PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC 2010 September 10.
Published in final edited form as:
PMCID: PMC2863080
NIHMSID: NIHMS186293

SYNAPTIC LOCALIZATION AND FUNCTION OF SIDEKICK RECOGNITION MOLECULES REQUIRE MAGI SCAFFOLDING PROTEINS

SUMMARY

Four transmembrane adhesion molecules – Sidekick-1, Sidekick-2, Dscam and Dscam-like – are determinants of lamina-specific synapse formation in the vertebrate retina. Their carboxy termini are predicted to bind PDZ domains, which are present in many synaptic scaffolding proteins. We identify members of the MAGI and PSD-95 subfamilies of multi-PDZ domain proteins as binding partners for Sidekicks and Dscams. Specific MAGI and PSD-95 family members are present in distinct subsets of retinal synapses, as are Sidekicks and Dscams. Using Sidekick-2 as exemplar, we show that its PDZ-binding carboxy terminus is required for both its synaptic localization in photoreceptors and its ability to promote lamina-specific arborization of pre- and postsynaptic processes in the inner plexiform layer. In photoreceptor synapses, which contain both MAGI-1 and PSD-95, Sidekick-2 preferentially associates with MAGI-1. Depletion of MAGI-1 from photoreceptors by RNA interference blocks synaptic localization of Sidekick 2 in photoreceptors without affecting localization of PSD-95. Likewise, depletion of MAGI-2 from retinal ganglion cells and interneurons interferes with Sidekick 2-dependent laminar targeting of processes. These results demonstrate that localization and function of Sidekick-2 requires its incorporation into a MAGI-containing synaptic scaffold.

Keywords: Dscam, Laminar Specificity, PDZ domains, PSD-95, Synaptogenesis, Adhesion

INTRODUCTION

At chemical synapses, the nerve terminal is specialized for neurotransmitter release, the postsynaptic apparatus is specialized for signal transduction, structures that mediate release and response are precisely apposed to each other, and appropriate partners are selectively matched to form functional circuits (Craig et al., 2006; McAllister, 2007; Sanes and Yamagata, 2009). Key to all of these processes is the selective association of synaptic components with pre- and postsynaptic membranes. Accordingly, proteins that generate and maintain such associations are critical for synaptic development and function. Several intracellular binding partners have been found that are required for localization of particular neurotransmitter receptors in the postsynaptic membrane. These include rapsyn, gephyrin, and members of the postsynaptic density (PSD)-95 family, which are involved in aggregation of acetylcholine, glycine and AMPA-type glutamate receptors, respectively (Gautam et al., 1995; Feng et al., 1998; Banks et al., 2003; Fritschy et al., 2008; Ehrlich and Malinow, 2004; Elias et al., 2006; Prybylowski et al., 2005). For other synaptic membrane proteins, however, localization and clustering mechanisms remain poorly understood.

Here, we address this issue with regard to a set of four closely related homophilix adhesion molecules that are localized to specific synapses in retina: Sidekick-1, Sidekick-2, Down’s Syndrome Cell Adhesion Molecule (Dscam) and Dscam-like-1 (DscamL). Sidekicks and Dscams are expressed by mutually exclusive neuronal subsets in the chick retina, and they mediate selective connectivity among neurons that express the same molecules (Yamagata et al., 2002; Yamagata and Sanes, 2008). Dscams also mediate intercellular interactions in mouse retina, brain stem and spinal cord (Fuerst et al., 2008, 2009; Ly et al., 2008; Amano et al., 2009).

Sidekicks and Dscams terminate in sequences predicted to bind to PDZ (PSD-95/Discs Large/ ZO-1) domains, ~90 amino acid modules present in numerous scaffolding proteins that are localized at a variety of intercellular junctions, including synapses. PDZ domains bind carboxy-terminal consensus sequences of numerous proteins involved in synaptic differentiation and function. PDZ domain proteins play diverse roles in the trafficking, anchoring and clustering of neurotransmitter receptors and in linking them to signaling partners and cytoskeletal elements (Ehrlich and Malinow, 2004; Elias et al., 2006; Prybylowski et al., 2005; Kim and Sheng, 2004; Funke et al., 2005; Feng and Zhang, 2009). We therefore tested the possibility that PDZ domain proteins are also required for synaptic development.

We show here that Sidekicks and Dscams interact with PDZ domain-containing synaptic scaffolding proteins of the MAGI (Membrane-associated Guanylate Kinase with Inverted Orientation) subfamily (Funke et al., 2005; Feng and Zhang, 2009; Cho et al., 1992; Hirao et al., 1998). In the retina, the three MAGI subfamily members, like Sidekicks and Dscams, are expressed by subsets of retinal neurons, leading to complex combinatorial patterns of adhesion and scaffolding proteins. Using Sidekick-2 as an exemplar, we show that interaction with MAGI proteins is necessary for localization and developmental function of this synaptic adhesion molecule in vivo. Together our results suggest that interaction with synaptic scaffolding molecules is required for target recognition molecules to trigger and regulate synaptic differentiation.

METHODS

Reagents

Expression vectors and piggyBac transposons encoding mouse Sidekick-1, Sidekick-2, Dscam, and DscamL were described previously (Yamagata and Sanes, 2008). The piggyBac transposon vectors contained a cytomegalovirus (CMV) promoter and enhancer, the Sidekick or Dscam cDNA, and a SV40 polyadenylation signal. In some cases, the cDNA was followed by an internal ribosome entry side (IRES) and GFP. A Sidekick-2 mutant lacking the C-terminal tripeptide -SFV (Sidekick-2ΔSFV) was generated by using PCR to replace this sequence with a termination codon (TAG). Fragments of MAGI-1 and SAP102 were cloned into pCMV-Tag3B vector (Stratagene, La Jolla, CA) to obtain myc-tagged constructs. A full length mouse MAGI-1b tagged with FLAG was obtained from Addgene, Cambridge, MA (Vazquez et al., 2001). cDNA encoding mouse PSD95 was amplified from P0 mouse brain and fused to Cerulean (cyan) fluorescent protein in pCMV-N1-Cerulean. Full length cDNAs encoding chick MAGI-1, MAGI-2, and MAGI-3 were amplified from E17 chick retina, and cloned into pCMV-3Tag-9 (Stratagene) or pCMV-N1-mCherry to fuse to monomeric Cherry red fluorescent protein. Partial cDNA sequences of chick Cipp, Pist/Cal, Chapsyn110, and SAP102 were amplified, cloned into pGEM-Teasy vectors (Promega, Madison, WI) and used as templates to generate riboprobes for in situ hybridization.

