PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of wtpaEurope PMCEurope PMC Funders GroupSubmit a Manuscript
 
J Neurosci. Author manuscript; available in PMC 2010 May 25.
Published in final edited form as:
PMCID: PMC2875847
EMSID: UKMS30413

Sensory axon-derived Neuregulin-1 is required for axoglial signalling and normal sensory function but not for long term axon maintenance

Abstract

Neuregulin-1 has a key role in mediating signalling between axons and Schwann cells during development. A limitation to studying its role in adulthood is the embryonic lethality of global Nrg1 gene deletion. We used the Cre-loxP system to generate transgenic mice in which neuregulin-1 is conditionally ablated in the majority of small diameter and a proportion of large diameter sensory neurons that have axons conducting in the C and Aδ fibre range, respectively. Sensory neuron-specific neuregulin-1 ablation resulted in abnormally large Remak bundles with axons clustered in ‘polyaxonal’ pockets. The total number of axons in the sural nerve was unchanged but a greater proportion, were unmyelinated. In addition, we observed large diameter axons which were in a 1:1 relationship with Schwann cells, surrounded by a basal lamina but not myelinated. There was no evidence of DRG or Schwann cell death, the markers of different DRG cell populations and cutaneous innervation were unchanged. These anatomical changes were reflected in a slowing of conduction velocity at the lower end of the A fibre conduction velocity range and a new population of more rapidly conducting C fibres which are likely to represent large diameter axons which have failed to myelinate. Conditional neuregulin-1 ablation resulted in a reduced sensitivity to noxious mechanical stimuli. These findings emphasise the importance of neuregulin-1 in mediating the signalling between axons and both myelinating and nonmyelinating Schwann cells required for normal sensory function. Sensory neuronal survival and axonal maintenance however are not dependent on axon-derived neuregulin-1 signalling in adulthood.

Keywords: Neuregulin-1, Schwann cell, myelin, DRG cell, skin, pain

Introduction

Neuregulins (NRGs) are structurally related glycoproteins and four genes have been identified encoding NRGs, Nrg1, Nrg2, Nrg3 and Nrg4. (Holmes et al., 1992;Peles et al., 1992;Wen et al., 1992;Goodearl et al., 1993;Marchionni et al., 1993;Falls et al., 1993;Holmes et al., 1992;Harari et al., 1999;Zhang et al., 1997;Carraway, III et al., 1997). NRG1 is the most widely studied of the NRGs and is known to have a major role in neural, mammary and cardiac development (Wen et al., 1994;Nave and Salzer, 2006). Alternative splicing and differential promoter usage gives rise to at least 15 different NRG1 isoforms which demonstrate different spatiotemporal patterns of expression (Meyer et al., 1997;Falls, 2003). All isoforms possess an epidermal growth factor (EGF)-like signalling domain which is essential for mediating biological activity and can be classified into sub groups according to the structure of their amino termini. Type I and II isoforms have Ig like domains and following proteolytic cleavage can be released as soluble proteins from the cell surface. Type III isoforms possess a cysteine-rich domain (CRD) and have two transmembrane domains. This isoform undergoes proteolytic cleavage by BACE1, a process required for some aspects of its biological activity (Willem et al., 2006;Hu et al., 2006).

During development axonally-derived NRG1 binds to erbB2 and erbB3 receptors expressed on Schwann cells (and their precursors); this signalling pathway is critical for the survival of glia and peripheral neurons, Schwann cell proliferation, motility and finally myelination (Garratt et al., 2000a). The ensheathment fate of the axon depends on a threshold level of NRG1 type III being expressed on the axonal surface (Taveggia et al., 2005). Furthermore myelin thickness depends on the amount of NRG1 type III expressed on the axolemma (Michailov et al., 2004). Increasing the levels of NRG1 type III produces thicker myelin sheaths whilst haploinsufficiency of NRG1 type III (Taveggia et al., 2005) or targeted ablation of the erbB2 receptor in myelinating Schwann cells results in thinner myelin sheaths (Garratt et al., 2000b).

NRG-erbB signalling is not only required for establishing the normal interaction of large diameter axons with myelinating Schwann cells but may have a role in signalling between unmyelinated axons and nonmyelinating Schwann cells (NMSCs), the cell types which form the Remak bundle. A dominant negative erbB4 receptor has been used to disrupt erbB2/3 signalling in NMSCs resulting in reduced numbers of axons per Remak bundle as well as Schwann cell death and sensory axon loss (Chen et al., 2003).

One difficulty in studying NRG1 function in postnatal development and adulthood has been that the ablation of all NRG1 isoforms results in embryonic lethality due to defective cardiogenesis. Blockade of neuregulin-erbB mediated axoglial signalling throughout the peripheral nervous system results in perinatal mortality due to respiratory failure (Meyer et al., 1997;Falls, 2003;Wolpowitz et al., 2000;Woldeyesus et al., 1999;Morris et al., 1999). We have therefore crossed animals in which Cre is expressed under control elements of the Nav1.8 gene (Nav1.8-Cre) with animals in which exons 7-9 of the Neuregulin gene (Nrg1) have been floxed (Nrg1f/f). This approach results in Nrg1 gene deletion in the majority of small DRG cells (which normally have unmyelinated axons) and a population of large diameter DRG cells (which normally have thinly myelinated axons), enabling us to study NRG1 function in axo-glial signalling between sensory axons and both myelinating and NMSCs.

Materials and Methods

Animals

All work carried out conformed to UK Home Office legislation (Scientific Procedures Act 1986). All behaviour, surgery, immunohistochemistry and electron microscopy was carried out on animals or tissue taken from 10 week old animals unless stated otherwise.

The generation and genotyping of mutant mice with floxed alleles of Nrg1 (Nrg1f/f) and Nav1.8-Cre mice has previously been described (Meyer and Birchmeier, 1995;Yang et al., 2001;Brinkmann et al., 2008;Stirling et al., 2005). In Nav1.8-Cre mice the onset of Cre expression is at E13 and it is expressed selectively in nociceptors constituting the majority of sensory neurons with unmyelinated axons (C fibres) and a small group with thin myelinated axons (Aδ fibres) (Stirling et al., 2005;Abrahamsen et al., 2008). Nav1.8-Cre mice have previously been thoroughly characterised. The Nav 1.8 sodium channel contributes to the Tetrodotoxin resistant (TTX-r) sodium current and although these animals are haplotype insufficent for Nav 1.8 DRG cells demonstrate a normal TTX-r current density and normal nociceptive behaviour (Stirling et al., 2005). Both colonies were on a C57 B16 background. Nrg1f/f mice have loxP sites flanking the essential EGF domain (Li et al., 2002;Brinkmann et al., 2008). Floxed alleles are genetically null for alpha NRG1 isoforms but have normal peripheral nerve development and can be considered controls. Nrg1f/f and Nrg1f/f;Nav1.8-Cre mice were born in expected ratios. In each experiment Nrg1f/f;Nav1.8-Cre animals were compared with Nrg1f/f littermate controls. We included equal numbers of animals of each gender in experimental groups where possible.

Cre-mediated recombination in DRG cells was assessed using PCR of genomic DNA, the primers used to detect the presence of the first loxP site were: 5′-tttggtggactgggtttctc-3′ and 5′-CTGACTGGCCTTTCTTCCAG-3′. The primes used to detect the recombined allele were: 5′-tttggtggactgggtttctc-3′ and 5′-TCACTATGTAGCTCTGGCTGGCATC-3′ (both reactions carried out as follows; heating at 94°C for 2 min, 34 cycles of 94°C for 30 sec 60°C for 30 sec and 72°C for 50 sec, followed by a final extension at 72°C for 8 min). For genotyping, ear-derived DNA was analyzed by PCR to identify Nrg1f/f;Nav1.8-Cre experimental mice. Primers used to identify the Nav1.8-Cre allele were as follows: 5′-TGTAGATGGACTGCAGAGGATGGA-3′ and 5′-AAATGTTGCTGGATAGTTTTTACTGCC-3′(94°C for 3 min, 30 cycles of 94°C for 30 sec, 62°C for 30 sec 72°C for 1 min, followed by a final extension at 72°C for 10 min).

