PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of wtpaEurope PMCEurope PMC Funders GroupSubmit a Manuscript
 
J Cell Sci. Author manuscript; available in PMC 2010 May 17.
Published in final edited form as:
PMCID: PMC2871294
EMSID: UKMS27183

Heat shock causes a decrease in polysomes and appearance of stress granules in trypanosomes independently of eIF2α phosphorylation at threonine 169, the residue equivalent to serine 51 in mammalian eIF2α

Summary

In trypanosomes there is an almost total reliance on post-transcriptional mechanisms to alter gene expression and here heat shock was used to investigate the response to an environmental signal. Heat shock rapidly and reversibly induced a decrease in polysome abundance and the consequent changes in mRNA metabolism were studied. Both heat shock and polysome dissociation were necessary for (i) a reduction in mRNA levels that was more rapid than normal turnover, (ii) an increased number of P-body-like granules that contained DHH1, SCD6 and XRNA, (iii) the formation of stress granules that remained largely separate from the P-body-like granules and localized to the periphery of the cell and, (iv) an increase in the size of a novel focus located at the posterior pole of the cell that contained XRNA, but neither DHH1, nor SCD6. The response differed from mammalian cells in that neither the decrease in polysomes nor stress granule formation required phosphorylation of eIF2α at the position homologous to serine 51 in mammalian eIF2α and in the occurrence of a novel XRNA-focus.

Keywords: Heat shock, Trypanosoma brucei, stress granules, eIF2 alpha, P-bodies

Introduction

When cells are subjected to stress, such as heat shock, genes associated with growth are down-regulated and expression of proteins believed to increase cellular survival, such as HSP70, are selectively up-regulated. In eukaryotes, this regulation operates at multiple levels: transcription initiation may be enhanced via factors specific for heat shock genes while for other genes there is selective inhibition of splicing and nuclear export of mRNAs (Bond, 2006).

Stress also influences the fate of cytoplasmic mRNA in eukaryotes. Treatment of mammalian cells with a variety of stresses, such as arsenite or heat shock results in the relocation of most mRNAs from polysomes to cytoplasmic foci called stress granules (Kedersha et al., 1999), which contain the small ribosomal subunit (Kedersha et al., 2002), translation initiation factors eIF2, eIF3, eIF4E and eIF4G (Kedersha et al., 2002; Kimball et al., 2003), polyA binding protein (Kedersha et al., 1999), DHH1/p54/Rck RNA helicase (Wilczynska et al., 2005), the 5′-3′ exonuclease XRN1 (Kedersha et al., 2005) and RNA-binding proteins, including SCD6/RAP55/LSM14 (Yang et al., 2006) (Kedersha and Anderson, 2007).

Stress granule formation in response to heat shock and metabolic stress is dependent on, and might be initiated by, the phosphorylation of eukaryotic translation initiation factor eIF2α on a conserved residue (serine 51 in mammals and yeast) by one of a family of stress-activated kinases (Kedersha et al., 1999; McEwen et al., 2005). The modification inhibits initiation of translation by increasing the affinity of eIF2α for the guanine nucleotide exchange factor eIF2B, resulting in its sequestration. Stress granule formation can also be induced independently of eIF2α phosphorylation by pateamine or hippuristanol which interfere with the action of eIF4A, an RNA helicase necessary for translation initiation (Dang et al., 2006; Mazroui et al., 2006).

The fate of mRNAs in stress granules remains unclear; mRNAs may be degraded or stored until the stress is over. Inhibitors of translation elongation that stabilize polysomes cause stress granule dissociation, while inhibitors that destabilise polysomes promote the assembly of stress granules, suggesting that the mRNA in stress granules is in equilibrium with polysomes (Kedersha et al., 2000).

Stress granules have been shown to interact with processing bodies (P-bodies) (Kedersha et al., 2005; Wilczynska et al., 2005). P-bodies are cytoplasmic granules thought to be sites of mRNA degradation (Parker and Sheth, 2007). P-bodies share some, but not all, components with stress granules, for instance XRN1, DHH1 and SCD6/RAP55/LSM14. The decapping enzyme DCP1/2 is specific to P-bodies while the small ribosomal subunit, eIF2, eIF3 and polyA binding protein are absent (Bashkirov et al., 1997; Cougot et al., 2004; Ingelfinger et al., 2002; Kedersha and Anderson, 2007; Sheth and Parker, 2003). It is believed that XRN1 is the major degradative enzyme in P-bodies but the precise function of other components has yet to be fully characterized.

Trypanosoma brucei is a unicellular flagellate that causes Human African Trypanosomiasis and a range of diseases in animals. Synthesis of mRNA in trypanosomes is atypical; tandem arrays of genes (Berriman et al., 2005; El Sayed et al., 2003; Hall et al., 2003; McDonagh et al., 2000) are transcribed from a single promoter (Johnson et al., 1987; Kooter et al., 1987; Martinez-Calvillo et al., 2004; Martinez-Calvillo et al., 2003) and monocistronic mRNAs result from trans-splicing of a short, capped leader to the 5′ end and linked 3′ cleavage and polyadenylation of the upstream mRNA (Campbell et al., 1984; LeBowitz et al., 1993; Liang et al., 2003; Matthews et al., 1994; Schürch et al., 1994; Ullu et al., 1993). Consequently, the regulation of gene expression in trypanosomes is predominantly post-transcriptional (Clayton and Shapira, 2007). There is evidence for the presence of P-bodies: DHH1, XRNA and one Pumilio family protein are located in cytoplasmic granules in normally growing cells (Caro et al., 2006; Cassola et al., 2007; Dallagiovanna et al., 2007; Dallagiovanna et al., 2005; Holetz et al., 2007) although any role in the regulation of gene expression has yet to be determined. In contrast to mRNA synthesis, the mechanisms of translation initiation and elongation appear to be typical for a eukaryote; all the factors identified in metazoa and yeast are present in the trypanosome genome (Ivens et al., 2005) although a functional analysis has only been performed on a small number (Dhalia et al., 2006; Dhalia et al., 2005) and very little is known about regulation of translation (Clayton and Shapira, 2007).

Little is known about how the overall rate of gene expression is regulated, for example when trypanosomes stop growth and enter stationary phase. The only such phenomenon that has been investigated in any detail is the response to heat shock (Lee, 1998; Lee and Van der Ploeg, 1990; Muhich and Boothroyd, 1988; Muhich and Boothroyd, 1989; Muhich et al., 1989). There is a reduction of up to 50% in the rate of transcription and a selective block in trans-splicing of tubulin mRNAs whereas HSP70 and HSP85 mRNA maturation continues efficiently. There is a reduction in steady state levels of tubulin and several other mRNAs, but the steady state levels of HSP70 and HSP85 mRNAs are either stable or perhaps slightly increased.

Recent work described the appearance of stress granules in trypanosomes in response to carbon source starvation. The granules contained polyadenylated mRNA, poly A binding protein, one isoform of eIF4E, the XRN1 homologue XRNA, DHH1, and several proteins with RNA recognition motifs (Cassola et al., 2007). However, unlike in mammalian cells, the stress granules did not contain the ribosomal small subunit, arguing against the presence of arrested initiation complexes. The RNA in the granules was stable and it was suggested that the granules might be involved in mRNA storage and stabilization during stress (Cassola et al., 2007).

Here, the behaviour of cytoplasmic mRNA during heat shock and recovery in T. brucei has been characterised. The onset of heat shock caused a reduction in polysomes and a decrease in mRNA levels; the majority of mRNAs decreased at a rate greater than could be explained by a block in synthesis. These changes in mRNA levels were associated with alterations in cytoplasmic granules. Heat shock stress granules of similar composition to mammalian stress granules appeared, the number of P-body-like granules increased and XRNA accumulated in a novel granule at the posterior pole of the cell. However, unlike in mammalian cells these changes were not dependent on the phosphorylation of eIF2α at the position homologous to serine 51.

