PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Helicobacter. Author manuscript; available in PMC 2010 May 17.
Published in final edited form as:
PMCID: PMC2871674
NIHMSID: NIHMS183233

Helicobacter pylori–pulsed dendritic cells induce H. pylori–specific immunity in mice

Abstract

Background

The growing concern over the emergence of antibiotic-resistant Helicobacter pylori infection is propelling the development of an efficacious vaccine to control this highly adaptive organism.

Aim

We studied the use of a dendritic cell (DC)–based vaccine against H. pylori infection in mice.

Methods

The cellular immune responses to murine bone marrow–derived DCs pulsed with phosphate-buffered saline (PBS-DC) or live H. pylori SS1 (HP-DC) were assessed in vitro and in vivo. The protective immunity against H. pylori SS1 oral challenge was compared between HP-DC or PBS-DC immunized mice. The effect of regulatory T cell (Treg) depletion by anti-CD25 antibody on HP-DC vaccine efficacy was also evaluated.

Results

HP-DC induced a Th1-dominant response in vitro. In vivo, HP-DC immunized mice were characterized by a mixed Th1/Th2 peripheral immune response. However, in the stomach, HP-DC immunized mice expressed a higher level of IFN-γ compared to PBS-DC immunized mice; no difference was found for IL-5 expressions in the stomach. A lower bacterial colonization post H. pylori challenge was observed in HP-DC immunized mice compared to PBS-DC immunized mice with no significant difference in gastritis severity. H. pylori–specific Th1 response and protective immunity were further enhanced in vivo by depletion of Treg with anti-CD25 antibody.

Conclusion

DC-based anti–H. pylori vaccine induced H. pylori–specific helper T cell responses capable of limiting bacterial colonization. Our data support the critical role of effector cellular immune response in the development of H. pylori vaccine.

Keywords: vaccine, dendritic cells, Th1/Th2, regulatory T cells, CD25 depletion

Introduction

Helicobacter pylori (H. pylori) causes chronic gastritis in most infected individuals and it is associated with gastroduodenal ulcers and malignancies. Although H. pylori can be eradicated by a combination of antibiotics and proton pump inhibitors, the emergence of antibiotic-resistant H. pylori strains [13] remains a significant threat to the half of the world’s population infected with this pathogen. An improved understanding of the interplay between H. pylori and the host immune response will contribute to the development of an effective immunotherapy targeting H. pylori.

Studies in mice have revealed that IL-12, a type 1 helper T cell (Th1)-promoting cytokine, plays a critical role in vaccine-induced protective immunity [4, 5]. We have previously shown that dendritic cells (DCs) pulsed with H. pylori (HP-DC) secrete lower levels of IL-12 than Escherichia coli or Acinetobacter lwoffi, possibly leading to an ineffective host response and failure to eradicate H. pylori [6]. Since immunization with ex vivo antigen-pulsed DCs leads to the induction of in vivo antigen-specific protective immunity against tumors [7], we speculate that an HP-DC vaccine may prime effective protective immunity against H. pylori. Although several prototype vaccines for H. pylori have been assessed with some degree of success [8, 9], the advantage of DC vaccine is the priming of potent adaptive immunity which, in tumor models, were shown to be more efficacious than non-DC based vaccines [10]. The goal of the current study was to examine the efficacy of an HP-DC vaccine against H. pylori infection in vivo.

Our results showed that HP-DC stimulate the in vitro proliferation of Th1 cells. In vivo, HP-DC stimulated H. pylori–specific Th responses, including Th1 and Th2, and a lower bacterial colonization was observed in HP-DC mice compared to DCs pulsed with phosphate-buffered saline (PBS-DC). Depletion of Tregs with anti-CD25 antibodies in mice immunized with HP-DC augments H. pylori–specific immunity. These data indicate that the goal of H. pylori vaccine should include both augmentation of Th1 effector response and controlled Treg response.

Materials and Methods

Mice

Specific pathogen–free female C57BL/6 mice aged 8–10 wk were purchased from Jackson Laboratory (Bar Harbor, ME) and housed in the Animal Maintenance Facility at the University of Michigan Health System. Experiments were conducted on mice aged 10–14 wk. All animal experiments were approved by the University of Michigan Animal Care and Use Committee.