In situ hybridisation (ISH) combined with fluorescence histochemistry

All solutions and materials used in tissue preparation and processing for in situ hybridisation were RNase-free or DEPC-treated. Histochemistry was performed prior to in situ hybridisation. Following a series of washes in DEPC-treated phosphate buffered saline (PBS), samples were incubated overnight at room temperature with rabbit anti-calcitonin gene-related peptide (CGRP, 1:2000, Sigma) and biotin-conjugated IB4 (1:50, Sigma). Following incubation, samples were washed and incubated with donkey anti-rabbit IgG-conjugated Alexa Fluor ™ 546 (1:1000, Molecular Probes) and Extravidin-AMCA (1:400, Vector Laboratories) for 3hr. All antibody dilutions were in DEPC-PBS containing 0.2% Triton X-100, 0.1% sodium azide and 100 U/ml RNasin Plus ribonuclease inhibitor (Promega, Madison, WI, USA). Finally, samples were washed in DEPC-treated PBS.

Pre-hybridisation treatment included acetylation in 0.25M acetic anhydride/0.1M triethanolamine, dehydration in graded alcohol (70–100% ethanols) and delipidation in 100% chloroform. ISH was performed using 34-nucleotide long radioactive probes as described previously. Oligonucleotides were designed using NetPrimer software, subjected to BLAST analysis to ensure specificity of hybridisation (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi), synthesized (Sigma) and radioactively end-labelled with 35S-dATP (Perkin-Elmer Life Sciences, Boston, MA, USA) using terminal deoxynucleotidyl transferase (Promega). The NRG1 probe sequence was CTGGTGATCGTTGCCAAAACTACGTAATGGCCAGC, designed to detect the βEGF domain of mouse NRG1 mRNA (accession number NM_178591). Hybridisation with the oligonucleotide probe was performed overnight at 37°C. Following hybridisation, sections were washed in standard saline citrate solutions with increasing stringencies. Slides were dehydrated rapidly through graded alcohols, air-dried, dipped in autoradiographic emulsion (LM1, GE Healthcare) and exposed for 3–4 weeks before development. Slides were either counter-stained with Toiludine blue and coverslipped with DPX, or mounted with Vectashield (Vector Laboratories) when fluorescence was present. Controls included competition of specific labelling by addition of a 20-fold excess of unlabelled oligonucleotide in the hybridisation reaction, as well as identical labelling patterns when using different probes.

DRG Cell Culture

Neuronal dissociated DRG cultures were prepared as previously described (Golding et al., 1999). Postnatal day 3 mice were killed according to institutional (King's College, London) and UK Home Office regulations. The DRGs were dissected, trimmed and placed in Ca2+ and Mg2+ free Hank's balanced buffer solution (HBSS, Gibco). DRGs were then incubated in 0.125% collagenase (Sigma) at 37 °C in Ham's F12 medium for 40 minutes followed by 0.25% trypsin/EDTA (Sigma) for 15 minutes, washed in Ham's F12 containing 10% foetal calf serum (Sigma) and tritrurated with a P1000 Gilson pipette in 500 μl of modified Bottenstein and Sato's culture medium (BS) in Ham's F12. The cell suspension was then centrifuged at 600g for 8 minutes through a cushion of 15% bovine serum albumin (BSA, Sigma) to remove myelin debris. Dissociated neurons were resuspended in Bottenstein and Sato's medium containing 50 ng/ml NGF (Alomone) and 2% FCS and plated onto coverslips coated with Poly-L-lysine (10 μg/ml, Sigma) and Laminin (10μg/ml, Sigma). Medium was changed daily and on alternate days 20 μM FUDR (Sigma) was added to reduce the growth of non-neuronal cells.

Western Blotting

Cells from DRG culture were washed with PBS, scraped off the coverslip, lysed and centrifuged at 12,000rpm for 15mins. The supernatant was used to determine the protein concentration using the BCA protein assay kit (Pierce 23227). 50ug of protein was mixed with SDS gel sample buffer and electrophoresed on 8% SDS-polyacrylamide gels, transferred onto nitrocellulose membrane, blocked in 10% milk and immunoblotted with antibodies against NRG1 (Neuregulin-1α/β1/2 (C-20) SantaCruz SC-348) at a dilution of 1 in 500 and Beta-III Tubulin (Promega G7121) at a dilution of 1 in 2000. Secondary antibodies were anti-rabbit IgG horseradish peroxidase linked (GE Healthcare NA9340V) and anti-mouse IgG horseradish peroxidase linked (GE Healthcare NA931V). ECL plus western blotting detection system (GE Healthcare) was used to visualise the immunoreactive band on chemiluminescence film (GE Healthcare) which was developed on a Fuji X Ray Imager (Mediphot 937).

Histology

Immunofluorescence microscopy

Animals were deeply anesthetized with pentobarbitone and transcardially perfused with 5ml saline followed by 25ml paraformaldehyde (4% in 0.1 M phosphate buffer). Skin biopsies were taken from the hind paw glabrous skin proximal to the pad below the first digit. Skin, L4 DRG, sciatic and sural nerve tissue were post fixed in paraformaldehyde (4% in 0.1M phosphate buffer) for 2hrs and then transferred to 20% sucrose overnight (4°C). Tissue was then blocked in OCT embedding compound on dry ice and stored at −80°C. Transverse sections of skin were cut at 14μm on a cryostat onto chrome alum gelatine covered slides. DRG sections were cut at 10μm and longitudinal nerve sections at 5μm on a cryostat onto SuperFrost Ultra Plus® slides. E14.5 and E16.5 embryos were obtained by mating and observing a vaginal plug, the day of the vaginal plug was defined as embryonic day 0.5. Embryos were post fixed in paraformaldehyde (4% in 0.1M phosphate buffer) overnight and transferred sequentially to 10%, 20% and 30% sucrose for 1 day at each concentration (4°C) before being embedded in OCT compound on dry ice and stored at −80°C. 20μm thick sections of whole embryos were cut transversely.

C fibres in the epidermis were visualised by immunostaining with the pan-neuronal marker protein gene product (PGP), polyclonal rabbit PGP9.5 (Ultraclone 1 in 800 14hr) or polyclonal sheep calcitonin gene related peptide (CGRP Biomol CA1137 1 in 800 14hr). Secondary antibodies used were anti-rabbit Cy3 (Stratech 711-166-152 1 in 500 2.5hrs) and anti-sheep Cy3 (Stratech 713-166-1471 in 400 2.5hrs) respectively. DRG cell profiles were visualised by staining for either IB4 Isolectin B4 biotin conjugate (BSI-B4, 10μg/ml Sigma-Aldrich L2140 14hr), CGRP (1 in 800 14hr) or monoclonal mouse anti-neurofilament 200 clone N52 (NF200 (N52) 1 in 500 Sigma N0142 14 hr). All of which were double stained with PGP9.5 to aid counting the total number of profiles. Secondary antibodies used were; ExtrAvidin®-FITC (Sigma E 2761 1 in 500 2.5hr) with anti- rabbit Cy3 for IB4 double staining. Anti –sheep Cy3 with goat anti-rabbit FITC (Stratech 111-096-003 1 in 200 2.5hr) for CGRP double staining. Donkey anti-mouse FITC (Stratech 715-095-150 1 in 200 2.5hr) with anti-rabbit Cy3 for NF200(N52) double staining. Incubation of primary antibodies was overnight and was preceded by an incubation with normal donkey serum (Chemicon S30 1 in 10 30mins). All reagents were diluted in PBS 0.2% Triton X-100 0.1% Sodium Azide.