For performing RNA interference, the following DNA sequences were cloned into pcDNA6.2-GW/EmGFP-miR (Invitrogen, Carlsbad, CA). MAGI-1A: TGCTGACAGCATGGCGATAAAGGTTAGTTTTGGCCACTGACTGACTAACCTTT CGCCATGCTGT and MAGI-2C: TGCTGTAGACAATCACATCACCTGTTGTTTTGGCCACTGACTGACAACAGGTG GTGATTGTCTA. They were chained to generate two tandem copies, and transferred to a unique ClaI site of RCAS-BP(B) vectors together with EmGFP as described previously (Yamagata and Sanes, 2008). RCAS replication-competent retroviruses were generated by in vivo electroporation to optic vesicles (see below). As an alternative, the EmGFP-miR cassettes were transferred to pXL-BacII-CAG-Dest plasmid using LR clonase (Invitrogen). This Gateway destination vector pXL-BacII-CAG-Dest bears a RfA fragment (Gateway vector conversion system, Invitrogen) between CAG promoter (Addgene) and ß-globin polyadenylation signal flanked by piggyBac transposon sequences (Li et al., 2001).

Antibodies to Sidekick-1, Sidekick-2, Dscam, and DscamL were described previously (Yamagata et al., 2002;Yamagata and Sanes, 2008). The antibodies were generated to chick antigens but antibody CS22, to Sidekick-2, crossreacts with mouse Sidekick-2. A rabbit polyclonal antibody to mouse MAGI-1 was a gift from J. Cartaud (Universites Paris, Paris, France) (Strochlic et al., 2001). This antibody was generated to the peptide CPRNPPEQRRRPYKE; the final 9-mer is perfectly conserved in chick. Anti-PSD95 (IgG2a) was from Affinity BioReagents (Golden, CO); monoclonal antibodies to visinin, synaptotagmin (Mab 48), SV2 and myc (9E10) were from Developmental Studies Hybridoma Bank (Iowa City, IA); monoclonal antibodies to pan-PDZ (pan-MAGUK) and chapsyn110 were from NeuroMab (Davis, CA); rabbit anti-MAGI-2 (M2441) and anti-FLAG were from Sigma (St. Louis, MO); mouse anti-MAGI-3 (612676) was from BD Biosciences (San Jose, CA); rabbit anti-myc was from Immunology Consultants Laboratory (Newberg, OR); and secondary antibodies were from Invitrogen.

Yeast two hybrid screening

Yeast two hybrid screening (Fields and Song, 1989) was performed using BD Matchmaker Two-Hybrid System 3 (Clontech, Palo Alto, CA) essentially as described in the manufacturer’s protocol. Bait cDNA segments corresponding to C-terminal segments of mouse Sidekick-1 or Sidekick-2 were cloned into the EcoRI/SalI site of pGBKT7. Mouse brain and spinal cord cDNA libraries in HybriZAP (Stratagne) were gifts of G. Feng (Duke University, Durham, NC). The growth of yeast strain AH109 was monitored on –Ade/-His/-Leu/-Trp plates.

In ovo electroporation

RCAS plasmids or a 10: 1 mixture of transposon plasmid(s) and a piggyBac transposase plasmid were injected into the optic vesicles of E2 (Hamburger-Hamilton stage 9–11) chick embryos. Electroporation was with three square pulses of 7 V, 25 ms using ECM830 (Harvard Apparatus, Holliston, MA). Embryos were fixed with 4% (w/v) paraformaldehyde in PBS, and sectioned at E17.

Histology

For immunohistochemistry, the retina was dissected free of the eye cup and fixed with 4% paraformaldehyde in PBS for 2 h at 4°C. The tissue was sunk in 30% sucrose/PBS, frozen in OCT compound, and sectioned at 20 μm in a cryostat. Sections were mounted on gelatin-subbed slides, treated with 0.1% (w/v) Triton X-100 in PBS for 10 min at room temperature, blocked with 5% skim milk in PBS for 30 min, and then incubated successively with primary and secondary antibodies. In situ hybridization was performed using NBT/BCIP for colorimetric detection of digoxigenin-labeled riboprobes (Yamagata et al., 2002).

Cell culture

Human embryonic kidney (HEK) 293 cells obtained from ATCC (Manassas, VA) were transfected with expression vectors containing a CMV promoter, using DMRIE-C (Invitrogen). Stably expressing cells were selected in G418-supplemented medium, and highly-expressing clones were used for further studies. To cluster Sidekick-2 on the surface of HEK cells, cultures were incubated with 2 μg/ml CS22 IgG, rinsed with culture medium, incubated with Alexa568-coupled goat anti-mouse antibodies, rinsed again, and fixed with 4% paraformaldehyde/PBS. The cells were methanol-treated at -20C for 15min, and stained with rabbit anti-myc antibodies, followed by Alexa488-coupled goat anti-rabbit antibodies.

Retinal cells were dissociated from embryonic chicks at E16 using papain (Worthington, Lakewood, NJ) and plated onto transfected HEK cells. The cocultures were maintained in Neurobasal medium (Invitrogen) with 10% (v/v) FCS and 2%(v/v) B27 (Invitrogen) for 4 days before being fixed and stained. To doubly stain cultures for visinin plus anti-SV2, which are both IgG1 antibodies, we used the Zenon technology kit (Invitrogen) according to the manufacturer’s instructions.