Media, cytokines, and neutralizing antibodies

Complete medium (CM) consisted of RPMI-1640 with 10% heat-inactivated fetal calf serum, 2 mM glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin. Two recombinant cytokines (R&D Systems, Minneapolis, MN) were diluted in CM: mouse granulocyte/macrophage colony-stimulating factor (GM-CSF, 10 ng/mL) and mouse IL-4 (10 ng/mL). The antibodies used to deplete CD25+ cells were purified using protein G columns (Amersham Biosciences, Piscataway, NJ) from the supernatant of the PC61 hybridoma cell line (American Type Culture Collection, Manassas, VA).

Bacterial strains and culture conditions

H. pylori (SS1 strain) organisms were grown on Campylobacter-selective agar (BD Diagnostics, Bedford, MA) supplemented with 5% sterile horse blood, trimethoprim (5 µg/mL), vancomycin (10 µg/mL), and nystatin (10 µg/mL) [11] for 2 days at 37°C in a humidified microaerophilic chamber (BBL Gas System, with CampyPak Plus packs, BD Microbiology, Sparks, MD).

Generation of bone marrow–derived DCs

Erythrocyte-depleted murine bone marrow cells were cultured in CM with GM-CSF (10 ng/mL) and IL-4 (10 ng/mL) at 1 × 106 cells/mL [12]. On day 6, nonadherent bone marrow–derived DCs were harvested by vigorous pipetting and enriched by gradient centrifugation using the Optiprep density solution (Sigma, St. Louis, MO). The low-density interface containing the DCs was collected by gentle aspiration. The recovered bone marrow–derived DCs were washed twice with RPMI-1640 and cultured in CM with GM-CSF (10 ng/mL).

Induction of proliferative T-cell responses in vitro

After overnight stimulation with H. pylori SS1 (1×108 CFU/mL) followed by washing to remove bacteria, irradiated (5000 rads) bone marrow–derived DCs (1×104 cells/mL) were cocultured with naïve syngeneic C57BL/6 splenocytes (1 × 105 cells/mL) for 48 h. Tritiated deoxythymidine (Amersham Biosciences) was added to each microtiter well (1 µCi/well) and the plates were incubated for 24 h [7]. The plates were harvested at completion and the radioactivity was measured using a scintillation counter. Responses were reported as the mean cpm ± SEM from duplicate samples in three separate experiments.

Animal studies

Naïve C57BL/6 mice (n=15 per group) were given an intraperitoneal (IP) injection of H. pylori SS1 (1×108 CFU/mL)–stimulated DCs (106 cells per injection) on day 0 and day 14. PBS-treated unstimulated DCs served as controls. Beginning on day 21, all mice were infected with H. pylori SS1 – an oral gavage of 108 colony forming units (CFU) per mL live organisms was given to each mouse, three times over 1 wk. Mice were sacrificed 120 days after the first infection on day 0 and spleens and stomachs were removed for analyses. The stomachs were cut along the greater curvature into 2-mm strips that included fundic and antral tissue. Paraffin sections were prepared for H&E. The spleens were flushed with RPMI-1640 and CD4+ T cells were isolated using MACS microbeads (Miltenyi Biotech, Auburn, CA). Histological scores were determined as mean ± SEM according to the Eaton scoring method [13]. The pathologist was blinded to the experimental manipulation of each mouse to eliminate observer bias.

Delayed-type hypersensitivity measurement

To measure delayed-type hypersensitivity, mice were given 10 µg of H. pylori sonicate by injection into the right hind footpad 1 day before sacrifice. The left hind footpad was given an equal volume of sterile saline. Footpad thickness was measured with a dial thickness gauge 24 h later, immediately before sacrifice, and the difference in thickness between the control and sonicate-treated footpads was recorded.

Cytometric bead analysis

Mouse Th1/Th2 Cytokine Cytometric Bead Array Kit (BD Biosciences PharMingen, San Diego, CA) was used according to the manufacturer’s instructions. Briefly, cell culture supernatants and standards were incubated with capture beads and PE Detection Reagent and analyzed with the BD FACSCalibur™ system (BD Biosciences, San Jose, CA) using software supplied by the manufacturer.