Immunofluorescence was visualised under a Zeiss Imager.Z1 microscope. Epidermal fibres were counted at a 40x magnification live on the microscope according to rules set out by (Lauria et al., 2005). Only nerve fibres that can be seen to cross the basement membrane were counted. If the nerve fibre diverged into two fibres before crossing the membrane it was counted as two fibres where as if the fibre diverged after crossing the membrane it was counted as only one fibre. Nerve fragments in the epidermis that did not cross the basement membrane in the section were not counted. Skin sections were numbered and then selected randomly using randomly generated numbers. 4 sections per animal were counted blind, twice. Photographs were taken using the Axio Cam at 10x magnification in a mosaic. The length of the epidermis was measured using Image J and used to calculate Intraepidermal Nerve Fibre Density (IENFD, number of fibres/mm). Photographs of DRG sections were taken using the Axio Cam at 40x magnification in a mosaic. 2 sections per animal per staining were counted blind from a photograph taken using AxioVision LE Rel. 4.2 software. Positive cell profiles were counted as well as negative to get a percentage of total cell profiles for each marker. The same software was used to measure the diameter of DRG profiles for cell size distributions.

TUNEL analysis staining was performed using an ApopTag Fluorescein In Situ Apoptosis Detection Kit (Chemicon S7110) according to the manufacturer's instructions. Nerve sections were counter-stained with DAPI-mounting medium (Vector Laboratories Inc. H-1200) to identify nuclei for total counts. Photographs of all of the fields covering the whole of each longitudinal nerve section were taken at x40 magnification. The number of fields varied depending on the nerve and the age of the animal, at least 2 nerve sections were analysed per animal. Over 1000 cells were counted blind per genotype at each time point and TUNEL positive cells were represented as a percentage of total cell number. TUNEL positive embryonic DRG cells were counted blind in at least 6 L4/5 DRG sections per animal.

Electron Microscopy

Animals were deeply anesthetized with pentobarbitone and transcardially perfused with 5ml saline followed by 25ml 4% paraformaldehyde, 3% glutaraldehyde in 0.1M phosphate buffer. Sural nerves were dissected and a 5 mm length taken as it reaches the gastrocnemius muscle. Nerves were postfixed in 3% glutaraldehyde at 4°C overnight, washed in 0.1M PB, osmicated, dehydrated and embedded in epoxy resin (TAAB® Embedding Materials). Sections 1μm thick were cut on a microtome and stained with toludine blue before being examined on a light microscope. Ultrathin sections were cut on an ultramicrotome and stained with lead uranyl acetate by the Centre for Ultrastructural Imaging Kings College London. Sections were mounted on unsupported 100 mesh grids and uninhibited sections were visualised on a Hitachi H7600 transmission electron microscope.

For analysis photographs of the entire section of one nerve from each animal were taken at a magnification of x15, 000. Total counts of myelinated and unmyelinated axons as well as Schwann cell nuclei were carried out of the whole cross-section of the nerve. G-ratios of 100 axons and C fibre diameters of 300 axons chosen using randomly generated numbers were measured per animal using AxioVision LE Rel. 4.2 software.

Neurophysiology

The conduction velocity (CV) of individual A and C fibres projecting through the sciatic nerve was measured in urethane anesthetized animals (terminal urethane anaesthesia; 1.25 g/kg i.p.). A tracheal cannula was inserted and core body temperature was maintained at 37 °C using a feedback controlled heating blanket. The spinal cord was exposed by an L2-L5 dorsal laminectomy and the sciatic nerve was exposed at the mid thigh level and immersed in mineral oil. The sciatic nerve was placed on a pair of silver hook stimulating electrodes and was cut distally. Fine jewellers forceps were used to dissect microfilaments from the L4 dorsal root close to the dorsal root entry zone and these were mounted on a recording electrode. It was then possible to evoke activity in sensory axons by applying graded electrical stimuli to the sciatic nerve, and recording the individual action potentials as they passed over the recording electrodes. Dividing the distance between these sets of electrodes by the conduction time taken for action potentials yields the conduction velocity of individual axons. Groups of myelinated and unmyelinated axons (typically 30-50 per animal) were studied. To evoke activity in A fibres (CV > 2 m/s) the sciatic nerve was stimulated using a square wave current pulse of duration 100μS. The evoked activity on the root filament was amplified and filtered by conventional means. The stimulating current was gradually increased up to a maximum of 500μA, which is sufficient to recruit all A fibres in the nerve. This procedure typically resulted in a group of 3-10 axons being progressively recruited with increasing current strengths in each strand. To stimulate C fibres (CV< 2m/s) a square wave current pulse of 1mA for 1ms was used. When recording activity in C fibres, 32 responses were averaged (in order to reveal relatively small potentials). Because of the relative slowness of conduction in these fibres, the action potentials evoked are dispersed by the time they reach the recording electrodes and they generally are not superimposed. It was therefore possible to identify action potentials from individual C axons in these recordings, from which the latency (and hence conduction velocity) was determined (see Figure 4 A, B). There were usually 5-10 A and 3-10 C fibres per strand (and typically 10-15 strands would be studied resulting in a total of approximately 50 A and 50 C fibres being collected per animal). Conduction velocity distributions were expressed as cumulative sums (Qsums) and the compared statistically using the Kolmogorov-Smirnov test.

Behavioural Tests

All behavioural testing was carried out with the observer blind to the genotype of the animal.

Mechanical withdrawal threshold assessed using von Frey hairs

Static mechanical withdrawal thresholds were assessed by applying von Frey hairs (Somedic, Sweden) to the plantar surface of the hind paw. Unrestrained animals were acclimatised in acrylic cubicles (8 × 5 × 10 cm) atop a wire mesh grid for up to 60 min prior to testing. Calibrated von Frey hairs were applied to the plantar surface of the hind paw until the fibre bent. The 50% withdrawal threshold was determined using the up-down method described previously (Dixon, 1980).

Randall-Selitto test of mechanosensation

Animals were placed in a restrainer and left to settle for a few minutes. Force was applied approximately midway along the tail. The force at which the animal attempted to withdraw the tail, vocalise or struggle was recorded (Takesue et al., 1969). The test was repeated three times for each animal. Results were expressed as the mean weight tolerated for each group.

Hargreaves' test of thermal nociception

Heat-pain threshold of the hind paw was ascertained with the Hargreaves method using the Plantar Test (7370; active intensity 20%; Ugo Basile, Italy) (Hargreaves et al., 1988). Unrestrained animals were acclimatised in acrylic cubicles (8 × 5 × 10 cm) atop a uniform glass surface for up to 60 min prior to testing. An infrared light source was directed onto the plantar surface of the hind paw and the latency to paw withdrawal was measured in seconds. Four responses were recorded for each hind paw on each testing occasion with at least 2 minutes between stimuli. To avoid tissue injury, the maximum stimulus latency was 20.0 s.

Hot Plate test

The response to thermal stimuli was tested using a hot-plate analgesia meter (Ugo Basile, Italy). Mice were acclimatised to the hot plate chamber for 15 min before the plate was heated. The latency for hindpaw withdrawal at two temperatures, 50 and 55 °C, was measured. The latency was measured once for each animal and the tests at different temperatures were separated by at least 24 h. A cut-off latency time of 60 s and 30 s for 50 and 55 °C respectively was imposed in each measurement in order to avoid lesions to the skin and unnecessary suffering to the animals.