RESULTS

Localization and function of Sidekick-2 depend on its PDZ-binding motif

Sidekick proteins bear a carboxy terminal hexapeptide sequence, –GFSSFV, which is perfectly conserved in all known vertebrates and invertebrate orthologues (Table 1a). This sequence is predicted to bind PDZ domains, with the terminal tripeptide S/T-x-V, called a type I PDZ-binding motif, being the critical determinant (Songyang et al., 1997). To ask whether this canonical PDZ-binding motif is required for synaptic localization of Sidekick proteins, we analyzed the large, easily visualized synapses that photoreceptors form onto interneurons (horizontal and bipolar cells) in the outer plexiform layer of the retina. Sidekick-2 but not Sidekick-1 is expressed by photoreceptors and present at these synapses (Yamagata et al, 2002; Fig. 1a-d). We therefore generated expression vectors encoding GFP plus wild-type Sidekick-2, or a Sidekick2 mutant lacking the last 3 amino acids (Sdk2ΔSFV). Using in ovo electroporation, we introduced these constructs into the optic vesicle of chick embryos. Because gene transfer is most efficient at embryonic day (E)2 but synapses are not mature until E17, we used a PiggyBac transposon-transposase system, which results in genomic integration of introduced sequences, thereby allowing stable, long-term expression (Yamagata and Sanes, 2008). Transduced cells were recognizable by coexpression of GFP. Wild type Sidekick-2 was concentrated at photoreceptor synapses, in a pattern indistinguishable from that of the endogenous protein (Fig. 1e,g). In contrast, Sdk2ΔSFV protein was diffusely distributed in photoreceptor cells (Fig. 1f,h). These results demonstrate that that the carboxy terminal PDZ-binding motif in Sidekick-2 is important for its synaptic localization.

Figure 1
Localization of Sidekick-2 at photoreceptor synapses requires its C-terminus
Table 1
Phylogenetic conservation of PDZ domain-binding carboxy termini of Sidekicks and Dscams

We next asked whether Sidekick-2 function requires its carboxy terminus. We could not use photoreceptors for this purpose, because roles of Sidekicks in these cells have not yet been defined. Instead, we assessed targeting of processes in the inner plexiform layer (IPL). Processes of amacrine and bipolar cells arborize in one or a few sublaminae within the IPL, where they form synapses on similarly sublamina-restricted dendrites of retinal ganglion cells (Masland, 2001; Wassle, 2004). There are 10 or more sublaminae in the chick IPL, but we follow the convention (Ramon y Cajal, 1892) of dividing the IPL into 5 parallel slabs of equal width, S1-S5. Synapses containing Sidekick-2 are concentrated in two sublaminae of the IPL: most are in the outer portion of S2, and a minority is in the outer portion of S4. Overexpression of Sidekick-2 in cells that are normally Sidekick-2-negative redirects their processes to S2 and S4 (Yamagata et al., 2002; Yamagata and Sanes, 2008; Fig. 2a,b,d,e). In contrast, overexpression of Sidekick-2ΔSFV, or of a Sidekick-2 mutant lacking most of the cytoplasmic domain (Sidekick-2ΔCyto) had no detectable effect of the laminar positioning of processes in the IPL (Fig.1c,f and data not shown). This result indicates that the PDZ-binding motif is required for Sidekick-2 to direct laminar specificity.

Figure 2
Function of Sidekick-2 in the inner plexiform layer requires its C-terminus

Sidekicks and Dscams bind MAGI and PSD-95 family members

To identify binding partners for the C-terminal domain of Sidekicks, we performed yeast two-hybrid screens (Fields and Song, 1989), using the C-terminal 50 amino acids of Sidekick-1 and Sidekick-2 as baits. Approximately 1× 107 clones from a brain library and 4× 106 clones from a spinal cord library were screened. Positive clones were retested to verify the specificity of the interaction, and then inserts were sequenced and identified.

The verified interactors obtained in these screens encoded proteins with PDZ domains. They included three of four members of the PSD-95 family (PSD-95/SAP90/DLG4, chapsyn110/PSD93/DLG2, and SAP102/DLG3), two of three members of the MAGI family (MAGI-1/BAP1/WWP3/TNRC19 and MAGI-2/S-SCAM/AIP/KIAA0705), Pist/Cal (PDZ domain protein interacting specifically with TC10/cystic fibrosis transmembrane conductance regulator-associated ligand), Cipp/PatJ (Channel-interacting PDZ domain protein/Pals1-associated tight junction protein), and Par6α (Funke et al., 2005; Neudauer et al., 2001; Kurschner et al., 1998) (Supplementary Table 1). The isolated fragments suggested that Sidekicks bind to PDZ domains 2 and/or 3 in MAGI proteins and PDZ domain 3 in PSD-95 proteins. All PDZ domain-containing fragments isolated bound with similar strength to Sidekick-1 and Sidekick-2, and reacted as well with the C-terminal 7 amino acids as with the C-terminal 50 amino acids (not shown). Thus, binding of Sidekicks to the PDZ domain-containing fragments can be entirely accounted for by their C-termini.

Next, we used the two-hybrid system to assess interactions of the PDZ domain-containing fragments isolated using Sidekicks with PDZ-binding C-termini of Dscams (Table 2). Using the growth rate of doubly-transformed yeast as an approximate indicator of binding strength, we found that the C-termini of Dscams bound similarly to the C-termini of Sidekicks, despite differences in their sequences (Dscams: -KSYTLV; Sidekicks: –GFSSFV). In contrast, preferences of three other PDZ-binding synaptic components - the NMDA receptor 2B subunit (C-terminal, -SIESDV), and the adhesion molecules NrCAM (-AMNSFV) and neuroligin-1 (-HSTTRV) – differed from each other and from Sidekicks and Dscams (Table 2). For example, the NMDA-receptor 2B did not bind detectably to the MAGI fragments; neuroligin-1 bound only to the MAGI-derived fragment that contained PDZ domain 1 (Iida et al., 2004); and NrCAM preferred PSD-95 family members to MAGI family members. Thus, within the limited set of synaptic proteins tested, the PDZ binding patterns of Sidekicks and Dscams are most similar to each other.