Preparation of conditioned medium and whole cell sonicate

Bacteria were grown overnight at a concentration of 1 × 109 CFU/mL. H. pylori was grown in brain–heart infusion medium. The cultures were spun down for 15 min at 36,000 rpm. The culture supernatants were designated as conditioned media. The pellets were sonicated on ice as previously described [14] and then spun down for 10 min at 5000 rpm. The supernatants were stored and designated as bacterial sonicate.

Quantification of Helicobacter colonization and gastric tissue mRNA for IFN-γ and IL-5 by real-time polymerase chain reaction (PCR)

A standard curve was generated by extracting total RNA, using TRIzol Reagent (Invitrogen, Carlsbad, CA), from H. pylori SS1 bacterial cultures with densities ranging from 103–109 total bacteria. Total RNA also was isolated from stomach tissue using TRIzol Reagent. Primer pairs C97 and C98 [15] were used to amplify the 16S rRNA species that is specific for Helicobacter, generating an amplicon of about 400 base pairs [16]. Additional primer sequences used were: IFN-γ (sense: GGCTGTTTCTGGCT GTTACTGCCACG, antisense: GACAATCTCTTCCCCACCCC GAATCAG) and IL-5 (sense: GCAATGGAAGGCTGAGGCTG, antisense: GGGTATGTGATCCTCCTGCGT C). PCR amplifications were performed in a total volume of 25 µL, containing 10 5 PCR buffer with MgCl2, 10 nM dNTPs, 200 nM primers, 5 µL cDNA, 100 nM Taq polymerase GOLD, and 2.5 µL Sybr Green (Molecular Probes, Carlsbad, CA). Each PCR amplification was performed in duplicate wells in a Bio-Rad I-Cycler (I-Cycler IQ Real-Time PCR Detection System, Bio-Rad Laboratories, Hercules, CA) at 94°C for 10 min, followed by 35 two-temperature cycles at 94°C for 1 min and 55°C for 1 min.

Fluorescence-activated cell sorting (FACS)

DCs were washed twice with ice-cold PBS containing 0.5% bovine serum albumin and sodium azide. After a 30-min incubation with Fc Block (1 µg/100 µL, BD Biosciences PharMingen), the cells were incubated with either FITC and/or PE-conjugated antibodies or with isotype control antibodies (1:100 dilution). The cells were washed, resuspended in ice-cold 2% paraformaldehyde, and analyzed using a Coulter XL Flow Cytometer (Beckman Coulter, Miami, FL). For intracellular cytokine staining, cells were permeabilized with Perm/Fix Solution (BD Biosciences PharMingen) before staining. Both dot plots and histograms were obtained using WinMDI version 2.8. The percentage of CD4+CD25+ Treg determination was measured using Mouse Regulatory T Cell Staining Kit (eBioscience, San Diego, CA).

H. pylori–specific in vitro stimulation

Erythrocyte-depleted splenic CD4+ T cells (1×105 cells/mL) were isolated using MACS (Miltenyi Biotech) and then stimulated for 7 days with syngeneic bone marrow–derived DCs (1 × 106 cells/mL) and H. pylori SS1 sonicate (5 µg/mL). CD4+ T cells stimulated with DCs alone or H. pylori sonicate alone served as controls.

Enzyme-linked immunosorbent spot (ELISpot)

In vitro stimulated H. pylori–specific CD4+ T cells were cultured with bone marrow–derived DCs (1:10) and H. pylori SS1 sonicate (10 µg/mL) for 24 h (to measure IFN-γ secretion) or for 48 h (to measure IL-5 secretion). ELISpot (BD Biosciences Pharmingen) assays were performed.

In vivo depletion of regulatory T cells (Tregs)

C57BL/6 mice (n=9 or 10 per group) were treated IP with either PBS or a single 1-mg dose of anti-CD25 mAb (PC61). The success of Treg depletion was determined after 30 days by FACS analysis of isolated splenocytes.

Statistical analysis

Statistical significance was determined by nonparametric Student t test using commercially available software (PRISM, GraphPad, San Diego, CA). P < 0.05 was considered significant.

