M100-S19. Clinical and Laboratory Standards Institute, Wayne, PA.
7. El Yacoubi, B., S. Bonnett, J. N. Anderson, M. A. Swairjo, D. Iwata-Reuyl, and V. de Crecy-Lagard. 2006. Discovery of a new prokaryotic type I GTP cyclohydrolase family. J. Biol. Chem. 281:37586-37593. [PubMed]
8. Ellington, M. J., J. Kistler, D. M. Livermore, and N. Woodford. 2007. Multiplex PCR for rapid detection of genes encoding acquired metallo-beta-lactamases. J. Antimicrob. Chemother. 59:321-322. [PubMed]
9. Falagas, M. E., and D. E. Karageorgopoulos. 2008. Pandrug resistance (PDR), extensive drug resistance (XDR), and multidrug resistance (MDR) among Gram-negative bacilli: need for international harmonization in terminology. Clin. Infect. Dis. 46:1121-1122. [PubMed]
10. Fournier, P. E., D. Vallenet, V. Barbe, S. Audic, H. Ogata, L. Poirel, H. Richet, C. Robert, S. Mangenot, C. Abergel, P. Nordmann, J. Weissenbach, D. Raoult, and J. M. Claverie. 2006. Comparative genomics of multidrug resistance in Acinetobacter baumannii. PLoS. Genet. 2:e7. [PubMed]
11. Heuer, H., C. Kopmann, C. T. Binh, E. M. Top, and K. Smalla. 2009. Spreading antibiotic resistance through spread manure: characteristics of a novel plasmid type with low %G+C content. Environ. Microbiol. 11:937-949. [PubMed]
12. Houang, E. T., Y. W. Chu, W. S. Lo, K. Y. Chu, and A. F. Cheng. 2003. Epidemiology of rifampin ADP-ribosyltransferase (arr-2) and metallo-beta-lactamase (blaIMP-4) gene cassettes in class 1 integrons in Acinetobacter strains isolated from blood cultures in 1997 to 2000. Antimicrob. Agents Chemother. 47:1382-1390. [PMC free article] [PubMed]
13. Huang, L. Y., T. L. Chen, P. L. Lu, C. A. Tsai, W. L. Cho, F. Y. Chang, C. P. Fung, and L. K. Siu. 2008. Dissemination of multidrug-resistant, class 1 integron-carrying Acinetobacter baumannii isolates in Taiwan. Clin. Microbiol. Infect. 14:1010-1019. [PubMed]
14. Koeleman, J. G., J. Stoof, M. W. van der Bijl, C. M. Vandenbroucke-Grauls, and P. H. Savelkoul. 2001. Identification of epidemic strains of Acinetobacter baumannii by integrase gene PCR. J. Clin. Microbiol. 39:8-13. [PMC free article] [PubMed]
15. Krawczyk, B., K. Lewandowski, and J. Kur. 2002. Comparative studies of the Acinetobacter genus and the species identification method based on the recA sequences. Mol. Cell Probes 16:1-11. [PubMed]
16. La Scola, S. B., V. A. Gundi, A. Khamis, and D. Raoult. 2006. Sequencing of the rpoB gene and flanking spacers for molecular identification of Acinetobacter species. J. Clin. Microbiol. 44:827-832. [PMC free article] [PubMed]
17. Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan, H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez, J. D. Thompson, T. J. Gibson, and D. G. Higgins. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23:2947-2948. [PubMed]
18. Lim, Y. M., K. S. Shin, and J. Kim. 2007. Distinct antimicrobial resistance patterns and antimicrobial resistance-harboring genes according to genomic species of Acinetobacter isolates. J. Clin. Microbiol. 45:902-905. [PMC free article] [PubMed]
19. Livermore, D. M., and N. Woodford. 2006. The β-lactamase threat in Enterobacteriaceae, Pseudomonas and Acinetobacter. Trends Microbiol. 14:413-420. [PubMed]
20. Lu, P. L., L. Y. Huang, S. T. Lian, K. Chang, C. L. Lin, I. J. Hwang, W. G. Chiang, Y. H. Chen, S. F. Lin, and L. K. Siu. 2008. How carbapenem-resistant Acinetobacter spp. established in a newly constructed hospital. Int. J. Antimicrob. Agents 31:463-466. [PubMed]
21. Ma, L., J. Alba, F.-Y. Chang, M. Ishiguro, K. Yamaguchi, L. K. Siu, and Y. Ishii. 2005. Novel SHV-derived extended-spectrum β-lactamase, SHV-57, that confers resistance to ceftazidime but not cefazolin. Antimicrob. Agents Chemother. 49:600-605. [PMC free article] [PubMed]