Results

Heat shock reversibly reduces translation of most proteins

Procyclic form Trypanosoma brucei are normally cultured at 27°C but some procyclic cell lines can grow indefinitely at 37°C (Guttinger et al., 2007). The T. brucei Lister 427 procyclic cell line used in these experiments was cultured at 27°C and was able to proliferate for at least one day at 37°C. At 41°C, the trypanosomes underwent a heat shock response that resulted in a cessation of proliferation. The response was reversible for at least 2 hours at 41°C and, after a lag, normal growth resumed on return to 27°C; a typical growth curve is shown in Figure 1. The heat shock treatments above did not cause significant cell death.

Fig. 1
Growth recovery following heat shock

The effect of heat shock on gene expression was investigated by metabolic labelling with [35S]-methionine. Cells were labelled for 20 min windows over a time course of heat shock (41°C for 60 minutes) and recovery (27°C for 5 hours) (Fig. 2A). There was a decrease in the synthesis of most polypeptides within the first 30 min. Some polypeptides were unaffected, most noticeably two of 55 kDa and 70 kDa (solid arrows in Fig. 2A). On return to 27°C, the incorporation of [35S]-methionine into most polypeptides returned to the level before the heat shock. However, even after 5 hours recovery some polypeptides were still synthesised at a lower rate (dashed arrows in Fig. 2A) and the 55 kDa protein was still synthesised at an increased rate. Reduced protein synthesis during heat shock could result from an inhibition of translation initiation or elongation, or from increased proteolysis of newly synthesised proteins. Polysome analysis of cells after 15 or 30 minutes at 41°C showed a large decrease in the polysome fraction, consistent with a reduced rate of initiation of translation (Fig. 2B).

Fig. 2
Effect of heat shock on translation and polysomes

Heat shock reversibly reduces steady state levels of most mRNAs

The rapid reduction in number of polysomes during heat shock must increase the pool of non-polysome associated mRNAs. To investigate the fate of mRNA during heat shock, RNA was prepared and northern blots were probed for the 5′-spliced leader present on all cytoplasmic mRNAs (De Lange et al., 1984). At 41°C, steady state mRNA was reduced to 51% after 60 minutes and to 28% after 120 minutes. At 37°C, mRNA levels remained unaffected for the first 60 minutes but began to decrease slightly between 60 and 120 minutes (Fig. 3A).

Fig. 3
Changes in mRNA steady state levels following heat shock

To determine global effects of heat shock on mRNA steady state levels in more detail, a microarray was performed to compare the mRNAs in cells incubated at 41°C for 60 min with those in cells at 27°C (ArrayExpress submission accession number: E-MEXP-1476). The data were normalized and filtered for quality and reproducibility. The data are shown as a plot of the intensities for each spot in each condition for the total (Fig. 3B) and filtered dataset (Fig. 3C). Data normalization was based on the standard assumption that the total mRNA levels remain unchanged in the two conditions. Since, in reality, incubation at 41°C for 60 minutes resulted in a loss of 50% of total mRNA (Fig. 3A), an mRNA with a ratio of 1.0 (41°C/27°C) in the plot of the array data was actually reduced 2-fold; an mRNA with a ratio of 2.0 was unaffected by heat shock and an mRNA with a ratio of 0.5 was reduced four fold. In an initial analysis we selected genes that behaved significantly differently from the average mRNA using cutoffs of ≥2.5 and ≤0.4 (Table S1 in supplementary material). The heat shock regulated genes were randomly distributed throughout the genome.

The list of genes with a ratio of ≥2.5 represents the mRNAs that escaped the general reduction in mRNA levels upon heat shock. There were 371 genes in this category (Table S2 in supplementary material). 230 had no assigned function (half of all open reading frames in the genome are unassigned). The annotated genes included several stress response genes including one HSP100, four E2 ubiquitin ligases, two proteosome subunits, and two DNAJ domain containing chaperones. Genes involved in mRNA metabolism included a polyU polymerase (Stagno et al., 2007), an RNA helicase and three mRNA binding proteins; RBP6, RBP10 and hnRNP H/F. The 317 genes with a ratio of ≤0.4 included both mRNAs that were down-regulated after heat shock and those which normally have a high turnover rate. More than half of these were functionally annotated (Table S1 and S2 in supplementary material). Core metabolic functions were strongly represented. There were eleven amino acyl tRNA synthases (three more have ratios between 0.41 and 0.45) and five translation initiation factors. In addition, there were three subunits of the t-complex chaperone (three further subunits have ratios between 0.41 and 0.45).

Response of individual mRNAs to heat shock

The kinetics of the response of individual mRNAs was investigated in further detail. Four genes associated with cell growth were used: actin, alpha- and beta-tubulin (probed together) and protein disulphide isomerase-2 (PDI-2) (Rubotham et al., 2005). After 60 minutes of heat shock, steady state levels of these mRNAs were reduced to between 50 and 25% (Fig. 3D).

Next, the expression of putative heat shock protein genes was investigated. The T. brucei genome encodes a range of different HSP70 genes (Folgueira and Requena, 2007) and a tandem array of identical HSP83/90 genes (Mottram et al., 1989). Specific probes were used to screen northern blots of RNA prepared over a time course of heat shock. The steady state levels of HSP70 (Tb11.01.3110) and HSP83 (Tb10.26.1080) mRNAs were maintained during heat shock (Fig. 3E). HSP70 and HSP83 mRNAs increased slightly at 37°C whereas the housekeeping genes tested did not. The results with HSP70 and HSP83 mRNAs confirm earlier observations (Lee, 1998; Muhich et al., 1989). Other HSP70 isoforms were investigated; mitochondrial HSP70s (Tb927.6.3740, Tb927.6.3750 and Tb927.6.3800) and cytoplasmic HSP70.4 (Tb927.7.710) (Searle and Smith, 1993) all decreased in response to heat shock, similar to the the majority of mRNAs (Fig. S1 in supplementary material). The changes in mRNA levels determined by northern blot for actin and PDI-2 were very similar to those determined by in the microarray experiment. The tubulin, HSP70 (Tb11.01.3110) and HSP83 could not be accurately measured in the microarray experiments as the mRNAs are very abundant and saturated the spots (Fig. 3C and ArrayExpress submission accession number: E-MEXP-1476).

The decrease in mRNA steady state levels during heat shock was fully reversible. Total mRNA returned to the pre-heat shock levels after ~3 hours recovery (Fig. 4). Individual mRNAs had variable kinetics of return with tubulin being noticeably slower than the mean. Together, the data from metabolic labelling, microarray experiments, and northern blots show that trypanosomes undergo a defined and reversible change in gene expression in response to heat shock.

Fig. 4
The decrease in mRNA steady state levels is reversible

Bulk mRNA decay rate is increased during heat shock

The decrease in steady state levels of mRNAs during heat shock could have resulted from decreased synthesis and/or increased decay. Two experiments were performed to distinguish between the two possibilities. First, mRNA synthesis was inhibited by sinefungin, an inhibitor of trans-splicing (McNally and Agabian, 1992; Ullu et al., 1993; Ullu and Tschudi, 1991), and the rate of mRNA decay was compared in cells grown without heat shock at either 27°C or 37°C or in heat shock at 41°C. The rate of decay was significantly higher in the heat shocked cells, both for bulk mRNA (Fig. 5A) and for tubulin, PDI-2 and actin mRNAs (Fig. 5B). A similar result was obtained when transcription was inhibited with actinomycin D (data not shown). The results provide strong evidence for an increased rate of turnover of mRNA during heat shock. Second, the rate of mRNA decrease was measured in heat-shocked cells with or without sinefungin. For both bulk mRNA (Fig. 5A) and individual mRNAs (Fig. 5B), the rate of decrease was more rapid in the presence of sinefungin than with heat shock alone (Fig. 5) indicating that synthesis of mRNA was still occurring at 41°C. This is consistent with microarray results, which indicate that some mRNAs are elevated after heat shock (Tables S1 and S2 in supplementary materials).