Results

H. pylori–pulsed DCs stimulated Th1 response in vitro

The activation of antigen-presenting cells by bacterial antigens can be measured by the surface expression of costimulatory molecules (e.g., CD80 and CD86) and by the level of intracellular cytokine expression. To determine whether H. pylori SS1 activates DCs, bone marrow–derived DCs were cocultured with live H. pylori SS1 or PBS for 18 h and cell surface expressions of CD40, CD80, and CD86 and intracellular cytokine expression were determined by FACS analysis. As shown in Figure 1A, H. pylori stimulated a significant upregulation of IL-12, which suggests that bone marrow–derived DCs recognize H. pylori in vitro and may prime a Th1 response. To determine the type of Th response induced by HP-DC, we measured the ability of bone marrow–derived DCs to stimulate T cell proliferation of splenocytes and the Th1/Th2 cytokine profiles of the proliferating cells. HP-DC induced significantly higher levels of cellular proliferation than PBS-DC in a dose-dependent fashion (Figure 1B and C). The cytokine profiles of the proliferating cells as determined by cytometric bead assay showed a Th1-dominant response with increased levels of TNF-α and IFN-γ and no measurable levels of IL-4 or IL-5 (Figure 1D). These data suggest that HP-DC induce a Th1-dominant response in vitro, a finding that is consistent with reports using human monocyte-derived DCs [17, 18].

Figure 1Figure 1
H. pylori–pulsed DCs induce Th1 helper response in vitro

HP-DC induced a delayed-type hypersensitivity reaction against H. pylori sonicate in vivo

Research suggests that the induction of an H. pylori–specific Th1 response is a crucial component of protective immunity against H. pylori [4, 5]. Since HP-DC prime a Th1 response in vitro, we examined this response in vivo. Using a general protocol for inducing protective anti-tumor immunity, mice were injected IP with HP-DC or PBS-PBS-DC. A booster injection was given 2 wk later. The mice were then challenged with live H. pylori to assess the induction of anti–H. pylori immunity. After footpad injection with H. pylori SS1 sonicate to measure H. pylori–specific delayed-type hypersensitivity reaction, a significant increase in footpad thickness was measured in the HP-DC injected mice compared to the PBS-DC injected mice (Figure 2). These data indicate that HP-DC induce H. pylori–specific cellular immune responses.

Figure 2
H. pylori–pulsed DCs (HP-DC) induce a delayed-type hypersensitivity reaction to H. pylori sonicate

Induction of H. pylori–specific Th1 and Th2 responses in vivo

To determine the ability of HP-DC to induce H. pylori–specific adaptive immune responses, CD4+ T cells isolated from splenocytes of PBS-DC and HP-DC mice were stimulated ex vivo with H. pylori sonicate. Naïve BM-DCs were included as stimulators. ELISpot assays showed significantly higher numbers of H. pylori–specific Th1 (i.e., IFN-γ producing CD4+) and Th2 (i.e., IL-5 producing CD4+) cells in HP-DC mice (Figure 3A and B). Thus, HP-DC are capable of inducing Th1 and Th2 responses in vivo.

Figure 3
Induction of in vivo H. pylori–specific Th1 and Th2 responses by HP-DC

Induction of a Th1-dominant gastric response in HP-DC mice

To characterize further the effective of HP-DC on host response to H. pylori infection, total gastric RNA of mice was assessed for IFN-γ and IL-5 expressions in order to better define the Th1/Th2 responses at the gastric tissue level. We found increased gastric IFN-γ mRNA in HP-DC mice compared to PBS-DC mice and no measurable difference for the IL-5 mRNA expression (Fig. 4A). Despite detecting a mixed Th1/Th2 response in the peripheral (spleen) immune compartment, HP-DC induced a Th1-dominant response in the gastric tissue. This finding indicates HP-DC primes a Th1-dominant response in the gastric tissue despite a mixed Th1/Th2 in the periphery. Therefore, it is critical to evaluate the gastric Th response separately from peripheral Th response when determining in vivo H. pylori specific immunity.