Table 2
Binding of neural cell adhesion molecules to PDZ domains assessed in yeast

To ask whether Sidekicks and Dscams interact with PSD-95 and MAGI family members in vertebrate cells, we assessed the extent to which they colocalized when introduced into human embryonic kidney (HEK) 293 cells. In one assay, epitope-tagged fragments of one MAGI family member, MAGI-1 or one PSD-95 family member, SAP-102, were coexpressed with Sidekick-2, Dscam or the Sidekick-2ΔSFV mutant described above. Each was diffusely distributed when expressed alone, but Sidekick-2 and Dscam could be induced to cluster by incubating live cells successively with a specific antibody and a fluorophore-tagged secondary antibody. Antibody-mediated aggregation of Sidekick-2 or Dscam induced co-aggregation of MAGI-1 and SAP-102, whereas aggregation of Sidekick-2ΔSFV had no effect on MAGI-1 or SAP-102 distribution (Fig. 3a).

Figure 3
Sidekicks and Dscams interact with PDZ domain proteins in vertebrate cells

In a second assay, we introduced Dscams or Sidekicks into cells expressing full-length MAGI-1, then cultured cells at high density. The homophilic binding of Sidekicks and Dscams concentrates these adhesion molecules at points of contact between cells that express them (Yamagata and Sanes, 2008). MAGI-1 was diffusely distributed in HEK cells when expressed alone but concentrated at cell-cell contact sites when co-expressed with Sidekicks or Dscams (Fig. 3b). A Sidekick-1 protein in which the carboxy-terminus was occluded by fusion to GFP aggregated at cell-cell contact sites, but failed to recruit MAGI-1 (not shown). MAGI-2 was also aggregated by Sidekick-1 but not by Sidekick-1-GFP (Fig. 3c). Together, these results demonstrate that Sidekicks and Dscams interact with PSD-95 and MAGI family members at the plasma membrane of vertebrate cells.

Sidekick 2 differentially recruits MAGI-1 and PSD-95 to photoreceptor synapses

As a prelude to analyzing roles of Sidekick- and Dscam-PDZ protein interactions in vivo, we assessed the expression of the PDZ domain-containing binding partners in retina. In situ hybridization showed that each of the 3 MAGI genes was expressed by subsets of retinal neurons (Figure 4a-c) and immunohistochemical staining showed that MAGI 1-3 proteins, like Sidekicks and Dscams (Yamagata et al, 2002; Yamagata and Sanes, 2008), were concentrated at subsets of synapses in the outer and inner plexiform layers (Fig. 4d-f). Strikingly, MAGI-1 but not MAGI-2 or -3 was expressed at high levels by photoreceptors and concentrated at synapses in the outer plexiform layer. PSD-95 family members and Pist/Cal were also expressed by subsets of retinal cells (Supplemental Fig. 1a-c). PSD-95 was present at high levels in the outer plexiform layer, but at low levels in the inner plexiform layer (Supplemental Figure 1e).

Figure 4
Differential localization of MAGI-1-3 in retina

Photoreceptor terminals form synapses on both horizontal and bipolar cell processes in the outer plexiform layer, with the latter forming an annulus around the former (Fig. 5h). These synapses bore Sidekick-2, PSD-95 and MAGI-1 but not Sidekick-1, MAGI-2 or MAGI-3 (Figs. 1, ,3,3, and Yamagata et al., 2002). MAGI-1 was concentrated in the core domain, indicating an association with horizontal cell synapses, whereas PSD-95 was concentrated in the annular domain, indicating an association with bipolar cell synapses (Fig. 4a-f). The presynaptic localization of PSD-95 contrasts with its postsynaptic localization at many central synapses, but is consistent with its presence in photoreceptor terminals in rodents (Koulen et al., 1998). Remarkably, Sidekick-2 was co-localized with MAGI-1 in the core domain, and present at significantly lower levels in the annular domain (Fig. 4a-d). When tagged MAGI-1 and PSD-95 were coexpressed in photoreceptor cells, the cognate proteins were differentially recruited to core and annular domains, respectively (Fig. 4g,h), confirming that photoreceptor cells can differentially deliver these proteins to distinct subcellular domains.

Figure 5
Differential localization of PDZ domain proteins and Sidekick 2 in the outer retina

These results suggest that Sidekick-2 associates preferentially with MAGI-1 over PSD-95 in photoreceptors. To test this idea, we analyzed the distribution of MAGI-1 and PSD-95 in photoreceptors cultured on Sidekick-2-expressing HEK cells, reasoning that it would recruit Sidekick-2 in the photoreceptors as it does in the HEK cells (Fig. 3b).

Photoreceptors, identified with antibodies to the specific marker, visinin(Bruhn and Cepko, 1996), extended short processes on HEK cells (Fig. 6a, d, g). MAGI-1 clustered at sites of contact between photoreceptor processes and Sidekick-2-expressing HEK cells, but not at sites of contact with Sidekick1-expressing or non-transfected HEK cells (Fig. 6a-c, j). The distribution of PSD-95 was not affected by contact with either transfected or non-transfected HEK cells (Fig. 6d-f). By contrast, Sidekick recruited MAGI and PSD-95 equally well when all three proteins are coexpressed in HEK cells (Fig. 6k,l). Thus, factors specific to photoreceptors lead to a specific association between Sidekick and MAGI.

Figure 6
Photoreceptors recruit MAGI-1 but not PSD-95 to sites of contact with Sidkick-2

Interestingly, SV2, a component of synaptic vesicles, was aggregated in stretches of photoreceptor processes that contacted Sidekick-2-expressing cells (Fig. 6g-i), raising the possibility that Sidekick-mediated transsynaptic interactions can promote presynaptic differentiation, as has been shown for other synaptic adhesion molecules such as neuroligin, SynCAM, and SIRP-α (Scheiffele et al., 2000; Biederer et al., 2002; Umemori and Sanes, 2008).