Fig. 5
Effect of heat shock on transcription and mRNA processing

Heat shock causes reversible formation of cytoplasmic granules containing components typical of mammalian stress granules

At 41°C, the decrease in polysomes was more rapid than the decrease in mRNA (Figs. (Figs.2B2B and and3).3). Thus, non-polysome associated mRNA in the cell must increase during the onset of heat shock. To investigate the fate of the mRNAs released from polysomes, a screen for the presence of heat shock inducible stress granules was performed. Homologues of known stress granule components were expressed as enhanced yellow fluorescent protein (eYFP) fusion proteins. Poly(A) binding proteins, PABP1 (Tb09.211.0930) (De Gaudenzi et al., 2005) and PABP2 (Tb09.211.2150) (Hotchkiss et al., 1999), and translation initiation factors eIF4E1 to 4 (Tb11.18.0004, Tb10.61.0210, Tb11.01.3630, Tb927.6.1870) (Dhalia et al., 2005), eIF2A (Tb927.3.2900) (Moraes et al., 2007) and eIF3B (Tb11.01.1370) (De Gaudenzi et al., 2005) were tagged. The expression of all fusion proteins was confirmed by Western blotting using anti-GFP (Fig. S2B in supplementary material) and all were the expected molecular weight.

At 27°C, PABP1 and PABP2 were predominantly in the cytoplasm, eIF2A, eIF3B, eIF4E3 and eIF4E4 were present mainly in the cytoplasm and in lower concentrations in the nucleus, and eIF4E1 and eIF4E2 were about equally distributed between nucleus and cytoplasm (Fig. 6A and B). One hour after transfer to 41°C, all eYFP-fusion proteins above were concentrated in distinct cytoplasmic foci of heterogenous size and shape whereas the localisation of the eYFP control was unaffected (Fig. 6 A,B). Granule formation occurred within 30 minutes and increased up to 120 minutes (Fig. 6B), and required a minimum temperature of 40°C (data not shown). Inhibition of new mRNA synthesis using actinomycin D for up to 2 hours did not prevent heat shock stress granule formation (Fig. 6B) indicating that granule formation does not require newly synthesized mRNAs.

Fig. 6
Characterization of T. brucei heat shock stress granules

The formation of granules was fully reversible and they disappeared within 5 to 6 hours after return to 27°C (Fig. 6C). Optical sections through a heat-shocked cell expressing either eIF4E3-eYFP or PABP1-eYFP revealed that the granules were concentrated towards the cell periphery (Fig. 6D). eIF4E3 and eIF3B were tagged in the same cell line and co-localised in granules (Fig. 6E).

Cycloheximide prevents heat shock granule formation and can reverse the decline in the polysome pool during heat shock

Cycloheximide was added before and during heat shock to investigate the relationship between polysome dissociation and stress granule formation. Polysome analyses were performed on cells incubated at: (1) 27°C, (2) 41°C, (3) 27°C with cycloheximide, (4) 27°C with cycloheximide followed by an increase in temperature to 41°C, (5) 41°C with cycloheximide (6) 27°C with puromycin (Fig. 7A). Stress granule formation was monitored in similar conditions using cells expressing PABP1-eYFP (Fig. 7B). Cycloheximide stabilised and puromycin dissociated polysomes as expected and neither caused stress granule formation. Thus, polysome dissociation by puromycin is not sufficient for granule formation. Addition of cycloheximide prior to heat shock largely prevented polysome dissociation and granule formation was blocked providing evidence that polysome dissociation is necessary for stress granule formation.

Fig. 7
Effect of cycloheximide on polysomes, stress granules and mRNA degradation during heat shock

Cycloheximide addition during heat shock caused an increase in polysomes. The increase could result from newly synthesized mRNAs becoming trapped and/or ‘old’ mRNAs returning to polysomes. However, the rapid increase in polysomes after cycloheximide addition favours a return of old mRNA. Cycloheximide also inhibited heat shock induced decrease in PDI-2 and tubulin mRNAs (Fig. 7C) providing evidence that polysome dissociation is required for mRNA decay during heat shock.

Heat shock increases the number of P-bodies and causes relocalization of XRNA, but not of DHH1 and SCD6, to a focus at the posterior pole of the cell.

Homologues of P-body components were screened by expression of eYFP fusions from extragenic loci. At 27°C, three proteins localized to discrete foci within the cytoplasm: DHH1 (Tb10.70.3290), SCD6/RAP55/LSM14 (Tb11.03.0530) and XRNA (Li et al., 2006). The putative P-bodies differed from the stress granules induced by heat shock in that they were constitutively present and more defined with a clearly spherical shape.

The localization of DHH1 and SCD6 to cytoplasmic foci was confirmed using antisera raised against recombinant proteins (see Figure S3 in supplementary data for details). The foci visualized using antibodies were less apparent against the background signal from the cytoplasm than the foci visualised using fluoresecence from the cognate fusion protein. The same was true when anti-eYFP was used. The most likely explanation for this discrepancy is that the antibodies only labelled the surface of the foci whereas the fluorescent proteins labelled the foci uniformly, giving a stronger signal relative to the cytoplasm.

For further analysis cell lines were made with one endogenous allele of either DHH1 or SCD6 modified to express a fluorescent protein fusion. The expression levels from the modified allele were either similar (SCD6) or less (DHH1) than from the remaining wild type allele (Fig. S3A). DHH1 was expressed with eYFP at the N-terminus (eYFP-DHH1) and this fusion protein was shown to be functional as cells grew at the normal rate after deletion of the second allele whereas knockdown of DHH1 by RNAi was lethal (Schwede et al., 2008). SCD6 was expressed as either an N- or C-terminal eYFP-fusion protein (eYFP-SCD6 or SCD6-eYFP) and both localized into discrete foci in the cytoplasm. There was an average of 2.9 foci per cell (Fig. 8A and Fig. S4A in supplementary material). DHH1 and SCD6 were expressed as eYFP and mCherry fluorescent protein fusions (eYFP-DHH1 and SCD6-mChFP) in the same cell line (Fig. 8B, left panel). Both proteins co-localized to the same cytoplasmic foci and no foci were found that did not contain both fluorescent proteins. In response to protein synthesis inhibitors, the foci behaved in a similar manner to P-bodies in yeast and cultured mammalian cells. Puromycin caused an increase in size of the foci but not in the number, and cycloheximide caused the foci to fully disappear. Heat shock at 41°C caused an increase in the number and the size of the foci (Fig. 8B).

Fig. 8
T. brucei P-bodies

XRNA was expressed as either an N- or C-terminal eYFP fusion protein by modification of one endogenous allele (eYFP-XRNA, XRNA-eYFP, Fig. S5 in supplementary material); both localized to foci distributed throughout the cytoplasm but, in contrast to DHH1 and SCD6, one focus was always located at the posterior pole of the cell. A cell line expressing XRNA-eYFP and mChFP-DHH1 (Fig. 8B, right panel, Fig. S5 in supplementary material) confirmed that the two proteins localised to the same foci in the cytoplasm (dashed arrows in Fig. 8B) but only XRNA-eYFP localized to the focus present at the posterior pole of cells (solid arrows in Fig. 8B). Cycloheximide caused all XRNA-containing foci to disappear (Fig. 8B right panel), whereas puromycin caused an increase in size of all (Fig. 8B right panel, Fig. S4B in supplementary material). In contrast, heat shock caused a preferential increase in size of the XRNA-containing focus at the posterior pole, which always became the brightest focus in the cell (Fig. 8B right panel, Fig. S4B in supplementary material).

Heat shock stress granules do not co-localize with P-bodies

Any interaction between P-bodies and heat shock stress granules was investigated using cell lines expressing PABP1-eYFP and either mChFP-DHH1 or SCD6-mChFP (Fig. S5 in supplementary material). At 27°C, PABP1-eYFP was uniformly distributed throughout the cytoplasm whereas mChFP-DHH1 and SCD6-mChFP were concentrated in cytoplasmic foci (Fig. 8C). At 41°C, PABP1 localized to heat shock stress granules, and the DHH1 and SCD6 foci increased in size and number (Fig. 8C). The majority of the PABP1 foci did not co-localize with the DHH1 and SCD6 foci. Only a small number of heat shock stress granules (PABP1-foci) and P-bodies (DHH1/SCD6 foci) were found to either co-localize or lie adjacent to each other (dashed arrows in Fig. 8C).