Figure 4Figure 4
Induction of a Th1-dominant gastric immune response that limited H. pylori colonization

A reduced H. pylori colonization was observed in HP-DC mice compared to PBS-DC mice

To determine whether the H. pylori–specific Th1-dominant response induced by HP-DC could limit H. pylori colonization, we performed quantitative reverse transcriptase (RT)-PCR, which is a sensitive method of determining the number of bacterial CFU in the stomach. There was a trend toward lower bacterial colonization in HP-DC mice compared to PBS-DC mice (P=0.1) (Figure 4B). To evaluate whether this trend was due to more severe gastritis in HP-DC mice, the degree of gastritis also was assessed using the Eaton gastritis score for H. pylori–induced gastritis [14]. Quantification of H. pylori by the culture method showed a similar trend (data not shown). No significant differences in gastritis or polymorphonuclear neutrophil infiltration scores were measured (Figure 4C–D). Thus, HP-DC induced a H. pylori-specific Th response and reduced H. pylori colonization.

Depletion of Tregs by CD25 antibody further enhanced the ability of HP-DC mice to prime H. pylori–specific immunity

H. pylori infected individuals have been shown to express higher levels of Foxp3, a regulatory T cell (Treg) marker. We speculate that a depletion of Tregs by the anti-CD25 antibody PC61 may further enhance the ability of HP-DC to limit H. pylori colonization. To examine this, PC61-treated or non-treated mice vaccinated with HP-DC were challenged with H. pylori and then analyzed 7 days post infection. We found PC61-treated mice had a lower percentage of splenic CD4+CD25+ T cells (Figure 5A–B) and an increased H. pylori–specific Th1 response (Figure 5C) with a significant reduction of H. pylori colonization in the stomach (P = 0.0028) compared to non–PC61-treated HP-DC immunized mice (Figure 5D). No significant gastritis was noted at this early time point in either group (data no shown). These data indicate further enhancement of H. pylori-specific Th1 response by removal of Tregs.

Figure 5
Depletion of Tregs by CD25 antibody enhanced the ability of HP-DC mice to prime H. pylori–specific immunity

Discussion

Research has shown that human DCs pulsed with H. pylori stimulate a Th1-dominant response [17, 18]. Although the use of DC vaccine as a routine immunization strategy for H. pylori infection may appear impractical and too technically complex, the role of DC-based vaccine may benefit patients infected with antibiotic-resistant H. pylori, especially those with mucosa-associated lymphoid tissue (MALT) lymphoma in which eradication of H. pylori may lead to disease regression [19]. We explored the possibility of inducing bacteria-specific immunity with a DC-based vaccine in a mouse model of H. pylori infection. Similar to human DCs, mouse bone marrow–derived DCs pulsed with live H. pylori stimulated a Th1-dominant response. HP-DC mice challenged with H. pylori exhibit an H. pylori–specific delayed-type hypersensitivity reaction, whereas PBS-DC mice challenged with H. pylori do not. Analysis of HP-DC–stimulated helper T cell responses showed that HP-DC induce a mixed peripheral Th1/Th2 response but a Th1-dominant gastric response that lowered H. pylori colonization. We also showed that enhancing the H. pylori-specific Th1 response by Treg depletion further augmented H. pylori immunity.

Otsu et al. reported that the transfer of H. pylori–pulsed immortalized murine DC cell line (JAWS II) effectively induced therapeutic immunity against H. pylori infection (reported as a 2-log reduction in bacterial colonization) [20]. In our study, HP-DC induced a 1.25-log reduction in bacterial colonization compared to PBS-DC. The difference in these results may be explained by their use of immortalized DC cell lines versus bone marrow-derived primary DCs used in this study. Immortalized cells may have higher efficacy in vivo due to prolonged antigen priming. Another difference between the two studies is the methods used to quantify H. pylori colonization (i.e., culture by Otsu et al. versus real-time PCR in this study). In our laboratory, we find that real-time PCR quantification of H. pylori colonization is more sensitive than culturing methods (data not shown).