Association with MAGI 1 is required for synaptic localization of Sidekick 2

To ask whether synaptic localization of Sidekick-2 in vivo depends on MAGI-1, we identified an interfering RNA that targeted MAGI-1 effectively in cultured cells (Supplementary Fig. 2a), incorporated it into a microRNA-based vector that co-expressed GFP, and electroporated it into retina as described above for Sidekick. Expression of the interfering RNA led to a substantial decrease in MAGI-1 levels (Fig. 7a). Sidekick-2 levels were also decreased in GFP-positive, MAGI-1-depleted photoreceptors, but not in their GFP-negative, MAGI-1-positive neighbors (Fig. 7b). As control, we used vectors encoding GFP alone or along with an interfering RNA that targeted MAGI-2 (Supplementary Fig. 2b), which is not expressed by photoreceptors (see above); neither had a discernible effect on MAGI-1 or Sidekick-2 levels in photoreceptors (Fig. 7e, f and data not shown). We conclude that MAGI-1 is required for localization of Sidekick-2. We were unable to determine, however, whether total levels of Sidekick-2 were decreased, or whether protein that would otherwise be concentrated at the synapse was diffusely distributed in the absence of MAGI-1.

Figure 7
Depletion of MAGI-1 alters synaptic localization of Sidekick-2 in photoreceptors

We also asked whether loss of MAGI-1 and Sidekick-2 from the presynaptic membrane perturbed localization of other components of photoreceptor terminals. PSD-95 and SV2 were not detectably affected by the loss of MAGI-1 (Fig. 7c,d). Thus, although Sidekick can recruit synaptic vesicles in photoreceptors, it is not required for vesicle recruitment in vivo.

Association with MAGI 2 is required for synaptic function of Sidekick 2

As noted above, MAGI-2 and MAGI-3 but not MAGI-1 are concentrated in specific sublaminae of the IPL (Fig. 3). Double-label immunohistochemistry revealed that MAGI-2 and -3-rich sublaminae are nonoverlapping, indicating that MAGI-2 and -3 are present in distinct synapses (Fig. 8a). We then asked whether either MAGI protein was codistributed with Sidekicks or Dscams. The two bands rich in MAGI-2 corresponded to those that contain Sidekick-positive synapses, and one of three bands rich in MAGI-3 corresponded to that in which Dscam-positive synapses are concentrated (Fig. 8b, c, and data not shown). Confocal images suggested that MAGI-2 and Sidekick-2 were present in the same synaptic puncta, as were MAGI-3 and Dscam (Fig. 8b, c insets). The two Dscam-negative MAGI-3-positive bands contained few if any DscamL- or Sidekick positive synapses, but instead corresponded to sublaminae in which cholinergic starburst amacrines arborize (Fig. 8d-f).

Figure 8
Association of MAGI-2 and -3 with nonoverlapping sublaminae in the IPL

For functional analysis, we used RNA interference to deplete MAGI-2 from retina, and asked whether its loss affected the sublaminar concentration of Sidekicks, with which it is localized. We used retroviral vectors for this study rather than transposons, in order to transduce large groups of neuron (Fig. 9a,f). RNAi directed at MAGI-2 but not at MAGI-1 depleted MAGI-2 both in cultured cells (Supplemental Fig. 2b) and in the IPL (Fig. 9c,h). RNAi directed at MAGI-2 but not at MAGI-1 also led to a strong decrease in Sidekick-2 immunoreactivity (Fig. 9b,g). Thus, consistent with their expression patterns, MAGI-1 and MAGI-2 are required for localization of Sidekick-2 in the outer and inner plexiform layers, respectively.

Figure 9
Depletion of MAGI-2 in IPL disrupts Sidekick-positive sublaminae in the inner plexiform layer

When Sidekick-2 is depleted from retinal neurons, their processes defasciculate and are no longer confined to specific sublaminae within the IPL (Yamagata and Sanes, 2008). Loss of Sidekick immunoreactivity from the IPL following downregulation of MAGI-2 could also reflect defasciculation, but could also result from redistribution of the protein within otherwise unaltered processes. To distinguish between these alternatives, we stained retinae with antibodies to calbindin, a soluble protein coexpressed by Sidekick-2 positive cells that arborize in S4 (Fig. 9d) (Yamagata and Sanes, 2008). Calbindin-positive processes were present but no longer confined to S4 following depletion of MAGI-2 (Fig.9d,i). In contrast, laminar markers such as choline acetyltransferase and cadherin 4 (R-cadherin), which were not colocalized with MAGI-2, were unaffected by MAGI-2 depletion (Fig. 9e,j and data not shown). These results demonstrate that MAGI proteins are required for Sidekick-2 to promote lamina-specific synapse formation in the IPL.

DISCUSSION

Mechanisms that promote aggregation of neurotransmitter receptors in the postsynaptic membrane have been analyzed in considerable detail (references in Introduction) but very little is known about how other synaptic components become localized to synaptic sites. Our study began with the observation that a set of four synaptic recognition molecules, two Sidekicks and two Dscams, are predicted to bind PDZ domains. We found that Sidekicks and Dscams do indeed bind PDZ domain-containing proteins, and asked whether the interaction is critical for the localization or function of Sidekicks in retina, the only portion of the nervous system in which they have so far been analyzed (Yamagata et al., 2002; Yamagata and Sanes, 2008).

Our main findings are as follows: (1) Sidekicks and Dscams interact, via their carboxy termini, with members of the MAGI and PSD-95 families of multi-PDZ domain synaptic scaffolding proteins. (2) Individual members of both families are expressed by distinct subsets of neurons and the proteins are localized to distinct synapses, much as has been found for Sidekicks and Dscams. (3) In photoreceptor nerve terminals, which contain both MAGI-1 and PSD-95, Sidekick-2 preferentially associates with and recruits MAGI-1, even though it interacts similarly with both in heterologous cells. (4) Deletion of the carboxy terminus of Sidekick-2 or knock-down of MAGI-1 prevents synaptic localization of Sidekick to the presynaptic membrane of photoreceptors in vivo. (5) Deletion of the carboxy terminus of Sidekick-2 or knock-down of MAGI-2 blocks the ability of Sidekick to promote laminae-restricted arborization of processes in the inner plexiform layer. Together, these results establish that the function and localization of Sidekick-2 (and by implication, Sidekick-1 and Dscams) require interaction with MAGI scaffolding proteins.