Heat shock granule formation is independent of eIF2A phosphorylation at threonine 169, the equivalent of serine 51 in mammalian eIF2α

One of the first steps in the heat shock response in mammalian cells is the inhibition of the initiation of translation after phosphorylation of serine 51 (S51) of eIF2α (Kedersha et al., 1999; McEwen et al., 2005). eIF2A, the T. brucei homologue of α, has an N-terminal extension and the residue aligned with mammalian S51 is threonine 169 (T169) (Moraes et al., 2007). To test the role of T169 phosphorylation in the heat shock response, a cell line expressing PABP1-eYFP was used as the starting cell line (eIF2A +/+). First, one eIF2A allele was replaced with a blasticidin resistance gene (eIF2A +/−), then the remaining wild type allele was modified so that a T169->A mutation was introduced (eIF2A T169A/+). This second manipulation altered the 3′ untranslated region of the eIF2A gene and a control cell line was made with the same change in the 3′ untranslated region but with unaltered eIF2A sequence (eIF2A T169T/+) (Fig. S6 in supplementary material).

The cell lines T169A/− and T169T/− were incubated at 41°C and in both cases PABP1-eYFP was localised to multiple cytoplasmic granules on induction of heat shock (Fig. 9A) and polysomes abundance decreased (Fig. 9B). Thus, in trypanosomes neither heat shock granule formation nor translational exit requires phosphorylation of T169 in eIF2A.

Fig. 9
Heat shock stress granule formation is independent on eIF2α phosphorylation at threonine 169

Discussion

The changes in gene expression that occur to favour cellular survival during heat shock are a universal phenomenon and minimally comprise two components, a decrease in expression of genes associated with cell growth and an increase in expression of genes associated with maintaining the integrity of protein structure. Procyclic form trypanosomes are no exception. However, the mode of gene expression in trypanosomes precludes transcriptional regulation of individual genes in response to heat shock and the regulation must occur post-transcriptionally. Previously, it was shown that heat shock causes the overall RNA polymerase II transcription to halve (Lee, 1995; Muhich and Boothroyd, 1988) and that HSP70 mRNA maturation continues during heat shock whereas tubulin mRNA maturation is blocked (Muhich and Boothroyd, 1988; Muhich and Boothroyd, 1989). Here, the effect of heat shock on mRNA metabolism in trypanosomes has been investigated. The major findings are that heat shock caused: (1) a rapid and large decrease in polysomes, (2) a decrease in the levels of many mRNAs caused, in part, by increased decay, (3) increased levels of some mRNAs, (4) the formation of heat shock stress granules at the cell periphery, (5) an increase in the number and size of P-bodies and, (6) an increase in size of a novel XRNA focus at the posterior pole of the cell. The decrease in polysomes and appearence of stress granules were not dependent of phosphorylation of eIF2A at T169 (equivalent to S51 in mammalian eIF2α). The inhibition of stress granule formation by cycloheximide indicates that polysome-free mRNA is required for their formation. The P-bodies contained XRNA, DHH1 and SCD6; in contrast, a novel focus at the posterior pole of the cell contained XRNA but neither DHH1 nor SCD6. Importantly, the changes on heat shock were fully reversible and the kinetics of return to proliferative growth, restoration of starting mRNA levels, and disappearance of heat shock stress granules were similar.

Changes in mRNA metabolism following heat shock

Within 15 minutes of heat shock the polysomes pool and the translation of most proteins had decreased. Heat shock also reduced steady state levels of most mRNAs but with slower kinetics than the decrease in polysomes. Thus, the dissociation of polysomes on heat shock must result in increased levels of non-polysome associated mRNA in the cell. The appearance of heat shock stress granules and the increase in the number of P-bodies following heat shock occurred with similar kinetics to polysome dissociation. One interpretation of the kinetics is that the mRNAs released from polysomes were directed to either or both of these cytoplasmic mRNP particles, but this remains to be proven.

What causes the decrease in mRNA steady state levels following heat shock? The microarray experiment showed a wide range of responses for individual mRNA steady state levels; some were unaffected or even increased, most decreased and some decreased very rapidly. Experiments measuring the rate of decay strongly suggested that the decrease in mRNAs at 41°C was due to both increased degradation and reduced transcription and maturation.

Inhibition of polysome dissociation by cycloheximide blocked both the decrease in PDI-2 and tubulin mRNAs and heat shock stress granule formation. Dissociation of polysomes by puromycin was not sufficient to induce either heat shock stress granule formation or a decrease in mRNAs. These results provide evidence that dissociation of polysomes is necessary but not sufficient for the heat shock response. The addition of cycloheximide during heat shock resulted in an increase in polysomes (Fig. 7A); one explanation for this is that mRNAs are in equilibrium between polysomes and stress granules as found in mammals (Kedersha et al., 2000). If this is correct, exit from the polysome pool was not irreversible and did not inevitably lead to degradation.

P-bodies

In yeast and mammalian cells, P-bodies contain the activities involved in 5′->3′ exonucleolytic digestion of mRNA: the decapping enzyme components DCP1 and DCP2, XRN1 exonuclease, and accessory proteins including DHH1 and SCD6 (reviewed in (Parker and Sheth, 2007)). Decapping activity has been detected in trypanosomatid cell lysates (Milone et al., 2002) but the genes encoding this activity have not been identified as there are no readily identifiable orthologues of DCP1 or DCP2 in the trypanosome genome (Berriman et al., 2005). P-body components identified in trypanosomes includes: DHH1 (Cassola et al., 2007; Holetz et al., 2007), SCD6 (this work), XRNA (Cassola et al., 2007), one member of the Puf protein family (Caro et al., 2006; Dallagiovanna et al., 2007; Dallagiovanna et al., 2005) and the RNA binding protein RBP3 (Robles, A., Gudjonsdottir-Planck, D., Hartmann, C and Clayton, C.E; submitted). eIF4E is found in P-bodies in yeast and mammalian cells but has not been reported to be present in cytoplasmic foci in trypanosomes (Cassola et al., 2007). There is no LSM1 gene in the genome, and the LSM1 to LSM7 complex is absent whereas the LSM2-8 splicing factor is present in the nucleus (Liu et al., 2004).

The most unexpected result from this work was the localization of XRNA, but not DHH1 or SCD6, to a spot at the posterior cell pole in addition to the cytoplasm and P-bodies. This focus shared properties with P-bodies: cycloheximide caused the focus to dissolve and puromycin caused it to increase in size. In response to heat shock, this focus increased in size to become the largest focus of XRNA in the cell. It is not clear why XRNA is found there, nor why heat shock induces XRNA to further accumulate there. The posterior pole contains the plus end of the cortical microtubules (Robinson et al., 1995) that define the trypanosome shape (Ngo et al., 1998) and comprise the vast majority of cytoplasmic microtubules (reviewed in (Gull, 1999)). In S. cerevisiae, XRN1 can promote microtubule assembly in vitro and XRN1 mutants are hypersensitive to benomyl (Johnson, 1997; Page et al., 1998; Solinger et al., 1999); the location of XRNA at the posterior pole may reflect a distinct function to its role as an exoribonuclease (Li et al., 2006).

Heat shock stress granules

In response to heat shock, all translation initiation factors tested (eIF4E1, 2, 3 and 4, eIF3B and eIF2A) and both polyA binding proteins relocalized into cytoplasmic granules of uneven shape and size that remained largely separate from P-bodies (Fig. 8B). Orthologues of these components are also present in cytoplasmic stress granules described in mammals (Kedersha and Anderson, 2007). The heat shock granules were preferentially localized to the periphery of the cell, close to the subpellicular array of microtubules (Sherwin and Gull, 1989; Vickerman and Preston, 1976); whether there is an interaction is not yet known.