The current study shed light on the complexity of vaccine development against H. pylori. As the debate over the requirement of a Th1 response for vaccine-induced protective immunity continues [4, 5], our finding supports the current paradigm that an effective Th1 response protects against H. pylori infection. Ineffective Th1 effector response, suggested by our previous study of a defective Th1 priming by dendritic cells [6], may result in the persistent colonization and the development of chronic gastritis. Using a potent inducer of antigen-specific cellular immunity with DC vaccine, we show that H. pylori-specific Th1 response can be induced in vivo. A Th2 response also was augmented by DC vaccine but its role is less well defined as protective immunity could be achieved in B cell deficient mice [21, 22]. Additional support for the importance of effector Th1 response was reported by Rad et al. where depletion of CD4+CD25+ Tregs correlated with a reduction in H. pylori colonization [23]. In our study, a depletion of CD4+CD25+ Tregs further enhances DC vaccine primed H. pylori-specific Th1 response and reduced bacterial colonization. As an intact Th1 response is essential for vaccine induced protection against H. pylori, a balanced, non-restrictive Treg response may be the other determinant of whether H. pylori sterilization can be achieved. Understanding the interaction between H. pylori and host immune system with respect to induction of Th and Treg response will be critical for the success of a vaccination strategy. Furthermore, since Treg is also involved in regulation of gastric inflammation [23], manipulations to up-regulate this response may prove to be beneficial in suppressing chronic gastritis.

In summary, our study shows that DC-based vaccine is capable of inducing protective H. pylori–specific immunity. Treg depletion with anti-CD25 antibodies enhanced the ability of DC vaccine to prime a H. pylori-specific immunity. Our study supports the critical role of a Th1-skewed response in anti-H. pylori immunity. These studies may shed light on novel strategies to modulate the host response to eradicate H. pylori infection.

Acknowledgements

The preliminary results of this study was presented orally at the 2004 Digestive Disease Week and published in abstract form in Gastroenterology (Vol. 126(4) Suppl. 2: A790). This study was supported by grants from the National Institutes of Health (1 KO8 DK0669907-01 and P30 DK034933), the Foundation of Digestive Health and Nutrition (Fellow-to-Faculty Transition Award), and the GlaxoSmithKline Institute of Digestive Health (Basic Research Award).

