PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC 2010 October 14.
Published in final edited form as:
PMCID: PMC2862384
NIHMSID: NIHMS195677

DMob4/Phocein regulates synapse formation, axonal transport, and microtubule organization

Abstract

The Mob family of kinase-interacting proteins regulate cell cycle and cell morphology, and their dysfunction has been linked to cancer. Models for Mob function are largely based on studies of Mob1 and Mob2 family members in yeast. In contrast, the function of the highly conserved metazoan Phocein/Mob3 subfamily is unknown. We identified the Drosophila Phocein homolog (DMob4) as a regulator of neurite branching in a genome-wide RNAi screen for neuronal morphology mutants. To further characterize DMob4, we generated null and hypomorphic alleles and carried out in vivo cell biological and physiological analysis. We find that DMob4 plays a prominent role in neural function, regulating axonal transport, membrane excitability and organization of microtubule networks. DMob4 mutant neuromuscular synapses also show a profound overgrowth of synaptic boutons, similar to known Drosophila endocytotic mutants. DMob4 and human Phocein are >80% identical, and the lethality of DMob4 mutants can be rescued by a human phocein transgene, indicating a conservation of function across evolution. These findings suggest a novel role for Phocein proteins in the regulation of axonal transport, neurite elongation, synapse formation and microtubule organization.

Keywords: Drosophila, knockout, Axonal Transport [Axoplasmic Transport], Microtubule, Dendrite, Synapse

Introduction

The Monopolar spindle-one-binder (Mob) family of zinc binding proteins is conserved from yeast to humans (Stavridi et al., 2003; Ponchon et al., 2004; Li et al., 2006; Mrkobrada et al., 2006). Mobs are found in complexes with kinases, and may function as activating subunits, similar to cyclins (Weiss et al., 2002; Devroe et al., 2004; Hergovich et al., 2005; Wei et al., 2007). The founding Mob members, S. cerevisiae Mob1p and Mob2p, activate Dbf-2 kinases and facilitate exit from mitosis (Luca et al., 2001; Weiss et al., 2002; Stoepel et al., 2005; Mrkobrada et al., 2006). Mob isoforms have also been localized to neuronal dendrites in mammals, where NDR (nuclear Dbf-2) kinases regulate dendritic branching (Zallen et al., 2000; Baillat et al., 2001; He et al., 2005; Emoto et al., 2006). These findings suggest Mob proteins may have important functions within postmitotic neurons, in addition to regulating cell proliferation.

While S. cerevisiae has two Mobs, D. melanogaster, C. elegans, and D. rerio have four, and H. sapiens has seven (Li et al., 2006; Mrkobrada et al., 2006). Although roles in regulation of cell proliferation by Mob1 and cell polarity by Mob2 have been characterized, little is known about the third subfamily, Phocein/Mob3 (Colman-Lerner et al., 2001; Hou et al., 2003; Lai et al., 2005; Wei et al., 2007; Praskova et al., 2008). Phocein is highly expressed in Purkinje cell dendrites and spines (Baillat et al., 2001; Haeberle et al., 2006). Biochemical studies indicate that Phocein interacts with various vesicle trafficking proteins including Striatin, Eps-15, Dynamin-1 and Nucleoside-Diphosphate Kinase (NDPK) (Baillat et al., 2001; Baillat et al., 2002). However, no loss of function analysis of Phocein has been conducted. In vivo knockdown of Striatin blocks dendrite formation, suggesting the Phocein/Striatin complex may regulate neuronal morphology (Bartoli et al., 1999).

Phocein is also a component of the STRIPAK complex (for Striatin Interacting Phosphatase and Kinase) which contains Protein Phosphatase 2A (PP2A), Ste-kinases, Dynein and several other interactors (Goudreault et al., 2008). The presence of serine-threonine kinases and phosphatases in the STRIPAK complex suggests it may act as an ON/OFF switch that governs target phosphorylation states (Pi and Lisman, 2008). In neurons, PP2A associates with microtubules and regulates their dynamics by altering microtubule-associated protein phosphorylation (Sontag et al., 1996; Tournebize et al., 1997; Aranda-Orgilles et al., 2008). These interactions suggest that the STRIPAK/PP2A complex may regulate neuronal microtubules through interactions with a variety of effector proteins, including Phocein. As such, Phocein may regulate a host of neuronal functions in vivo.