Stress granule formation also occurs in trypanosomes in response to metabolic stress brought by either azide/2-deoxyglucose treatment (Marchetti et al., 2000) or by starving cells in phosphate buffered saline (Cassola et al., 2007). The granules resulting from metabolic stress and heat shock share components involved in initiation of translation but are different in two important ways: first during carbon source starvation, granules contained both translation initiation factors and the P-body components DHH1 and XRNA (Cassola et al., 2007), whereas upon heat shock they remained largely distinct. Second, metabolic stress granules contained mRNA that was stabilized (Cassola et al., 2007) in contrast to the decay that occurred over a shorter time scale on heat shock. The metabolic stress granules in trypanosomes resemble EGP-bodies (named for their protein constituents eIF4E, eIF4G and Pab1p) that appear in yeast on glucose starvation (Hoyle et al., 2007) with the exception there was only partial co-localisation of EGP-body components and a P-body marker.

Induction of events

The earliest event detected in the response to heat shock was a decrease in polysomes, probably caused by a reduction in initiation of translation. Regulation of translation initiation by phosphorylation of eIF2α on a conserved serine (S51) is essential for most stress responses (Wek et al., 2006), including heat shock response in mammalian cells (Doerwald et al., 2006; McEwen et al., 2005), and stress granules do not form in eIF2α/S51A mutants (McEwen et al., 2005). However, stress granule formation can also be induced in mammalian cells by manipulation of the RNA helicase eIF4A (Dang et al., 2006; Mazroui et al., 2006). In yeast, the reduction in translation in response to amino acid starvation is dependent on eIF2α phosphorylation whereas the response to glucose starvation is not (Hoyle et al., 2007).

Trypanosome eIF2A has an N-terminal extension; threonine 169 (T169) aligns with S51 and is phosphorylated by TbeIF2K2 in vitro (Moraes et al., 2007). A cell line dependent on a single eIF2A gene containing a T169->A mutation was made and exhibited a normal heat shock response. The pathway that causes the translational arrest required for heat shock granule formation remains unknown and might be novel.

The heat shock response in procyclic form trypanosomes

The effect of heat shock can thus be summarised as follows: the response was initiated at ~41°C and within 15 minutes there was a decrease in polysomes and a reduction in the translation of most but not all mRNAs independent of phosphorylation of eIF2A on T169. The mechanism of suppressing translation during heat shock remains unclear. Within 30 minutes, heat shock stress granules appear in the cytoplasm at the cell periphery, the number of P-bodies increases and the XRNA-containing focus at the posterior pole of the cell increases in size. The total mRNA in the cell decreases so by one hour the amount per cell has been halved. The loss is selective; some mRNAs are not affected. The decrease in mRNA is caused by both reduced synthesis and accelerated turnover. The appearance of heat shock stress granules and increase in P-bodies are co-incident with the alterations in mRNA metabolism and it can be speculated that they provide different compartments (Fig. 10) each of which can act as a gateway for a particular fate. The mechanism that regulates mRNA partitioning is central to the understanding of how mRNA levels are regulated.

Fig. 10
Model of compartments that may determine mRNA fate in growing cells (left) and cells in heat shock (right)

Methods

Trypanosomes

Trypanosoma brucei Lister 427 procyclic cells were used throughout. Either T. brucei Lister 427 pLEW29:pLEW13 (Wirtz et al., 1999), or T. brucei Lister 427 SIMP (Bill Wickstead, Sir William Dunn School of Pathology, Oxford) or PTT (Bastin, P., Pasteur Institute Paris, France) were used for tetracycline-inducible expression. Cells were cultured in SDM-79 (Brun and Schonenberger, 1979). Transgenic trypanosomes were generated using standard procedures (McCulloch et al., 2004). All experiments used logarithmically growing trypanosomes.

Expression of eYFP and mChFP fusion proteins

Previously described methods and vectors were used (Kelly et al., 2007), details of constructs are shown in Tables S3 and S4 (supplementary material). Where appropriate, expression of transgenes was induced using 1 μg/ml tetracycline for 12 to 16 hours.

eIF2A deletion and mutation

A blasticidin resistance ORF flanked by 316 nucleotides upstream and 975 nucleotides downstream of the eIF2A open reading frame was used to delete one eIF2A allele. The second allele was replaced by either mutated (T169->A; ACG->GCG) or wild type eIF2A by targeting the locus with a linearized plasmid consisting of the eIF2A open reading frame followed by a hybrid intergenic region derived from the pCPTP-NEO plasmid (Schimanski et al., 2005) followed by a neomycin resistence cassette, followed by 975 nucleotides of the eIF2A 3′ UTR. Successful targeted insertion resulted in the eIF2A mRNA having a 3′UTR derived from the RPA1 gene.

Quantitative RNA analysis by Northern blot

RNA was prepared with the RNAeasy kit (Quiagen). Northern blotting was as described (Webb et al., 2005). Probes for PDI-2, actin, mitochondrial HSP70 isoforms (927.6.3740, 927.6.3750, 927.6.3800), HSP70 isoform 927.7.710, HSP83/90 (Tb10.26.1080) were full-length open reading frames. The HSP70 isoform 11.01.3110 probe contained nucleotide 1140-2073 of the open reading frame. The tubulin probe contained one α-β repeat from the locus. Quantification was performed using a Molecular Dynamics Storm 840 and ImageQuant software. Individual bands were measured and the background (an equal area either above or below each band) substracted. Ribosomal RNA was used to measure loading. Total mRNA was measured using an oligonucleotide complementary to the mini-exon (5′ – CAATATAGTACAGAAACTGTTCTAATAATAGCGTT). Hybridization was performed at 42°C and the blot was washed at room temperature in 4×xSSC, 0.1% SDS. Experiments were performed at least twice and representative results from individual experiments are shown.

RNA extraction throughout this work is based on guanidinium isothiocyanate solubilization of the cells. In yeast, it has been reported that mRNAs become resistant to some RNA extraction methods when stationary phase cells are exposed to stress (Aragon et al., 2006). RNA was prepared from heat shocked trypanosomes using either a monophasic solution of 1:1 (v/v) phenol and buffer containing 1% SDS at 80°C (Carrington, 1993) or the standard method. The two methods gave identical results.

Polysome analysis

5×108 trypanosomes (<1×107 cells/ml) were harvested at room temperature, washed in SDM79 without serum, resuspended in 360 μl polysome buffer (120 mM KCl, 2 mM MgCl2, 20 mM Tris pH 7.5, 1 mM DTT, protease inhibitors (complete protease inhibitor cocktail, Roche)) and lysed by adding 40 μl 10% noctyl glycoside. The lysate was cleared by centrifugation at 16.000 g (4°C, 10 min), layered onto a 10-50% sucrose gradient (12 ml) prepared in polysome buffer, and centrifuged at 4°C for 2 hours at 36,000 rpm in a Beckman SW 40 rotor. Absorption at 254 nm was monitored using the UVICORD SII system. Both cycloheximide and puromycin were used at 50 μg/ml.

Metabolic labelling

5×106 cells were transferred into 500 μl methionine free RPMI-1640 (R7513, Sigma) with 3.7 kBq/ml [35S]-methionine (>37 TBq/mmol) for 20 minutes. Cells were pelleted, washed and lysed in SDS-PAGE sample buffer. Samples were analysed by SDS-PAGE and autoradiography.

Microscopic Imaging

Cells were washed with SDM79 without serum and fixed at a density of 1×107 /ml with 2.4% paraformaldehyde overnight, washed once in PBS and stained with Hoechst H33258. Fluorescence microscopy was carried out using a Zeiss Axioskop microscope equipped with a Plan-Apochromat 100x/ 1.4 Oil DIC objective. Images were taken with the monochrome CCD camera AxioCam MR using AxioVision software (Zeiss). Confocal images were made with a BioRad Radiance 2100 on a Nikon Eclipse E800 upright microscope using a 100×/ 1.4 Oil DIC objective.