These results raise new questions that can now be addressed to provide a more satisfying understanding of how synapses form. First, how does MAGI localize Sidekick to synapses? The simplest model is that binding sites in a MAGI-containing scaffold immobilize Sidekick in synaptic membranes. Rapsyn- and gephyrin-dependent aggregation of acetylcholine and glycine receptors, respectively, involve such aggregation, at least in part (Banks et al., 2003; Fritschy et al., 2008). However, PDZ domain proteins have been implicated in trafficking of glutamate receptors (Craig et al., 2006; Ehrlich et al., 2004; Prybylowski et al., 2005) so it is possible that the interaction regulates delivery to the synapse, in addition to or instead of immobilization.

Second, why does Sidekick-2 associate preferentially with MAGI-1 over PSD-95 in nerve terminals? Preliminary attempts to assess binding strength or preference have not revealed striking differences between Sidekick-MAGI and Sidekick-PSD-95 interactions (Fig. 4k and M.Y, unpublished). One possibility is that a posttranslational modification to one of the binding partners affects its affinity for the other. For example, phosphorylation of the PDZ domain binding site of the GluR2 glutamate receptor subunit decreases its affinity for one PDZ protein, GRIP-1, without affecting its affinity for another, PICK-1 (Chung et al., 2000). Sidekicks have serines at the -3 and -4 positions (Table 1) that are potential substrates for serine/threonine kinases. An alternative is that other binding partners present at synapses shift the balance. For example, the PDZ domains in PSD-95 to which Sidekick can bind might be occupied by higher affinity ligands.

Third, what is the significance of the conserved carboxy terminal hexapeptide in Sidekicks (Table 1)? PDZ-binding sequences are conserved to some degree in many transmembrane molecules (e.g., Dscam, Table 1), but Sidekick’s degree of conservation across multiple phyla is unusual. There might be novel binding partners highly specific for this hexapeptide that our screens did not reveal. Alternatively, the sequence may have been selected to recognize a specific subset of PDZ domains with different affinities. The preferential association of Sidekick with MAGIs over PSD-95 in vivo may exemplify this quality.

Fourth, does localization or function of other synaptic recognition or adhesion molecules require MAGIs in particular or PDZ proteins in general? Numerous proteins in this class terminate in PDZ-binding motifs, including neurologins, neurexins, nephrins, nectins, SynCAMs, Eph kinases, ephrinsB, and NrCAM. For several of them, PDZ domain-containing binding partners have been identified by yeast two-hybrid screens, co-expression in heterologous cells, or co-immunoprecipitation (Iida et al., 2004; Meyer et al., 2004; Davey et al., 2005, Yamada et al., 2003; Hirabayashi et al., 2005). It is thus tempting to speculate that the interactions defined here are emblematic of a more general phenomenon.

Finally, what role does MAGI play in Sidekick-dependent laminar specificity? Perhaps, the simplest model is that function requires a high concentration of Sidekick at developing synapses. In this view, the crucial role of MAGI would be to aggregate Sidekick. An intriguing alternative, however, is that MAGI acts by coordinating multiple transsynaptic interactions (Fig. 10). MAGIs are associated with both pre- and postsynaptic membranes in chick retina and rodent hippocampus (Yamada et al., 2003). Both neuroligins and cadherins, which have been implicated in regulation of synapse formation and synaptic efficacy (Sudhof, 2008; Arikkath and Reichardt, 2008), interact with MAGIs. Neuroligins, which are present in postsynaptic membranes of many synapses, bind to the first of 5 PDZ domains in MAGI-2 and -3 (Iida et al., 2004; Meyer et al., 2004). Neurexins, the presynaptic binding partners of neuroligins, also bear PDZ-binding carboxy-termini that influence their localization, although the binding partners have not yet been identified (Sudhof, 2008). Cadherins, which are present in both pre- and postsynaptic membranes of many synapses (Arikkath and Reichardt, 2008; Yamagata et al., 1995) bind to β- and δ-catenins, which in turn bind the 5th PDZ domain in MAGI (Nishimura et al., 2002; Ide et al., 1999). MAGIs may also be involved in recruitment of neurotransmitter receptors such as AMPA- and NMDA-type glutamate receptors (Deng et al., 2006). As shown here, Sidekicks and Dscams bind to PDZ domains 2 and/or 3 of MAGI. Based on these findings, we suggest that MAGI provides a means by which target recognition molecules that bias connectivity in favor of appropriate partners (e. g., Sidekicks and Dscams at PDZ 2/3) can recruit other adhesive proteins that promote synaptic maturation and regulate synaptic efficacy (e. g., neuroligin at PDZ1 and cadherin at PDZ5). If this model is correct, it may be possible to identify additional candidate target recognition molecules by screening for ligands of MAGI PDZ domains 2 and 3. In this regard, it is encouraging that nephrin, the mammian orthologue of the C. elegans synaptic specificity molecule SYG-2 also binds to MAGI PDZ domains 2/3 (Hirabayashi et al., 2005; Shen et al., 2004).

Figure 10
Model for roles of MAGI proteins and Sidekicks in synapse specificity and formation

Supplementary Material

Supp1

Supplementary Figure 1

Localization of PDZ domain containing proteins in E16 retina

(a-c) In situ hybridization for Pist/Cal (a), SAP102 (b) and Chapsyn110 (c). (d-f) Sections stained with antibodies that recognize all PSD-95 family members (d), PSD-95 (e), or Chapsyn110 (f), Bar is 25 μm.

Supplementary Figure 2

Interfering RNAs that selectively target MAGI-1 or MAGI-2.