Cold Plate Test

An incremental hot-cold plate analgesia meter (IITC Life Science, Woodland Hills, CA, USA) was used to assess noxious cold sensitivity on the plantar surface of the paw as previously described (Kwan et al., 2006). Mice were placed on the surface maintained at 0 ± 0.5°C, and pain was assessed by counting the number of hind paw lifts or jumping during a 5 min period. The mean number of the nocifensive responses was determined by counting over two separate trials conducted with at least a 60 min interval to prevent thermal sensitization and/or behavioural interferences. Results were expressed as the mean nocifensive responses for each group.

Rotarod

Mice were placed on the rotarod (Jones and Roberts, 1968) as it was rotating at 20 rpm. After 1 min the rate of revolution was increased, and reached a maximum of 36 rpm within 90 s. The duration that each animal spent on the rod was measured, with a cut off time of 5 min. The test was performed three times for each animal with an interval of at least 15 min between each test.

Statistical Analysis

Differences between Nrg1f/f;Nav1.8-Cre animals and Nrg1f/f littermate controls were determined using the Students t test for a single time point and Two-Way Repeated measures ANOVA using the Tukey post hoc test, with genotype and time points as factors. Results are reported as mean values ± SEM. Conduction velocity cumulative sum plots were compared statistically using the Kolmogorov-Smirnov test, as were cell size, and axon diameter frequency distributions.

Results

Efficient ablation of NRG1 in sensory neurons

In this study we have utilised mice expressing the Cre recombinase transgene under the control of the Nav1.8 promoter (Stirling et al., 2005). When crossed with mice homozygous for the conditional Nrg1 allele (Nrg1f/f) which have loxP sites flanking the essential EGF domain (Meyer and Birchmeier, 1995;Yang et al., 2001) this sequence which is present in all Nrg1 isoforms is conditionally ablated in the majority of small diameter as well as a population of large diameter DRG cells. Genomic DNA from control Nrg1f/f and knockout Nrg1f/f;Nav1.8-Cre DRGs show recombination of the allele in the presence of Cre recombinase expression (Fig.1A). In situ hybridisation using a probe directed against the β isoform of the EGF domain confirms the specificity of NRG1 ablation at the mRNA level specifically within small diameter DRG cells (Arrows Fig. 1B). In Nrg1f/f animals the highest level of expression of NRG1 is seen in the large diameter DRG cells (Arrowheads Fig.1B) as has previously been demonstrated, (Bermingham-McDonogh et al., 1997) however expression is seen at a low level in small diameter DRG cells identified by the markers CGRP and IB4. Expression of NRG1 in the CGRP and IB4 populations is largely absent in Nrg1f/f;Nav1.8-Cre animals however large diameter DRG cells (which are CGRP and IB4 negative) continue to show a normal pattern of expression. In Nav1.8-Cre animals Cre is selectively expressed in sensory neurons and therefore as expected the normal expression of NRG1 in motoneurons is observed in Nrg1f/f;Nav1.8-Cre animals (Arrows Fig. 1C). No signal was seen following addition of a 20-fold excess of unlabelled oligonucleotide in the hybridisation reaction demonstrating the specificity of the radiolabeled probe (Supp. Fig. 1). Further evidence of NRG1 ablation in small diameter sensory neurons was shown at the protein level by western blotting analysis of protein lysate of postnatal DRG cell cultures which are grown in the presence of NGF (which selects for small diameter DRG cells, Fig. 1D). The amount of NRG1 detected in DRG cell cultures from Nrg1f/f;Nav1.8-Cre mice is markedly reduced.

Figure 1
The floxed Nrg1 locus is efficiently recombined by the Cre recombinase in DRG cells. A, PCR performed on genomic DNA using primers in order to detect the presence of Cre with a product of ~320bp in length (lanes 1, 4, 7 and 10), the loxP site upstream ...

Loss of NRG1 in sensory neurons leads to altered Remak bundle structure as well as myelination defects

The sural nerve was chosen for electron microscopic analysis as it is a cutaneous sensory nerve and consequently is enriched in A and C fibres affected by the ablation of Nrg1 in these animals. Nrg1f/f;Nav1.8-Cre animals demonstrated an obvious phenotype in relation to both Remak bundle structure and myelination (Fig 2). Strikingly large Remak bundles were observed with many more axons present per bundle than in Nrg1f/f animals. In Nrg1f/f animals unmyelinated axons were individually ensheathed by extensions of Schwann cell cytoplasm so that they were separated from each other however in contrast the C fibres within the Remak bundles of Nrg1f/f;Nav1.8-Cre mice were much more closely packed, and often not separated by Schwann cell cytoplasm resulting in polyaxonal pockets which are normally only rarely seen in peripheral nerve (Murinson and Griffin, 2004) (Arrowheads Fig. 2 E, F). In addition in Nrg1f/f;Nav1.8-Cre mice we observed examples of type II axon/Schwann cell relationship in which the mesaxon is breached and the axon is directly exposed to the endoneurium (Arrows Fig.2 F) (Murakawa et al., 2002). There was a much greater range of sizes of C fibres within the Remak bundles of Nrg1f/f;Nav1.8-Cre mice (Fig. 2B).

Figure 2
NRG1 is necessary for normal Remak bundle structure and myelination. A-F, Electron micrographs of transverse sections of adult mouse sural nerve (10 weeks of age). A, C, and E, sural nerves of Nrg1f/f mice, B, D, and F sural nerves of Nrg1f/f;Nav1.8-Cre ...

Electron microscopy was used to count the total number of axons within the sural nerve which was unchanged in Nrg1f/f;Nav1.8-Cre mice. However, a greater proportion of axons were unmyelinated (Table 1.). Interestingly there was a population of large diameter fibres in a 1:1 relationship with a Schwann cell, surrounded by a basal lamina but having failed to myelinate (Fig.2D, ,3B).3B). The presence of such fibres indicates that amyelination was not solely due to impaired ensheathment. 30.8% ±2.8 of the amyelinated fibres larger than 1μm in diameter were in a 1:1 relationship with a Schwann cell the rest being present in Remak bundles. There was therefore a change at both ends of the frequency distribution when plotting the number of unmyelinated axons per Schwann cell unit (Fig. 3C). The proportion of unmyelinated axons associated with a Schwann cell in a 1:1 ratio increased from 14.7% ±0.8 (mean ± SEM) in Nrg1f/f mice to 28.8% ±1.3 in Nrg1f/f;Nav1.8-Cre mice (Fig. 3C) (Sharghi-Namini et al., 2006). As described above Nrg1f/f;Nav1.8-Cre mice also had a greater proportion of Schwann cell units containing large numbers of unmyelinated axons resulting in a significant change in the frequency distribution (Fig 3C, p<0.001 Kolmogorov-Smirnov test). We also noted a small population of larger myelinated fibres that appear to have proportionately thinner myelin in relation to the axon diameter reflected by an increase in the average g-ratio and a significant shift in the frequency distribution (Fig.3A p<0.001 Kolmogorov-Smirnov test and Supp. Fig. 2). The mean axon diameter of both unmyelinated and myelinated axons increased representing the fact that a population of small diameter myelinated axons have become large diameter unmyelinated axons in the Nrg1f/f;Nav1.8-Cre mice (Table 1.).

Figure 3
Analysis of effect of NRG1 ablation on myelinated and unmyelinated fibre diameter. Morphometric data calculated from electron micrographs of sural nerves from 10 week old mice (n = 4). A Frequency distribution of G ratios. Nrg1f/f mice have an average ...
Table 1
Quantification of sural nerve morphometry using electron microscopy.