22. Marti, S., J. Sanchez-Cespedes, M. D. Blasco, M. Ruiz, P. Espinal, V. Alba, F. Fernandez-Cuenca, A. Pascual, and J. Vila. 2008. Characterization of the carbapenem-hydrolyzing oxacillinase Oxa-58 in an Acinetobacter genospecies 3 clinical isolate. Antimicrob. Agents Chemother. 52:2955-2958. [PMC free article] [PubMed]
23. Miembros del grupo MENSURA. 2000. Recommendations from MENSURA for selection of antimicrobial agents for susceptibility testing and criteria for the interpretation of antibiograms. Rev. Esp. Quimioter. 13:73-86. [PubMed]
24. Naas, T., P. Bogaerts, C. Bauraing, Y. Degheldre, Y. Glupczynski, and P. Nordmann. 2006. Emergence of PER and VEB extended-spectrum-β-lactamases in Acinetobacter baumannii in Belgium. J. Antimicrob. Chemother. 58:172-182. [PubMed]
25. Pankey, G. A. 2005. Tigecycline. J. Antimicrob. Chemother. 56:470-480. [PubMed]
26. Peleg, A. Y., H. Seifert, and D. L. Paterson. 2008. Acinetobacter baumannii: emergence of a successful pathogen. Clin. Microbiol. Rev. 21:538-582. [PMC free article] [PubMed]
27. Poirel, L., and P. Nordmann. 2006. Carbapenem resistance in Acinetobacter baumannii: mechanisms and epidemiology. Clin. Microbiol. Infect. 12:826-836. [PubMed]
28. Poirel, L., S. Figueiredo, V. Cattoir, A. Carattoli, and P. Nordmann. 2008. Acinetobacter radioresistens as a silent source of carbapenem resistance for Acinetobacter spp. Antimicrob. Agents Chemother. 52:1252-1256. [PMC free article] [PubMed]
29. Poirel, L., P. D. Mugnier, M. A. Toleman, T. R. Walsh, M. J. Rapoport, A. Petroni, and P. Nordmann. 2009. ISCR2, another vehicle for blaVEB gene acquisition. Antimicrob. Agents Chemother. 53:4940-4943. [PMC free article] [PubMed]
30. Poirel, L., and P. Nordmann. 2006. Genetic structures at the origin of acquisition and expression of the carbapenem-hydrolyzing oxacillinase gene blaOXA-58 in Acinetobacter baumannii. Antimicrob. Agents Chemother. 50:1442-1448. [PMC free article] [PubMed]
31. Ruiz, M., S. Marti, F. Fernandez-Cuenca, A. Pascual, and J. Vila. 2007. Prevalence of ISAba1 in epidemiologically unrelated Acinetobacter baumannii clinical isolates. FEMS Microbiol. Lett. 274:63-66. [PubMed]
32. Tjernberg, I., and J. Ursing. 1989. Clinical strains of Acinetobacter classified by DNA-DNA hybridization. APMIS 97:595-605. [PubMed]
33. Tsakris, A., A. Ikonomidis, S. Pournaras, L. S. Tzouvelekis, D. Sofianou, N. J. Legakis, and A. N. Maniatis. 2006. VIM-1 metallo-beta-lactamase in Acinetobacter baumannii. Emerg. Infect. Dis. 12:981-983. [PMC free article] [PubMed]
34. Woodford, N., M. J. Ellington, J. M. Coelho, J. F. Turton, M. E. Ward, S. Brown, S. G. Amyes, and D. M. Livermore. 2006. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int. J. Antimicrob. Agents 27:351-353. [PubMed]
35. Yeh, K. M., A. Kurup, L. K. Siu, Y. L. Koh, C. P. Fung, J. C. Lin, T. L. Chen, F. Y. Chang, and T. H. Koh. 2007. Capsular serotype K1 or K2, rather than magA and rmpA, is a major virulence determinant for Klebsiella pneumoniae liver abscess in Singapore and Taiwan. J. Clin. Microbiol. 45:466-471. [PMC free article] [PubMed]
36. Yum, J. H., K. Yi, H. Lee, D. Yong, K. Lee, J. M. Kim, G. M. Rossolini, and Y. Chong. 2002. Molecular characterization of metallo-beta-lactamase-producing Acinetobacter baumannii and Acinetobacter genomospecies 3 from Korea: identification of two new integrons carrying the blaVIM-2 gene cassettes. J. Antimicrob. Chemother. 49:837-840. [PubMed]
37. Zarrilli, R., D. Vitale, A. Di Popolo, M. Bagattini, Z. Daoud, A. U. Khan, C. Afif, and M. Triassi. 2008. A plasmid-borne blaOXA-58 gene confers imipenem resistance to Acinetobacter baumannii isolates from a Lebanese hospital. Antimicrob. Agents Chemother. 52:4115-4120. [PMC free article] [PubMed]
38. Zong, Z., S. R. Partridge, and J. R. Iredell. 2009. A blaVEB-1 variant, blaVEB-6, associated with repeated elements in a complex genetic structure. Antimicrob. Agents Chemother. 53:1693-1697. [PMC free article] [PubMed]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)