Microarrays

Procyclic cultures (~5×106 /ml) at 27°C were added to one volume SDM79 at 53°C and incubated at 41°C in a waterbath in a closed tube for 60 min. The control cells were added to one volume medium at 27°C and also incubated for 60 minutes in a closed tube at 27°C. Total RNA was prepared using the Qiagen RNAeasy Midi kit, including the DNAse digestion on the column. Two biological replicates were performed on different days. 10 μg of total RNA of each condition (41°C and 27°C) were labelled as previously described (Brems et al., 2005; Diehl et al., 2002; Luu et al., 2006). After checking dye incorporation in a fluorimeter (Nanodrop ND-1000 3.3), samples were mixed and hybridized onto the array (JCVI PFGRC T. brucei 37K v2) according to the M008 TIGR protocol. Five technical replicates were performed. Image acquisition and data analysis were performed as previously described (Diehl et al., 2002). The MCHiPS software package (Fellenberg et al., 2002; Fellenberg et al., 2001) was used for data normalisation and analysis. After normalising the original signal intensities by Log Regression, each individual signal was filtered for quality and reproducibility. Only spots with a fitted intensity of at least twice the standard deviation above background, a p-values ≤ 0.05 and a min/max separation value of 0.1 survived the filtering.

Supplementary Material

Supplementary Material

Acknowledgements

This work was funded by the Wellcome Trust. The authors like to thank Alex Sossick and Nicola Lawrence (Gurdon Institute, Cambridge) for help with confocal microscopy, Julie Aspen and Richard Jackson (Biochemistry, Cambridge) for help with polysomes, Rachana Ramarao for helpful discussions, Jenny Reed for ever-patient and excellent assistance, Nancy Standart for critical reading of the manuscript, Elisabetta Ullu for helpful discussions on polysomes, Bill Wickstead (Pathology, Oxford) for the SIMP cell line, Jay Bangs (University of Wisconsin, Madison, USA) for kindly providing the BiP antibody, Derek Nolan for providing us with information about PDI-2. Rafael Queiroz holds a stipend from the Deutsche Akademische Austauschdienst.