There was no decrease in the number of Schwann cell nuclei of either myelinating or NMSCs, (Table 1.) and no apoptotic Schwann cells were seen by electron microscopy. Using TUNEL staining we examined Schwann cell apoptosis in postnatal (P3) and adult sciatic and sural nerve. As previously described Schwann cell apoptosis was observed in the postnatal but not adult nerve (Grinspan et al., 1996). There was no significant difference in the proportion of TUNEL positive Schwann cell nuclei in the Nrg1f/f;Nav1.8-Cre compared to Nrg1f/f animals (Fig.4). Nav1.8 is not expressed in sympathetic neurons and therefore as expected the appearance of unmyelinated axons in the lumbar sympathetic plexus of Nrg1f/f;Nav1.8-Cre animals was normal (Supp. Fig.3). The anatomical phenotype in peripheral sensory nerves in NRG1 knockout animals strongly suggests a role of NRG1 in signalling between unmyelinated axons and NMSCs as well as in myelination.

Figure 4
There is no difference in apoptosis of Schwann cells between Nrg1f/f and Nrg1f/f;Nav1.8-Cre mice. A Photomicrograhs of longitudinal sections of sciatic and sural nerve stained for apoptosis using the TUNEL system and DAPI as a nuclear stain at P3 and ...

Ablation of NRG1 leads to altered conduction in sensory axons

The shape of action potentials recorded from primary afferents in the Nrg1f/f;Nav1.8-Cre mice appeared normal, but there were changes in conduction velocity (see Fig. 5). The distribution of conduction velocities (CV) of individual myelinated fibres (ie conducting at more than 2 m/s) is shown as cumulative sum plots in figure 5C. There was a significant slowing of CV in Nrg1f/f;Nav1.8-Cre mice compared to Nrg1f/f control mice (see Fig 5C, p<0.05 Kolmogorov-Smirnov test), which was apparent for the more slowly conducting A fibres. This observation is consistent with the known expression of Nav1.8 in some small myelinated axons, and the loss of neuregulin expression form those in the Nrg1f/f;Nav1.8-Cre mice. There was also a greater electrical threshold for activation in this population of units. Whilst in Nrg1f/f animals only 1 of 208 units recorded with a CV>2 m/s required stimulation using the C fibre rather than A fibre parameters (as described in methods), this was the case in 51 of 262 such units recorded in Nrg1f/f;Nav1.8-Cre mice (p<10−5 Chi-squared test). The CV slowing and increased thresholds seen in the Nrg1f/f;Nav1.8-Cre mice is likely to represent the electrophysiological consequences of failure/impairment of myelination of a population of large diameter axons corresponding to our findings on morphometric analysis. Fibres conducting >12 m/s have a virtually identical CV distribution when comparing Nrg1f/f;Nav1.8-Cre and Nrg1f/f mice.

Figure 5
The conduction velocity (CV) of individual sensory axons projecting through the sciatic nerve was measured by stimulation of the nerve electrically and recording and averaging activity in fine strands of the L4 dorsal root. A and B show representative ...

A cumulative sum plot of fibres recorded with a CV of less than 2m/s (ie. C fibre conduction range) is shown in Figure 5D. There was a significant increase in CV in Nrg1f/f;Nav1.8-Cre mice compared to control Nrg1f/f mice particularly in the range of 1-2 m/s (p<0.05 Kolmogorov-Smirnov test). This is likely to represent a population of large diameter axons (which would normally be Aδ fibres) which have failed to myelinate and therefore now conduct in the C fibre range. There was no difference in CV distribution in the slower part of the range (0-0.8 m/s) and in particular no slowing of CV in Nrg1f/f;Nav1.8-Cre animals.

Epidermal innervation and DRG cell histochemistry are unaltered following NRG1 ablation

We investigated whether NRG1 ablation led to increased DRG cell apoptosis during development. Naturally occurring DRG cell death occurs between E 12.5 and E16 in the mouse (White et al., 1998). The TUNEL positive DRG cell profile counts were unchanged in Nrg1f/f;Nav1.8-Cre animals at E14.5 and E16.5 indicating no difference in the rate of DRG neuron apoptosis before birth (Supp. Fig. 4). The innervation of the epidermis was analysed in order to investigate whether abnormal axoglial signalling caused by NRG1 ablation could lead to a reduction in target innervation by sensory neurons. There was no significant difference in intraepidermal nerve fibre density (IENFD, fibres/mm) when stained for either PGP9.5 a pan neuronal marker (IENFD of 35.2 ± 6.2 and 31.5 ± 4.4 in Nrg1f/f and Nrg1f/f;Nav1.8-Cre animals respectively) or CGRP (IENFD 8.6 ± 1 and 6.9 ± 2.7 in Nrg1f/f and Nrg1f/f;Nav1.8-Cre animals respectively). There remained no difference in IENFD at the age of 1 year (27.7 ± 2 and 29.6 ± 2.7 in Nrg1f/f and Nrg1f/f;Nav1.8-Cre animals respectively). This indicates that after E13 axonally derived NRG1 is not required for C fibres to reach their target of the epidermis or maintain target innervation (Fig. 6). There was no difference in the DRG cell size distribution following NRG1 ablation (Supp. Fig. 5). In addition there was no evidence for an alteration in the constituent DRG cell populations as defined histochemically: counts of DRG cell profiles stained for NF200 (a marker for large diameter DRG cells), CGRP and IB4 binding (markers for peptidergic and non-peptidergic C fibres respectively) were unchanged (Supp. Fig. 5 and Table 2.).

Figure 6
Cutaneous innervation is unchanged in NRG1 knockout mice. Photomicrographs of skin sections stained for PGP9.5 a pan neuronal marker. There is no difference in the density of fibres (arrows) in the epidermal layer in Nrg1f/f;Nav1.8-Cre mice (B) compared ...
Table 2
% Counts of L4 DRG cell profiles immunopositive for CGRP, IB4 and NF200. Note that there was no difference between in Nrg1f/f and Nrg1f/f;Nav1.8-Cre mice in the percentage of DRG cell profile percentages immunopositive for these markers. n = 4. Data presented ...

Altered nociceptive behaviour in the absence of NRG1

To assess the impact of NRG1 ablation on nociceptive behaviour the thermal and mechanical thresholds of Nrg1f/f;Nav1.8-Cre an dNrg1f/f mice were assessed at intervals over a period of 1 year (Fig. 7 and Supp. Fig. 6). There was no difference in sensitivity to noxious thermal stimuli assessed using Hargreaves method at any time point. Similarly the mechanical threshold tested by von Frey hairs was unchanged. There was an increased threshold in Nrg1f/f;Nav1.8-Cre mice following application of a ramp pressure mechanical stimulus (using the method of Randall-Selitto) which became more apparent with age. The performance of Nrg1f/f;Nav1.8-Cre on the rotarod as well as their response to the hot plate test and noxious cold were unchanged (Supp. Fig. 6).

Figure 7
The nociceptive behaviour of a cohort of Nrg1f/f and Nrg1f/f;Nav1.8-Cre mice was followed over the course of 48 weeks (n=8 per group). There was no significant difference in A the response to noxious thermal stimuli as measured by Hargreaves' apparatus ...

Discussion

We have found that the selective ablation of NRG1 within sensory neurons results in profound changes in the structural relationship between axons and both nonmyelinating and myelinating Schwann cells: Large numbers of clustered unmyelinated axons are observed within Remak bundles and myelination is impaired as demonstrated by a reduction in the proportion of myelinated axons and an increased g-ratio. These structural changes are reflected in a slowing of conduction velocity in the A-fibre conduction range and a reduced sensitivity to high threshold mechanical stimuli. In contrast to animals which lack NRG1 at earlier stages of development there was no evidence of DRG cell or axon loss.