References

1. Fujioka T, Yoshiiwa A, Okimoto T, Kodama M, Murakami K. Guidelines for the management of Helicobacter pylori infection in Japan: current status and future prospects. J Gastroenterol. 2007 Jan;42 Suppl 17:3–6. [PubMed]
2. Raymond J, Burucoa C, Pietrini O, Bergeret M, Decoster A, Wann A, et al. Clarithromycin resistance in Helicobacter pylori strains isolated from French children: prevalence of the different mutations and coexistence of clones harboring two different mutations in the same biopsy. Helicobacter. 2007 Apr;12(2):157–163. [PubMed]
3. Hu CT, Wu CC, Lin CY, Cheng CC, Su SC, Tseng YH, et al. Resistance rate to antibiotics of Helicobacter pylori isolates in eastern Taiwan. J Gastroenterol Hepatol. 2007 May;22(5):720–723. [PubMed]
4. Akhiani AA, Pappo J, Kabok Z, Schon K, Gao W, Franzen LE, et al. Protection against Helicobacter pylori infection following immunization is IL-12-dependent and mediated by Th1 cells. J Immunol. 2002 Dec 15;169(12):6977–6984. [PubMed]
5. Garhart CA, Heinzel FP, Czinn SJ, Nedrud JG. Vaccine-induced reduction of Helicobacter pylori colonization in mice is interleukin-12 dependent but gamma interferon and inducible nitric oxide synthase independent. Infect Immun. 2003 Feb;71(2):910–921. [PMC free article] [PubMed]
6. Kao JY, Rathinavelu S, Eaton KA, Bai L, Zavros Y, Takami M, et al. Helicobacter pylori-secreted factors inhibit dendritic cell IL-12 secretion: a mechanism of ineffective host defense. Am J Physiol Gastrointest Liver Physiol. 2006 Jul;291(1):G73–G81. [PubMed]
7. Kao JY, Zhang M, Chen CM, Pierzchala A, Chen JJ. Aberrant T helper cell response in tumor-bearing mice limits the efficacy of dendritic cell vaccine. Immunol Lett. 2006 May 15;105(1):16–25. [PubMed]
8. Permin H, Andersen LP. Inflammation, immunity, and vaccines for Helicobacter infection. Helicobacter. 2005;10 Suppl 1:21–25. [PubMed]
9. Hoffelner H, Rieder G, Haas R. Helicobacter pylori vaccine development: Optimisation of strategies and importance of challenging strain and animal model. Int J Med Microbiol. 2007 Aug 20; [PubMed]
10. Saito H, Frleta D, Dubsky P, Palucka AK. Dendritic cell-based vaccination against cancer. Hematology/oncology clinics of North America. 2006 Jun;20(3):689–710. [PubMed]
11. Zavros Y, Rathinavelu S, Kao JY, Todisco A, Del Valle J, Weinstock JV, et al. Treatment of Helicobacter gastritis with IL-4 requires somatostatin. Proceedings of the National Academy of Sciences of the United States of America. 2003 Oct 28;100(22):12944–12949. [PubMed]
12. Kao JY, Gong Y, Chen CM, Zheng QD, Chen JJ. Tumor-derived TGF-beta reduces the efficacy of dendritic cell/tumor fusion vaccine. J Immunol. 2003 Apr 1;170(7):3806–3811. [PubMed]
13. Eaton KA, Logan SM, Baker PE, Peterson RA, Monteiro MA, Altman E. Helicobacter pylori with a truncated lipopolysaccharide O chain fails to induce gastritis in SCID mice injected with splenocytes from wild-type C57BL/6J mice. Infect Immun. 2004 Jul;72(7):3925–3931. [PMC free article] [PubMed]
14. Eaton KA, Mefford M, Thevenot T. The role of T cell subsets and cytokines in the pathogenesis of Helicobacter pylori gastritis in mice. J Immunol. 2001 Jun 15;166(12):7456–7461. [PubMed]
15. Fox JG, Dewhirst FE, Shen Z, Feng Y, Taylor NS, Paster BJ, et al. Hepatic Helicobacter species identified in bile and gallbladder tissue from Chileans with chronic cholecystitis. Gastroenterology. 1998 Apr;114(4):755–763. [PubMed]
16. Fox JG, Beck P, Dangler CA, Whary MT, Wang TC, Shi HN, et al. Concurrent enteric helminth infection modulates inflammation and gastric immune responses and reduces helicobacter-induced gastric atrophy. Nat Med. 2000 May;6(5):536–542. [PubMed]
17. Hafsi N, Voland P, Schwendy S, Rad R, Reindl W, Gerhard M, et al. Human dendritic cells respond to Helicobacter pylori, promoting NK cell and Th1-effector responses in vitro. J Immunol. 2004 Jul 15;173(2):1249–1257. [PubMed]
18. Guiney DG, Hasegawa P, Cole SP. Helicobacter pylori preferentially induces interleukin 12 (IL-12) rather than IL-6 or IL-10 in human dendritic cells. Infect Immun. 2003 Jul;71(7):4163–4166. [PMC free article] [PubMed]
19. Fischbach W, Goebeler-Kolve M, Ruskone-Fourmestraux A, Wundisch T, Neubauer A, Raderer M, et al. Most patients with minimal histological residuals of gastric MALT lymphoma after successful eradication of Helicobacter pylori can be safely managed by a watch-and-wait strategy. Experience from a large international series. Gut. 2007 Jul 16; [PMC free article] [PubMed]
20. Otsu S, Gotoh K, Yamashiro T, Yamagata J, Shin K, Fujioka T, et al. Transfer of antigen-pulsed dendritic cells induces specific T-Cell proliferation and a therapeutic effect against long-term Helicobacter pylori infection in mice. Infect Immun. 2006 Feb;74(2):984–993. [PMC free article] [PubMed]
21. Sutton P, Wilson J, Kosaka T, Wolowczuk I, Lee A. Therapeutic immunization against Helicobacter pylori infection in the absence of antibodies. Immunol Cell Biol. 2000 Feb;78(1):28–30. [PubMed]
22. Blanchard TG, Czinn SJ, Redline RW, Sigmund N, Harriman G, Nedrud JG. Antibody-independent protective mucosal immunity to gastric helicobacter infection in mice. Cell Immunol. 1999 Jan 10;191(1):74–80. [PubMed]
23. Rad R, Brenner L, Bauer S, Schwendy S, Layland L, da Costa CP, et al. CD25+/Foxp3+ T cells regulate gastric inflammation and Helicobacter pylori colonization in vivo. Gastroenterology. 2006 Aug;131(2):525–537. [PubMed]