HEK293 cells were transfected with chicken MAGI-1 or -2 and a vector encoding GFP plus interfering RNAs specific for MAGI-1 or -2. Arrows indicate cells that expressed MAGI-2 but had not been cotransfected with the interfering RNA vector. Bar is 20 μm.

Acknowledgments

This work was supported by a grant from the National Institutes of Health to J.R.S. We thank Guoping Feng (Duke University) for cDNA libraries, and J. Cartaud (Universite de Paris) for antibodies to MAGI-1.

Footnotes

AUTHOR CONTRIBUTIONS M.Y. and J.R.S. designed experiments and wrote the paper. M.Y. performed the experiments.

References

  • Amano K, Fujii M, Arata S, Tojima T, Ogawa M, Morita N, Shimohata A, Furuichi T, Itohara S, Kamiguchi H, Korenberg J, Arata A, Yamakawa K. DSCAM deficiency causes loss of pre-inspiratory neuron synchroneity and perinatal death. J Neurosci. 2009;29:2984–2996. [PubMed]
  • Arikkath J, Reichardt L. Cadherins and catenins at synapses: roles in synaptogenesis and synaptic plasticity. Trends Neurosci. 2008;31:487–494. [PMC free article] [PubMed]
  • Banks G, Fuhrer C, Adams M, Froehner S. The postsynaptic submembrane machinery at the neuromuscular junction: requirement for rapsyn and the utrophin/dystrophin-associated complex. J Neurocytol. 32:709–726. [PubMed]
  • Biederer T, Sara Y, Mozhayeva M, Atasoy D, Liu X, Kavalali E, Südhof T. SynCAM, a synaptic adhesion molecule that drives synapse assembly. Science. 2002;297:1525–1531. [PubMed]
  • Cho K, Hunt C, Kennedy M. The rat brain postsynaptic density fraction contains a homolog of the Drosophila discs-large tumor suppressor protein. Neuron. 1992;9:929–942. [PubMed]
  • Chung H, Xia J, Scannevin R, Zhang X, Huganir R. Phosphorylation of the AMPA receptor subunit GluR2 differentially regulates its interaction with PDZ domain-containing proteins. J Neurosci. 2000;20:7258–7267. [PubMed]
  • Craig AM, Graf ER, Linhoff MW. How to build a central synapse: clues from cell culture. Trends Neurosci. 2006;29:8–20. [PMC free article] [PubMed]
  • Davey F, Hill M, Falk J, Sans N, Gunn-Moore FJ. Synapse associated protein 102 is a novel binding partner to the cytoplasmic terminus of neurone-glial related cell adhesion molecule. J Neurochem. 2005;94:1243–1253. [PubMed]
  • Deng F, Price MG, Davis CF, Mori M, Burgess DL. Stargazin and other transmembrane AMPA receptor regulating proteins interact with synaptic scaffolding protein MAGI-2 in brain. J Neurosci. 2006;26:7875–7884. [PubMed]
  • Ehrlich I, Malinow R. Postsynaptic density 95 controls AMPA receptor incorporation during long-term potentiation and experience-driven synaptic plasticity. J Neurosci. 2004;24:916–927. [PubMed]
  • Elias G, Funke L, Stein V, Grant S, Bredt D, Nicoll R. Synapse-specific and developmentally regulated targeting of AMPA receptors by a family of MAGUK scaffolding proteins. Neuron. 2006;52:307–320. [PubMed]
  • Feng G, Tintrup H, Kirsch J, Nichol M, Kuhse J, Betz H, Sanes JR. Dual requirement for gephyrin in glycine receptor clustering and molybdoenzyme activity. Science. 1998;282:1321–1324. [PubMed]
  • Feng W, Zhang M. Organization and dynamics of PDZ-domain-related supramodules in the postsynaptic density. Nat Rev Neurosci. 2009;10:87–99. [PubMed]
  • Fields S, Song O. A novel genetic system to detect protein-protein interactions. Nature. 1989;340:245–246. [PubMed]
  • Fritschy J, Harvey R, Schwarz G. Gephyrin: where do we stand, where do we go? Trends Neurosci. 2008;31:257–264. [PubMed]
  • Fuerst P, Koizumi A, Masland R, Burgess R. Neurite arborization and mosaic spacing in the mouse retina require DSCAM. Nature. 2008;451:470–474. [PMC free article] [PubMed]
  • Fuerst P, Bruce F, Tian M, Wei W, Elstrott J, Feller M, Erskine L, Singer J, Burgess R. DSCAM and DSCAML1 function in self-avoidance in multiple cell types in the developing mouse retina. Neuron. 2009;64:484–497. [PMC free article] [PubMed]
  • Funke L, Dakoji S, Bredt DS. Membrane-associated guanylate kinases regulate adhesion and plasticity at cell junctions. Annu Rev Biochem. 2005;74:219–245. [PubMed]
  • Gautam M, Noakes P, Mudd J, Nichol M, Chu G, Sanes J, Merlie J. Failure of postsynaptic specialization to develop at neuromuscular junctions of rapsyn-deficient mice. Nature. 1995;377:232–236. [PubMed]
  • Hirabayashi S, Mori H, Kansaku A, Kurihara H, Sakai T, Shimizu F, Kawachi H, Hata Y. MAGI-1 is a component of the glomerular slit diaphragm that is tightly associated with nephrin. Lab Invest. 2005;85:1528–1543. [PubMed]
  • Hirao K, Hata Y, Ide N, Takeuchi M, Irie M, Yao I, Deguchi M, Toyoda A, Sudhof TC, Takai Y. A novel multiple PDZ domain-containing molecule interacting with N-methyl-D-aspartate receptors and neuronal cell adhesion proteins. J Biol Chem. 1998;273:21105–21110. [PubMed]
  • Hung A, Sheng M. PDZ domains: structural modules for protein complex assembly. J Biol Chem. 2002;277:5699–5702. [PubMed]