The role of NRG1 in signalling between small diameter sensory axons and non-myelinating Schwann cells

Nrg1f/f;Nav1.8-Cre mice demonstrated impaired sorting and ensheathment of unmyelinated axons: We found an increase in the number of axons per Remak bundle. Normally unmyelinated axons in peripheral nerves are isolated from each other by Schwann cell processes (Murinson and Griffin, 2004). Following conditional NRG1 ablation there was poor segregation of unmyelinated axons which were clustered in ‘polyaxonal’ pockets. We also observed instances of type 2 axon/Schwann cell relationships in which the axolemma is directly exposed to the endoneurium (Murakawa et al., 2002). A similar morphological phenotype is seen within the peripheral nerves of animals which are haploinsufficient for NRG1 type III (Taveggia et al., 2005) or in animals lacking BACE1 an enzyme which proteolytically cleaves this molecule (Willem et al., 2006). In contrast Chen et al., used a dominant-negative erbB4 receptor expressed in NMSCs to block Neuregulin signalling and described increased Schwann cell proliferation, apoptosis and reduced numbers of axons per Remak bundle (Chen et al., 2003). These differences may be due to the fact that in the study of Chen et al., NRG1 signalling is blocked in the postnatal period/adulthood as opposed to late embryonic development. Secondly the Nrg1f/f;Nav1.8-Cre mice selectively lack sensory axon derived NRG1 however there is a possibility that NRG1 may have an autocrine action on Schwann cells which would be impaired in the dominant-negative erbB4 receptor mice but not in our animals (Raabe et al., 1996;Rosenbaum et al., 1997); direct evidence for an autocrine NRG1 loop in Schwann cells is however lacking (Meier et al., 1999). There is also a possibility that the dominant-negative erbB4 receptor may block erbB signalling from ligands other than NRG1 within peripheral nerve.

The survival and migration of Schwann cell precursors is dependent on axonally derived NRG1 type III (Wolpowitz et al., 2000;Dong et al., 1995;Meyer et al., 1997). At later stages of development Schwann cells develop autocrine survival circuits (Jessen and Mirsky, 2005). As expected we observed Schwann cell apoptosis in postnatal but not in the adult nerve (Grinspan et al., 1996) however there was no increase in the rate of Schwann cell apoptosis (at either time point) in Nrg1f/f;Nav1.8-Cre mice. Consistent with this observation there was no significant change in the number of Schwann cell nuclei (either non-myelinating or myelinating) within the adult sural nerve of Nrg1f/f;Nav1.8-Cre mice. In these animals where the number of sural axons remains the same and there are Remak bundles containing increased numbers of unmyelinated axons, one may have expected a reduction in the number of Schwann cells. One explanation for this apparent paradox is that these animals demonstrate a new population of large diameter axons which are in a 1:1 relationship with a Schwann cell but which have failed to be myelinated (see below). Large diameter axons which have failed to myelinate would be expected to be associated with more Schwann cells along the length of the axon because of the shorter internuclear distance between adjacent Schwann cells associated with unmyelinated axons (Griffin and Thompson, 2008). The occurrence of such axons alongside the increase in the size of Remak bundles appears to be in balance such that the total number of Schwann cells is unchanged in Nrg1f/f;Nav1.8-Cre mice.

The role of NRG1 in the myelination of large diameter sensory axons

During the development of the peripheral nervous system the level of axonally derived NRG1 type III determines the ensheathment fate of axons and the thickness of the myelin sheath (Michailov et al., 2004;Taveggia et al., 2005). Large diameter DRG cells which are myelinated show a higher level of NRG1 type III expression (Bermingham-McDonogh et al., 1997). NRG1 does not appear to have such a critical instructive role in myelination of axons within the CNS (Roy et al., 2007;Taveggia et al., 2005;Taveggia et al., 2008;Brinkmann et al., 2008). Consistent with a role of NRG1 in the myelination of sensory axons we found an increased proportion of unmyelinated axons in Nrg1f/f;Nav1.8-Cre mice as well as an increase in the g-ratio of nerve fibres within the sural nerve. Previous studies of animals haploinsufficient for NRG1 type III (Taveggia et al., 2005) or with a dominant negative erbB4 receptor expressed in myelinating glia (Chen et al., 2003) also found an increased g ratio The key role of NRG1 in myelination is emphasised by the observation in Nrg1f/f;Nav1.8-Cre mice of large diameter sensory axons in a 1:1 relationship with a Schwann cell and surrounded by a basal lamina but which have failed to myelinate.

The consequences of NRG1 ablation for the survival and functional properties of sensory neurons

It has been suggested that NMSCs support axons in a number of ways for instance in the provision of neurotrophic factors (Griffin and Thompson, 2008). We had therefore speculated that the increased numbers of axons per Remak bundle and the arrangement of C fibres in ‘polyaxonal pockets’ seen in Nrg1f/f;Nav1.8-Cre mice may lead to defective axonal maintenance. Although changes in the functional properties of axons were observed there was no evidence of axonal degeneration in these animals.

During early development of the peripheral nervous system (between E12.5 and 14.5) DRG cell survival is dependent on NRG1 mediated survival of Schwann cell precursors (Riethmacher et al., 1997). In animals with a dominant negative erbB4 receptor expressed in NMSCs in the postnatal period, Chen et al., (2003) described DRG cell death, reduced expression of the markers trkA and IB4 within DRG cells and progressive reduction in sensitivity to noxious thermal stimuli (all these changes were apparent by P60). In Nrg1f/f;Nav1.8-Cre mice there was no increase in DRG cell apoptosis and the total number of axons within the sural nerve was unchanged. The proportion of DRG cell profiles expressing histochemical markers for different DRG cell populations (NF200, CGRP and IB4 (Snider and McMahon, 1998)) were the same. In addition intraepidermal nerve fibre density (IENFD) which is reduced in the context of small fibre neuropathy both in rodents (Johnson et al., 2008) and man (McArthur et al., 1998) was unchanged. Therefore although sensory axonally derived NRG1 is required for the formation of the normal relationship between axons and Schwann cells in peripheral nerve, unlike Chen et al., (2003) we have not found a reciprocal relationship in which it drives a signal from the NMSC back to the sensory axon required for the structural integrity and long term survival of sensory neurons. There are clearly situations in which reciprocal interactions between C fibres and NMSCs are critical for the maintenance of axonal integrity as for example seen in L1-deficient mice in which defective ensheathment of unmyelinated axons leads to progressive axonal degeneration (Haney et al., 1999).

The altered axoglial relationships within Nrg1f/f;Nav1.8-Cre mice were reflected in the electrophysiological findings in these animals. As expected (given the myelination defect in a sub-set of larger diameter axons) there was a slowing in conduction velocity particularly at the lower part of the A fibre CV range. When recording from C fibres in Nrg1f/f;Nav1.8-Cre mice there was a population of faster conducting C fibres. These were found particularly in the range of 1 to 2 m/s and are likely to represent large diameter axons which have failed to be myelinated and so now conduct in the C fibre range. The poor segregation of axons by Schwann cell cytoplasm may be expected to lead to reduced electrical insulation of C fibres. But we did not observe any slowing of conduction or altered action potential morphology in C fibres. On examining sensory function in Nrg1f/f;Nav1.8-Cre mice we found that the sensitivity of these animals to noxious heat and cold were unchanged. The response to punctuate mechanical stimulation with von Frey hairs was also unaltered however the response to a noxious pressure stimulus was reduced. This may represent deficits in encoding by either Aδ (some of which have myelination deficits) or C fibres. Our failure to see a change in threshold to von Frey hair stimulation is not unexpected given that in animals where the same population of Nav1.8 Cre expressing DRG cells are ablated the von Frey threshold is also unaltered (Abrahamsen et al., 2008).

In conclusion axon-derived NRG1 has a key role in axoglial signalling between sensory axons and both non-myelinating and myelinating Schwann cells necessary for normal sensory function however is not required for the long term maintenance of sensory axons in adulthood.