References

  • Aragon AD, Quinones GA, Thomas EV, Roy S, Werner-Washburne M. Release of extraction-resistant mRNA in stationary phase Saccharomyces cerevisiae produces a massive increase in transcript abundance in response to stress. Genome Biol. 2006;7:R9. [PMC free article] [PubMed]
  • Bashkirov VI, Scherthan H, Solinger JA, Buerstedde JM, Heyer WD. A mouse cytoplasmic exoribonuclease (mXRN1p) with preference for G4 tetraplex substrates. J Cell Biol. 1997;136:761–73. [PMC free article] [PubMed]
  • Berriman M, Ghedin E, Hertz-Fowler C, Blandin G, Renauld H, Bartholomeu DC, Lennard NJ, Caler E, Hamlin NE, Haas B, et al. The genome of the African trypanosome Trypanosoma brucei. Science. 2005;309:416–22. [PubMed]
  • Bond U. Stressed out! Effects of environmental stress on mRNA metabolism. FEMS Yeast Res. 2006;6:160–70. [PubMed]
  • Brems S, Guilbride DL, Gundlesdodjir-Planck D, Busold C, Luu VD, Schanne M, Hoheisel J, Clayton C. The transcriptomes of Trypanosoma brucei Lister 427 and TREU927 bloodstream and procyclic trypomastigotes. Mol Biochem Parasitol. 2005;139:163–72. [PubMed]
  • Brun R, Schonenberger Cultivation and in vitro cloning or procyclic culture forms of Trypanosoma brucei in a semi-defined medium. Short communication. Acta Trop. 1979;36:289–92. [PubMed]
  • Campbell DA, Thornton DA, Boothroyd JC. Apparent discontinuous transcription of Trypanosoma brucei variant surface antigen genes. Nature. 1984;311:350–5. [PubMed]
  • Caro F, Bercovich N, Atorrasagasti C, Levin MJ, Vazquez MP. Trypanosoma cruzi: analysis of the complete PUF RNA-binding protein family. Exp Parasitol. 2006;113:112–24. [PubMed]
  • Carrington M. Preparation of DNA and RNA from Trypanosoma brucei. Methods Mol Biol. 1993;21:101–11. [PubMed]
  • Cassola A, De Gaudenzi JG, Frasch AC. Recruitment of mRNAs to cytoplasmic ribonucleoprotein granules in trypanosomes. Mol Microbiol. 2007;65:655–70. [PubMed]
  • Clayton C, Shapira M. Post-transcriptional regulation of gene expression in trypanosomes and leishmanias. Mol Biochem Parasitol. 2007;156:93–101. [PubMed]
  • Cougot N, Babajko S, Seraphin B. Cytoplasmic foci are sites of mRNA decay in human cells. J Cell Biol. 2004;165:31–40. [PMC free article] [PubMed]
  • Dallagiovanna B, Correa A, Probst CM, Holetz F, Smircich P, de Aguiar AM, Mansur F, da Silva CV, Mortara RA, Garat B, et al. Functional genomic characterization of mRNAs associated with TcPUF6, a pumilio-like protein from Trypanosoma cruzi. J Biol Chem. 2007 [PMC free article] [PubMed]
  • Dallagiovanna B, Perez L, Sotelo-Silveira J, Smircich P, Duhagon MA, Garat B. Trypanosoma cruzi: molecular characterization of TcPUF6, a Pumilio protein. Exp Parasitol. 2005;109:260–4. [PubMed]
  • Dang Y, Kedersha N, Low WK, Romo D, Gorospe M, Kaufman R, Anderson P, Liu JO. Eukaryotic initiation factor 2alpha-independent pathway of stress granule induction by the natural product pateamine A. J Biol Chem. 2006;281:32870–8. [PubMed]
  • De Gaudenzi J, Frasch AC, Clayton C. RNA-binding domain proteins in Kinetoplastids: a comparative analysis. Eukaryot Cell. 2005;4:2106–14. [PMC free article] [PubMed]
  • De Lange T, Michels PAM, Veerman HJG, Cornelissen ACWA, Borst P. Many trypanosome mRNAs share a common 5′ terminal sequence. Nucl. Acids Res. 1984;12:3777–3790. [PMC free article] [PubMed]
  • Dhalia R, Marinsek N, Reis CR, Katz R, Muniz JR, Standart N, Carrington M, de Melo Neto OP. The two eIF4A helicases in Trypanosoma brucei are functionally distinct. Nucleic Acids Res. 2006;34:2495–507. [PMC free article] [PubMed]
  • Dhalia R, Reis CR, Freire ER, Rocha PO, Katz R, Muniz JR, Standart N, de Melo Neto OP. Translation initiation in Leishmania major: characterisation of multiple eIF4F subunit homologues. Mol Biochem Parasitol. 2005;140:23–41. [PubMed]
  • Diehl S, Diehl F, El-Sayed NM, Clayton C, Hoheisel JD. Analysis of stage-specific gene expression in the bloodstream and the procyclic form of Trypanosoma brucei using a genomic DNA-microarray. Mol Biochem Parasitol. 2002;123:115–23. [PubMed]
  • Doerwald L, van Genesen ST, Onnekink C, Marin-Vinader L, de Lange F, de Jong WW, Lubsen NH. The effect of alphaB-crystallin and Hsp27 on the availability of translation initiation factors in heat-shocked cells. Cell Mol Life Sci. 2006;63:735–43. [PubMed]
  • El Sayed NM, Ghedin E, Song J, MacLeod A, Bringaud F, Larkin C, Wanless D, Peterson J, Hou L, Taylor S, et al. The sequence and analysis of Trypanosoma brucei chromosome II. Nucleic Acids Res. 2003;31:4856–4863. [PMC free article] [PubMed]
  • Fellenberg K, Hauser NC, Brors B, Hoheisel JD, Vingron M. Microarray data warehouse allowing for inclusion of experiment annotations in statistical analysis. Bioinformatics. 2002;18:423–33. [PubMed]
  • Fellenberg K, Hauser NC, Brors B, Neutzner A, Hoheisel JD, Vingron M. Correspondence analysis applied to microarray data. Proc Natl Acad Sci U S A. 2001;98:10781–6. [PubMed]
  • Folgueira C, Requena JM. A postgenomic view of the heat shock proteins in kinetoplastids. FEMS Microbiol Rev. 2007;31:359–77. [PubMed]
  • Gull K. The cytoskeleton of trypanosomatid parasites. Annu Rev Microbiol. 1999;53:629–55. [PubMed]
  • Guttinger A, Schwab C, Morand S, Roditi I, Vassella E. A mitogen-activated protein kinase of Trypanosoma brucei confers resistance to temperature stress. Mol Biochem Parasitol. 2007;153:203–6. [PubMed]
  • Hall N, Berriman M, Lennard NJ, Harris BR, Hertz-Fowler C, Bart-Delabesse EN, Gerrard CS, Atkin RJ, Barron AJ, Bowman S, et al. The DNA sequence of chromosome I of an African trypanosome: gene content, chromosome organisation, recombination and polymorphism. Nucleic Acids Res. 2003;31:4864–4873. [PMC free article] [PubMed]
  • Holetz FB, Correa A, Avila AR, Nakamura CV, Krieger MA, Goldenberg S. Evidence of P-body-like structures in Trypanosoma cruzi. Biochem Biophys Res Commun. 2007;356:1062–7. [PubMed]
  • Hotchkiss TL, Nerantzakis GE, Dills SC, Shang L, Read LK. Trypanosoma brucei poly(A) binding protein I cDNA cloning, expression, and binding to 5 untranslated region sequence elements. Mol Biochem Parasitol. 1999;98:117–29. [PubMed]
  • Hoyle NP, Castelli LM, Campbell SG, Holmes LE, Ashe MP. Stress-dependent relocalization of translationally primed mRNPs to cytoplasmic granules that are kinetically and spatially distinct from P-bodies. J Cell Biol. 2007;179:65–74. [PMC free article] [PubMed]
  • Ingelfinger D, Arndt-Jovin DJ, Luhrmann R, Achsel T. The human LSm1-7 proteins colocalize with the mRNA-degrading enzymes Dcp1/2 and Xrnl in distinct cytoplasmic foci. Rna. 2002;8:1489–501. [PubMed]
  • Ivens AC, Peacock CS, Worthey EA, Murphy L, Aggarwal G, Berriman M, Sisk E, Rajandream MA, Adlem E, Aert R, et al. The genome of the kinetoplastid parasite, Leishmania major. Science. 2005;309:436–42. [PMC free article] [PubMed]
  • Johnson AW. Rat1p and Xrn1p are functionally interchangeable exoribonucleases that are restricted to and required in the nucleus and cytoplasm, respectively. Mol Cell Biol. 1997;17:6122–30. [PMC free article] [PubMed]
  • Johnson PJ, Kooter JM, Borst P. Inactivation of transcription by UV irradiation of T. brucei provides evidence for a multicistronic transcription unit including a VSG gene. Cell. 1987;51:273–281. [PubMed]
  • Kedersha N, Anderson P. Mammalian stress granules and processing bodies. Methods Enzymol. 2007;431:61–81. [PubMed]
  • Kedersha N, Chen S, Gilks N, Li W, Miller IJ, Stahl J, Anderson P. Evidence that ternary complex (eIF2-GTP-tRNA(i)(Met))-deficient preinitiation complexes are core constituents of mammalian stress granules. Mol Biol Cell. 2002;13:195–210. [PMC free article] [PubMed]
  • Kedersha N, Cho MR, Li W, Yacono PW, Chen S, Gilks N, Golan DE, Anderson P. Dynamic shuttling of TIA-1 accompanies the recruitment of mRNA to mammalian stress granules. J Cell Biol. 2000;151:1257–68. [PMC free article] [PubMed]
  • Kedersha N, Stoecklin G, Ayodele M, Yacono P, Lykke-Andersen J, Fritzler MJ, Scheuner D, Kaufman RJ, Golan DE, Anderson P. Stress granules and processing bodies are dynamically linked sites of mRNP remodeling. J Cell Biol. 2005;169:871–84. [PMC free article] [PubMed]
  • Kedersha NL, Gupta M, Li W, Miller I, Anderson P. RNA-binding proteins TIA-1 and TIAR link the phosphorylation of eIF-2 alpha to the assembly of mammalian stress granules. J Cell Biol. 1999;147:1431–42. [PMC free article] [PubMed]
  • Kelly S, Reed J, Kramer S, Ellis L, Webb H, Sunter J, Salje J, Marinsek N, Gull K, Wickstead B, et al. Functional genomics in Trypanosoma brucei: a collection of vectors for the expression of tagged proteins from endogenous and ectopic gene loci. Mol Biochem Parasitol. 2007;154:103–9. [PMC free article] [PubMed]
  • Kimball SR, Horetsky RL, Ron D, Jefferson LS, Harding HP. Mammalian stress granules represent sites of accumulation of stalled translation initiation complexes. Am J Physiol Cell Physiol. 2003;284:C273–84. [PubMed]