  • Ide N, Hata Y, Deguchi M, Hirao K, Yao I, Takai Y. Interaction of S-SCAM with neural plakophilin-related armadillo-repeat protein/delta-catenin. Biochem Biophys Res Comm. 1999;256:456–461. [PubMed]
  • Iida J, Hirabayashi S, Sato Y, Hata Y. Synaptic scaffolding molecule is involved in the synaptic clustering of neuroligin. Mol Cell Neurosci. 2004;27:497–508. [PubMed]
  • Kim E, Sheng M. PDZ domain proteins of synapses. Nat Rev Neurosci. 2004;5:771–781. [PubMed]
  • Koulen P, Fletcher EL, Craven SE, Bredt DS, Wassle H. Immunocytochemical localization of the postsynaptic density protein PSD-95 in the mammalian retina. J Neurosci. 1998;18:10136–10149. [PubMed]
  • Kurschner C, Mermelstein PG, Holden WT, Surmeier DJ. CIPP, a novel multivalent PDZ domain protein, selectively interacts with Kir4.0 family members, NMDA receptor subunits, neurexins, and neuroligins. Mol Cell Neurosci. 1998;11:161–172. [PubMed]
  • Levinson J, Li R, Kang R, Moukhles H, El-Husseini A, Bamji S. Postsynaptic scaffolding molecules modulate the localization of neuroligins. Neuroscience. 2009 online published. [PubMed]
  • Li X, Lobo N, Bauser CA, Fraser MJ., Jr The minimum internal and external sequence requirements for transposition of the eukaryotic transformation vector piggyBac. Mol Genet Genomics. 2001;266:190–198. [PubMed]
  • Ly A, Nikolaev A, Suresh G, Zheng Y, Tessier-Lavigne M, Stein E. DSCAM is a netrin receptor that collaborates with DCC in mediating turning responses to netrin-1. Cell. 2008;133:1241–1254. [PMC free article] [PubMed]
  • Masland R. The fundamental plan of the retina. Nat Neurosci. 2001;4:877–886. [PubMed]
  • McAllister A. Dynamic aspects of CNS synapse formation. Annu Rev Neurosci. 2007;30:425–450. [PMC free article] [PubMed]
  • Meyer G, Varoqueaux F, Neeb A, Oschlies M, Brose N. The complexity of PDZ domain-mediated interactions at glutamatergic synapses: a case study on neuroligin. Neuropharmacology. 2004;47:724–733. [PubMed]
  • Neudauer CL, Joberty G, Macara IG. PIST: a novel PDZ/coiled-coil domain binding partner for the rho-family GTPase TC10. Biochem Biophys Res Comm. 2001;280:541–547. [PubMed]
  • Nishimura W, Yao I, Iida J, Tanaka N, Hata Y. Interaction of synaptic scaffolding molecule and beta-catenin. J Neurosci. 2002;22:757–765. [PubMed]
  • Prybylowski K, Chang K, Sans N, Kan L, Vicini S, Wenthold R. The synaptic localization of NR2B-containing NMDA receptors is controlled by interactions with PDZ proteins and AP-2. Neuron. 2005;47:845–857. [PMC free article] [PubMed]
  • Ramón y Cajal S. La rétine des vertébrés. La Cellule. 1892;9:119–257.
  • Sanes JR, Yamagata M. Many paths to synaptic specificity. Annu Rev Cell Dev Biol. 2009;25:161–195. [PubMed]
  • Scheiffele P, Fan J, Choih J, Fetter R, Serafini T. Neuroligin expressed in nonneuronal cells triggers presynaptic development in contacting axons. Cell. 2000;101:657–669. [PubMed]
  • Shen K, Fetter R, Bargmann C. Synaptic specificity is generated by the synaptic guidepost protein SYG-2 and its receptor, SYG-1. Cell. 2004;116:869–881. [PubMed]
  • Songyang Z, Fanning A, Fu C, Xu J, Marfatia S, Chishti A, Crompton A, Chan A, Anderson J, Cantley L. Recognition of unique carboxyl-terminal motifs by distinct PDZ domains. Science. 1997;275:73–77. [PubMed]
  • Strochlic L, Cartaud A, Labas V, Hoch W, Rossier J, Cartaud J. MAGI-1c: A synaptic MAGUK interacting with MuSK at the vertebrate neuromuscular junction. J Cell Biol. 2001;153:1127–1132. [PMC free article] [PubMed]
  • Südhof T. Neuroligins and neurexins link synaptic function to cognitive disease. Nature. 2008;455:903–911. [PMC free article] [PubMed]
  • Umemori H, Sanes JR. Signal regulatory proteins (SIRPS) are secreted presynaptic organizing molecules. J Biol Chem. 2008;283:34053–34061. [PMC free article] [PubMed]
  • Vazquez F, Grossman SR, Takahashi Y, Rokas MV, Nakamura N, Sellers WR. Phosphorylation of the PTEN tail acts as an inhibitory switch by preventing its recruitment into a protein complex. J Biol Chem. 2001;276:48627–48630. [PubMed]
  • Wässle H. Parallel processing in the mammalian retina. Nat Rev Neurosci. 2004;5:747–757. [PubMed]
  • Yamada A, Irie K, Deguchi-Tawarada M, Ohtsuka T, Takai Y. Nectin-dependent localization of synaptic scaffolding molecule (S-SCAM) at the puncta adherentia junctions formed between the mossy fibre terminals and the dendrites of pyramidal cells in the CA3 area of the mouse hippocampus. Genes to Cells. 2003;8:985–994. [PubMed]
  • Yamagata M, Sanes JR. Dscam and Sidekick proteins direct lamina-specific synaptic connections in vertebrate retina. Nature. 2008;451:465–469. [PubMed]
  • Yamagata M, Herman JP, Sanes JR. Lamina-specific expression of adhesion molecules in developing chick optic tectum. J Neurosci. 1995;15:4556–4571. [PubMed]
  • Yamagata M, Weiner J, Sanes JR. Sidekicks: synaptic adhesion molecules that promote lamina-specific connectivity in the retina. Cell. 2002;110:649–660. [PubMed]