Supplementary Material

Supplementary Figures

Acknowledgements

FRF is a BBSRC CASE PhD student part funded by Acorda Therapeutics Inc. DLHB is a Wellcome Intermediate Clinical Scientist (Grant No. 077074/z/05/z). CT and MT are PhD students of the Wellcome Trust funded London Pain Consortium. JNW acknowledges the support of the MRC. ANG and CB acknowledge the support of the German Science Foundation (SFB 665). We would like to thank Drs S. Hall and B. Murinson for advice on the analysis of peripheral nerve anatomy.

Reference List

  • Abrahamsen B, Zhao J, Asante CO, Cendan CM, Marsh S, Martinez-Barbera JP, Nassar MA, Dickenson AH, Wood JN. The cell and molecular basis of mechanical, cold, and inflammatory pain. Science. 2008;321:702–705. [PubMed]
  • Bermingham-McDonogh O, Xu YT, Marchionni MA, Scherer SS. Neuregulin Expression in PNS Neurons: Isoforms and Regulation by Target Interactions. Molecular and Cellular Neuroscience. 1997;10:184–195. [PubMed]
  • Brinkmann BG, Agarwal A, Sereda MW, Garratt AN, Muller T, Wende H, Stassart RM, Nawaz S, Humml C, Velanac V, Radyushkin K, Goebbels S, Fischer TM, Franklin RJ, Lai C, Ehrenreich H, Birchmeier C, Schwab MH, Nave KA. Neuregulin-1/ErbB signaling serves distinct functions in myelination of the peripheral and central nervous system. Neuron. 2008;59:581–595. [PMC free article] [PubMed]
  • Carraway KL, III, Weber JL, Unger MJ, Ledesma J, Yu N, Gassmann M, Lai C. Neuregulin-2, a new ligand of ErbB3/ErbB4-receptor tyrosine kinases. Nature. 1997;387:512–516. [PubMed]
  • Chen S, Rio C, Ji RR, Dikkes P, Coggeshall RE, Woolf CJ, Corfas G. Disruption of ErbB receptor signaling in adult non-myelinating Schwann cells causes progressive sensory loss. Nat Neurosci. 2003;6:1186–1193. [PubMed]
  • Dixon WJ. Efficient analysis of experimental observations. Annu Rev Pharmacol Toxicol. 1980;20:441–462. [PubMed]
  • Djouhri L, Fang X, Okuse K, Wood JN, Berry CM, Lawson SN. The TTX-resistant sodium channel Nav1.8 (SNS/PN3): expression and correlation with membrane properties in rat nociceptive primary afferent neurons. J Physiol. 2003;550:739–752. [PubMed]
  • Dong Z, Brennan A, Liu N, Yarden Y, Lefkowitz G, Mirsky R, Jessen KR. Neu differentiation factor is a neuron-glia signal and regulates survival, proliferation, and maturation of rat Schwann cell precursors. Neuron. 1995;15:585–596. [PubMed]
  • Falls DL. Neuregulins: functions, forms, and signaling strategies. Exp Cell Res. 2003;284:14–30. [PubMed]
  • Falls DL, Rosen KM, Corfas G, Lane WS, Fischbach GD. ARIA, a protein that stimulates acetylcholine receptor synthesis, is a member of the neu ligand family. Cell. 1993;72:801–815. [PubMed]
  • Garratt AN, Britsch S, Birchmeier C. Neuregulin, a factor with many functions in the life of a schwann cell. Bioessays. 2000a;22:987–996. [PubMed]
  • Garratt AN, Voiculescu O, Topilko P, Charnay P, Birchmeier C. A dual role of erbB2 in myelination and in expansion of the schwann cell precursor pool. J Cell Biol. 2000b;148:1035–1046. [PMC free article] [PubMed]
  • Golding JP, Bird C, McMahon S, Cohen J. Behaviour of DRG sensory neurites at the intact and injured adult rat dorsal root entry zone: postnatal neurites become paralysed, whilst injury improves the growth of embryonic neurites. Glia. 1999;26:309–323. [PubMed]
  • Goodearl AD, Davis JB, Mistry K, Minghetti L, Otsu M, Waterfield MD, Stroobant P. Purification of multiple forms of glial growth factor. J Biol Chem. 1993;268:18095–18102. [PubMed]
  • Griffin JW, Thompson WJ. Biology and pathology of nonmyelinating Schwann cells. Glia. 2008;56:1518–1531. [PubMed]
  • Grinspan JB, Marchionni MA, Reeves M, Coulaloglou M, Scherer SS. Axonal interactions regulate Schwann cell apoptosis in developing peripheral nerve: neuregulin receptors and the role of neuregulins. J Neurosci. 1996;16:6107–6118. [PubMed]
  • Haney CA, Sahenk Z, Li C, Lemmon VP, Roder J, Trapp BD. Heterophilic binding of L1 on unmyelinated sensory axons mediates Schwann cell adhesion and is required for axonal survival. J Cell Biol. 1999;146:1173–1184. [PMC free article] [PubMed]
  • Harari D, Tzahar E, Romano J, Shelly M, Pierce JH, Andrews GC, Yarden Y. Neuregulin-4: a novel growth factor that acts through the ErbB-4 receptor tyrosine kinase. Oncogene. 1999;18:2681–2689. [PubMed]
  • Hargreaves K, Dubner R, Brown F, Flores C, Joris J. A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain. 1988;32:77–88. [PubMed]
  • Holmes WE, Sliwkowski MX, Akita RW, Henzel WJ, Lee J, Park JW, Yansura D, Abadi N, Raab H, Lewis GD. Identification of heregulin, a specific activator of p185erbB2. Science. 1992;256:1205–1210. [PubMed]
  • Hu X, Hicks CW, He W, Wong P, Macklin WB, Trapp BD, Yan R. Bace1 modulates myelination in the central and peripheral nervous system. Nat Neurosci. 2006;9:1520–1525. [PubMed]
  • Jessen KR, Mirsky R. The origin and development of glial cells in peripheral nerves. Nat Rev Neurosci. 2005;6:671–682. [PubMed]
  • Johnson MS, Ryals JM, Wright DE. Early loss of peptidergic intraepidermal nerve fibers in an STZ-induced mouse model of insensate diabetic neuropathy. Pain. 2008;140:35–47. [PMC free article] [PubMed]
  • Jones BJ, Roberts DJ. A rotarod suitable for quantitative measurements of motor incoordination in naive mice. Naunyn Schmiedebergs Arch Exp Pathol Pharmakol. 1968;259:211. [PubMed]
  • Kwan KY, Allchorne AJ, Vollrath MA, Christensen AP, Zhang DS, Woolf CJ, Corey DP. TRPA1 contributes to cold, mechanical, and chemical nociception but is not essential for hair-cell transduction. Neuron. 2006;50:277–289. [PubMed]
  • Lauria G, Cornblath DR, Johansson O, McArthur JC, Mellgren SI, Nolano M, Rosenberg N, Sommer C. EFNS guidelines on the use of skin biopsy in the diagnosis of peripheral neuropathy. Eur J Neurol. 2005;12:747–758. [PubMed]
  • Li L, Cleary S, Mandarano MA, Long W, Birchmeier C, Jones FE. The breast proto-oncogene, HRGalpha regulates epithelial proliferation and lobuloalveolar development in the mouse mammary gland. Oncogene. 2002;21:4900–4907. [PubMed]