  • Kooter JM, Van der Spek HJ, Wagter R, d'Oliviera CE, Van der Hoeven F, Johnson PJ, Borst P. The anatomy and transcription of a telomeric expression site for variant specific surface antigens in Trypanosoma brucei. Cell. 1987;51:261–272. [PubMed]
  • LeBowitz JH, Smith HQ, Rusche L, Beverley SM. Coupling of poly(A) site selection and trans-splicing in Leishmania. Genes & Dev. 1993;7:996–1007. [PubMed]
  • Lee MG. Heat shock does not increase the transcriptional efficiency of the Hsp 70 genes of Trypanosoma brucei. Exp Parasitol. 1995;81:608–13. [PubMed]
  • Lee MG. The 3′ untranslated region of the hsp 70 genes maintains the level of steady state mRNA in Trypanosoma brucei upon heat shock. Nucleic Acids Res. 1998;26:4025–4033. [PMC free article] [PubMed]
  • Lee MG, Van der Ploeg LH. Transcription of the heat shock 70 locus in Trypanosoma brucei. Mol Biochem Parasitol. 1990;41:221–31. [PubMed]
  • Li CH, Irmer H, Gudjonsdottir-Planck D, Freese S, Salm H, Haile S, Estevez AM, Clayton C. Roles of a Trypanosoma brucei 5′->3′ exoribonuclease homolog in mRNA degradation. Rna. 2006;12:2171–86. [PubMed]
  • Liang XH, Haritan A, Uliel S, Michaeli S. trans and cis splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryot Cell. 2003;2:830–40. [PMC free article] [PubMed]
  • Liu Q, Liang XH, Uliel S, Belahcen M, Unger R, Michaeli S. Identification and functional characterization of lsm proteins in Trypanosoma brucei. J Biol Chem. 2004;279:18210–9. [PubMed]
  • Luu VD, Brems S, Hoheisel JD, Burchmore R, Guilbride DL, Clayton C. Functional analysis of Trypanosoma brucei PUF1. Mol Biochem Parasitol. 2006;150:340–9. [PubMed]
  • Marchetti MA, Tschudi C, Kwon H, Wolin SL, Ullu E. Import of proteins into the trypanosome nucleus and their distribution at karyokinesis. J Cell Sci. 2000;113(Pt 5):899–906. [PubMed]
  • Martinez-Calvillo S, Nguyen D, Stuart K, Myler PJ. Transcription initiation and termination on Leishmania major chromosome 3. Eukaryot. Cell. 2004;3:506–517. [PMC free article] [PubMed]
  • Martinez-Calvillo S, Yan S, Nguyen D, Fox M, Stuart K, Myler PJ. Transcription of Leishmania major Friedlin chromosome 1 initiates in both directions within a single region. Mol. Cell. 2003;11:1291–1299. [PubMed]
  • Matthews KR, Tschudi C, Ullu E. A common pyrimidine-rich motif governs trans-splicing and polyadenylation of tubulin polycistronic pre-mRNA in trypanosomes. Genes & Dev. 1994;8:491–501. [PubMed]
  • Mazroui R, Sukarieh R, Bordeleau ME, Kaufman RJ, Northcote P, Tanaka J, Gallouzi I, Pelletier J. Inhibition of ribosome recruitment induces stress granule formation independently of eukaryotic initiation factor 2alpha phosphorylation. Mol Biol Cell. 2006;17:4212–9. [PMC free article] [PubMed]
  • McCulloch R, Vassella E, Burton P, Boshart M, Barry JD. Transformation of monomorphic and pleomorphic Trypanosoma brucei. Methods Mol Biol. 2004;262:53–86. [PubMed]
  • McDonagh PD, Myler PJ, Stuart K. The unusual gene organisation of Leishmania major chromosome 1 may reflect novel transcription processes. Nucl. Acids Res. 2000;28:2800–2803. [PMC free article] [PubMed]
  • McEwen E, Kedersha N, Song B, Scheuner D, Gilks N, Han A, Chen JJ, Anderson P, Kaufman RJ. Heme-regulated inhibitor kinase-mediated phosphorylation of eukaryotic translation initiation factor 2 inhibits translation, induces stress granule formation, and mediates survival upon arsenite exposure. J Biol Chem. 2005;280:16925–33. [PubMed]
  • McNally KP, Agabian N. Trypanosoma brucei spliced-leader RNA methylations are required for trans splicing in vivo. Mol. Cell. Biol. 1992;12:4844–4851. [PMC free article] [PubMed]
  • Milone J, Wilusz J, Bellofatto V. Identification of mRNA decapping activities and an ARE-regulated 3′ to 5′ exonuclease activity in trypanosome extracts. Nucleic Acids Res. 2002;30:4040–50. [PMC free article] [PubMed]
  • Moraes MC, Jesus TC, Hashimoto NN, Dey M, Schwartz KJ, Alves VS, Avila CC, Bangs JD, Dever TE, Schenkman S, et al. Novel membrane-bound eIF2alpha kinase in the flagellar pocket of Trypanosoma brucei. Eukaryot Cell. 2007;6:1979–91. [PMC free article] [PubMed]
  • Mottram JC, Murphy WJ, Agabian N. A transcriptional analysis of the Trypanosoma brucei hsp83 gene cluster. Mol Biochem Parasitol. 1989;37:115–27. [PubMed]
  • Muhich ML, Boothroyd JC. Polycistronic transcripts in trypanosomes and their accumulation during heat shock: evidence for a precursor role in mRNA synthesis. Mol. Cell. Biol. 1988;8:3837–3846. [PMC free article] [PubMed]
  • Muhich ML, Boothroyd JC. Synthesis of trypanosome hsp70 mRNA is resistant to disruption of trans-splicing by heat shock. J Biol Chem. 1989;264:7107–10. [PubMed]
  • Muhich ML, Hsu MP, Boothroyd JC. Heat-shock disruption of trans-splicing in trypanosomes: effect on Hsp70, Hsp85 and tubulin mRNA synthesis. Gene. 1989;82:169–75. [PubMed]
  • Ngo H, Tschudi C, Gull K, Ullu E. Double-stranded RNA induces mRNA degradation in Trypanosoma brucei. Proc Natl Acad Sci U S A. 1998;95:14687–92. [PubMed]
  • Page AM, Davis K, Molineux C, Kolodner RD, Johnson AW. Mutational analysis of exoribonuclease I from Saccharomyces cerevisiae. Nucleic Acids Res. 1998;26:3707–16. [PMC free article] [PubMed]
  • Parker R, Sheth U. P bodies and the control of mRNA translation and degradation. Mol Cell. 2007;25:635–46. [PubMed]
  • Robinson DR, Sherwin T, Ploubidou A, Byard EH, Gull K. Microtubule polarity and dynamics in the control of organelle positioning, segregation, and cytokinesis in the trypanosome cell cycle. J Cell Biol. 1995;128:1163–72. [PMC free article] [PubMed]
  • Rubotham J, Woods K, Garcia-Salcedo JA, Pays E, Nolan DP. Characterization of two protein disulfide isomerases from the endocytic pathway of bloodstream forms of Trypanosoma brucei. J Biol Chem. 2005;280:10410–8. [PubMed]
  • Schimanski B, Nguyen TN, Gunzl A. Highly efficient tandem affinity purification of trypanosome protein complexes based on a novel epitope combination. Eukaryot Cell. 2005;4:1942–50. [PMC free article] [PubMed]
  • Schwede A, Ellis L, Luther L, Carrington M, Stoecklin G, Clayton CE. A role for CAF1 in eukaryotic mRNA deadenylation and decay. Nulceic Acids Res. 2008 in press. [PMC free article] [PubMed]
  • Schürch N, Hehl A, Vassella E, Braun R, Roditi I. Accurate polyadenylation of procyclin mRNAs in Trypanosoma brucei is determined by pyrimidine-rich elements in the intergenic regions. Mol. Cell. Biol. 1994;14:3668–3675. [PMC free article] [PubMed]
  • Searle S, Smith DF. Leishmania major: characterisation and expression of a cytoplasmic stress-related protein. Exp Parasitol. 1993;77:43–52. [PubMed]
  • Sherwin T, Gull K. Visualization of detyrosination along single microtubules reveals novel mechanisms of assembly during cytoskeletal duplication in trypanosomes. Cell. 1989;57:211–21. [PubMed]
  • Sheth U, Parker R. Decapping and decay of messenger RNA occur in cytoplasmic processing bodies. Science. 2003;300:805–8. [PMC free article] [PubMed]
  • Solinger JA, Pascolini D, Heyer WD. Active-site mutations in the Xrn1p exoribonuclease of Saccharomyces cerevisiae reveal a specific role in meiosis. Mol Cell Biol. 1999;19:5930–42. [PMC free article] [PubMed]
  • Stagno J, Aphasizheva I, Rosengarth A, Luecke H, Aphasizhev R. UTP-bound and Apo structures of a minimal RNA uridylyltransferase. J Mol Biol. 2007;366:882–99. [PMC free article] [PubMed]
  • Ullu E, Matthews KR, Tschudi C. Temporal order of RNA-processing reactions in trypanosomes: rapid trans splicing precedes polyadenylation of newly synthesised tubulin transcripts. Mol. Cell. Biol. 1993;13:720–725. [PMC free article] [PubMed]
  • Ullu E, Tschudi C. Trans splicing in trypanosomes requires methylation of the 5′ end of the spliced leader RNA. Proc Natl Acad Sci U S A. 1991;88:10074–8. [PubMed]
  • Vickerman K, Preston T. Comparative cell biology of the kinetoplastid flagellates. Biology of the Kinetoplastida. 1976;1:35–130.
  • Webb H, Burns R, Ellis L, Kimblin N, Carrington M. Developmentally regulated instability of the GPI-PLC mRNA is dependent on a short lived protein factor. Nucleic Acids Res. 2005;33:1503–1512. [PMC free article] [PubMed]
  • Wek RC, Jiang HY, Anthony TG. Coping with stress: eIF2 kinases and translational control. Biochem Soc Trans. 2006;34:7–11. [PubMed]
  • Wilczynska A, Aigueperse C, Kress M, Dautry F, Weil D. The translational regulator CPEB1 provides a link between dcp1 bodies and stress granules. J Cell Sci. 2005;118:981–92. [PubMed]
  • Wirtz E, Leal S, Ochatt C, Cross GA. A tightly regulated inducible expression system for conditional gene knock-outs and dominant-negative genetics in Trypanosoma brucei. Mol Biochem Parasitol. 1999;99:89–101. [PubMed]
  • Yang WH, Yu JH, Gulick T, Bloch KD, Bloch DB. RNA-associated protein 55 (RAP55) localizes to mRNA processing bodies and stress granules. Rna. 2006;12:547–54. [PubMed]