  • Marchionni MA, Goodearl AD, Chen MS, Bermingham-McDonogh O, Kirk C, Hendricks M, Danehy F, Misumi D, Sudhalter J, Kobayashi K. Glial growth factors are alternatively spliced erbB2 ligands expressed in the nervous system. Nature. 1993;362:312–318. [PubMed]
  • McArthur JC, Stocks EA, Hauer P, Cornblath DR, Griffin JW. Epidermal nerve fiber density: normative reference range and diagnostic efficiency. Arch Neurol. 1998;55:1513–1520. [PubMed]
  • Meier C, Parmantier E, Brennan A, Mirsky R, Jessen KR. Developing Schwann Cells Acquire the Ability to Survive without Axons by Establishing an Autocrine Circuit Involving Insulin-Like Growth Factor, Neurotrophin-3, and Platelet-Derived Growth Factor-BB. J Neurosci. 1999;19:3847–3859. [PubMed]
  • Meyer D, Yamaai T, Garratt A, Riethmacher-Sonnenberg E, Kane D, Theill LE, Birchmeier C. Isoform-specific expression and function of neuregulin. Development. 1997;124:3575–3586. [PubMed]
  • Meyer D, Birchmeier C. Multiple essential functions of neuregulin in development. Nature. 1995;378:386–390. [PubMed]
  • Michailov GV, Sereda MW, Brinkmann BG, Fischer TM, Haug B, Birchmeier C, Role L, Lai C, Schwab MH, Nave KA. Axonal neuregulin-1 regulates myelin sheath thickness. Science. 2004;304:700–703. [PubMed]
  • Morris JK, Lin W, Hauser C, Marchuk Y, Getman D, Lee KF. Rescue of the cardiac defect in ErbB2 mutant mice reveals essential roles of ErbB2 in peripheral nervous system development. Neuron. 1999;23:273–283. [PubMed]
  • Murakawa Y, Zhang W, Pierson CR, Brismar T, Ostenson CG, Efendic S, Sima AA. Impaired glucose tolerance and insulinopenia in the GK-rat causes peripheral neuropathy. Diabetes Metab Res Rev. 2002;18:473–483. [PubMed]
  • Murinson BB, Griffin JW. C-fiber structure varies with location in peripheral nerve. J Neuropathol Exp Neurol. 2004;63:246–254. [PubMed]
  • Nave KA, Salzer JL. Axonal regulation of myelination by neuregulin 1. Curr Opin Neurobiol. 2006;16:492–500. [PubMed]
  • Peles E, Bacus SS, Koski RA, Lu HS, Wen D, Ogden SG, Levy RB, Yarden Y. Isolation of the neu/HER-2 stimulatory ligand: a 44 kd glycoprotein that induces differentiation of mammary tumor cells. Cell. 1992;69:205–216. [PubMed]
  • Raabe TD, Clive DR, Neuberger TJ, Wen D, DeVries GH. Cultured neonatal Schwann cells contain and secrete neuregulins. J Neurosci Res. 1996;46:263–270. [PubMed]
  • Riethmacher D, Sonnenberg-Riethmacher E, Brinkmann V, Yamaai T, Lewin GR, Birchmeier C. Severe neuropathies in mice with targeted mutations in the ErbB3 receptor. Nature. 1997;389:725–730. [PubMed]
  • Rosenbaum C, Karyala S, Marchionni MA, Kim HA, Krasnoselsky AL, Happel B, Isaacs I, Brackenbury R, Ratner N. Schwann cells express NDF and SMDF/n-ARIA mRNAs, secrete neuregulin, and show constitutive activation of erbB3 receptors: evidence for a neuregulin autocrine loop. Exp Neurol. 1997;148:604–615. [PubMed]
  • Roy K, Murtie JC, El-Khodor BF, Edgar N, Sardi SP, Hooks BM, oit-Marand M, Chen C, Moore H, O'Donnell P, Brunner D, Corfas G. Loss of erbB signaling in oligodendrocytes alters myelin and dopaminergic function, a potential mechanism for neuropsychiatric disorders. Proc Natl Acad Sci U S A. 2007;104:8131–8136. [PubMed]
  • Sharghi-Namini S, Turmaine M, Meier C, Sahni V, Umehara F, Jessen KR, Mirsky R. The Structural and Functional Integrity of Peripheral Nerves Depends on the Glial-Derived Signal Desert Hedgehog. J Neurosci. 2006;26:6364–6376. [PubMed]
  • Snider WD, McMahon SB. Tackling pain at the source: new ideas about nociceptors. Neuron. 1998;20:629–632. [PubMed]
  • Stirling LC, Forlani G, Baker MD, Wood JN, Matthews EA, Dickenson AH, Nassar MA. Nociceptor-specific gene deletion using heterozygous NaV1.8-Cre recombinase mice. Pain. 2005;113:27–36. [PubMed]
  • Takesue EI, Schaefer W, Jukniewicz E. Modification of the Randall-Selitto analgesic apparatus. J Pharm Pharmacol. 1969;21:788–789. [PubMed]
  • Taveggia C, Thaker P, Petrylak A, Caporaso GL, Toews A, Falls DL, Einheber S, Salzer JL. Type III neuregulin-1 promotes oligodendrocyte myelination. Glia. 2008;56:284–293. [PubMed]
  • Taveggia C, Zanazzi G, Petrylak A, Yano H, Rosenbluth J, Einheber S, Xu X, Esper RM, Loeb JA, Shrager P, Chao MV, Falls DL, Role L, Salzer JL. Neuregulin-1 Type III Determines the Ensheathment Fate of Axons. Neuron. 2005;47:681–694. [PMC free article] [PubMed]
  • Wen D, Peles E, Cupples R, Suggs SV, Bacus SS, Luo Y, Trail G, Hu S, Silbiger SM, Levy RB. Neu differentiation factor: a transmembrane glycoprotein containing an EGF domain and an immunoglobulin homology unit. Cell. 1992;69:559–572. [PubMed]
  • Wen D, Suggs SV, Karunagaran D, Liu N, Cupples RL, Luo Y, Janssen AM, Ben-Baruch N, Trollinger DB, Jacobsen VL. Structural and functional aspects of the multiplicity of Neu differentiation factors. Mol Cell Biol. 1994;14:1909–1919. [PMC free article] [PubMed]
  • White FA, Keller-Peck CR, Knudson CM, Korsmeyer SJ, Snider WD. Widespread elimination of naturally occurring neuronal death in Bax-deficient mice. J Neurosci. 1998;18:1428–1439. [PubMed]
  • Willem M, Garratt AN, Novak B, Citron M, Kaufmann S, Rittger A, DeStrooper B, Saftig P, Birchmeier C, Haass C. Control of peripheral nerve myelination by the beta-secretase BACE1. Science. 2006;314:664–666. [PubMed]
  • Woldeyesus MT, Britsch S, Riethmacher D, Xu L, Sonnenberg-Riethmacher E, bou-Rebyeh F, Harvey R, Caroni P, Birchmeier C. Peripheral nervous system defects in erbB2 mutants following genetic rescue of heart development. Genes Dev. 1999;13:2538–2548. [PubMed]
  • Wolpowitz D, Mason TB, Dietrich P, Mendelsohn M, Talmage DA, Role LW. Cysteine-rich domain isoforms of the neuregulin-1 gene are required for maintenance of peripheral synapses. Neuron. 2000;25:79–91. [PubMed]
  • Yang X, Arber S, William C, Li L, Tanabe Y, Jessell TM, Birchmeier C, Burden SJ. Patterning of muscle acetylcholine receptor gene expression in the absence of motor innervation. Neuron. 2001;30:399–410. [PubMed]
  • Zhang D, Sliwkowski MX, Mark M, Frantz G, Akita R, Sun Y, Hillan K, Crowley C, Brush J, Godowski PJ. Neuregulin-3 (NRG3): a novel neural tissue-enriched protein that binds and activates ErbB4. Proc Natl Acad Sci U S A. 1997;94:9562–9567. [PubMed]