Here we describe the first in vivo knockout analysis of phocein/DMob4 (hereafter referred to as DMob4) in metazoans. Within neurons, we find that DMob4 is required for axonal transport, synaptic development, and normal organization of microtubule networks. Genetic rescue of DMob4 mutant phenotypes with human phocein suggests a conserved role of this protein family in neurons. These findings highlight a new function for the metazoan-specific Phocein/Mob3 subfamily in the regulation of neuronal structure and function.

Materials and Methods

DMob4 mutant strains

To isolate DMob4 (CG3403) mutant alleles, a P-element excision screen was conducted using y1,w67c23;P[EPgy2]EY23407 and the transposase source y1,w1118; amosTft/CyO, PBac[Δ2-3.Exel]2. EY23407 is a P-element insertion in the 5′ UTR of DMob4 (in exon 1) and it is 33 b.p. upstream of the DMob4 start codon, as confirmed by inverse PCR and sequencing of the P-element ends. Putative w;EYΔ imprecise excision alleles arising from the screen were balanced over CyO and scored for homozygous lethality. A subsequent round of PCR screening of the homozygous lethal lines with oligonucleotides spanning the EY23407 insertion site (Pr3cdna For: 5′ TCAGTCTAGAGCATACTACGGTGCAGGGAT, Pr3cdnaRev: 5′ TCGAGAATTCACGACTCCTTGATGGACACC) identified strains containing small deletions of the DMob4 locus. Using these oligonucleotide pairs, a 729 b.p. band is obtained in wild types. Lethal stocks that yielded PCR products of less than 729 b.p. were identified as being excision mutants. These bands were analyzed by DNA sequencing to map the excision breakpoints. DMob4EYΔL307 contains a 116 b.p. deletion starting at −33 and is missing part of exon 1 and the downstream intron; at the former EY23407 insertion site, a small 17 b.p. foot print of EY23407 remains (CATGATGAAATAA). The DMob4EYΔL3 allele contains a 357 b.p. deletion with the 5′ breakpoint also at −33. This deletion removes all of exon 1, the intervening intron, and part of exon 2. The EYΔH.V.1223 strain is a homozygous viable precise excision allele of y1,w67c23;P[EPgy2]EY23407.

DMob4 Rescue Strains and Analysis

The Drosophila DMob4 cDNA LD21194 (Drosophila Genomics Resource Center) was PCR-amplified with BglII/SpeI-tailed oligonucleotides (5′ G AGATCTCATCGCGTCTTCGAGCGG/5′CACTAGTCATGCGAGTCTGACTAATCT) flanking the open reading frame of DMob4, and then directionally subcloned as a Bgl II/Spe I fragment into the pValum vector system (Vermillion AttB LoxP UAS MCS), for the generation of transgenic lines (Markstein et al., 2008; Ni et al., 2008). For the human phocein rescue construct, we repeated the same strategy as for DMob4. The human phocein variant-1 (Acession No: NM_015387.2) cDNA clone (OriGene Technologies Inc., Rockville, MD) was used to make the rescue construct and the human phocein-specific BglII/SpeI-tailed oligonucleotides (5′GAGATCTACATCCGGGTACCGACTCCAG and 5′CACTAGTTGTTAATT ATATGATCAGTAC) were used for PCR. DNA for the rescue constructs was sequenced to identify clones without polymerase errors; constructs were injected into an attP2 strain containing a source of phiÿCÿ3ÿ1ÿ-ÿintegrase (Genetic Services Inc., Boston, MA). To conduct the rescue experiments, yw;DMob4EYΔL3,actin-GAL4/CyO males were crossed to either yw;DMob4EYΔL3/CyO;UAS-DMob4,v+,attP2,y+ or yw;DMob4EYΔL3/CyO;UAS-human phocein variant-1,v+,attP2,y+ females at 21°C, and the progeny were examined for non-CyO escaper flies. The presence of the rescue transgene in the escapers was also confirmed with PCR using the Bgl II/Spe I primer pairs employed in the generation of the rescue constructs.

Other Drosophila strains

The P[EPgy2]EY23407 strain was obtained from Hugo Bellen. The Rab2C02699 stock was obtained from the Exelixis collection at Harvard Medical School. The GAL4 drivers used for rescue experiments (actin-GAL4, MHC-Gal4, elavc155) were obtained from Bloomington Stock Center, as was the Df(2R)42 strain.

Drosophila Cell Culture and Morphology Analysis

The fly stock elavc155-GAL4, UAS-mCD8GFP/FM6;gcm-GAL4/CyO was used for the preparation of primary cell cultures for the DMob4 RNAi experiments. RNAi knock-down of DMob4 was achieved using amplicons DRSC04993 and DRSC29567 (Drosophila RNAi Screening Center database). DRSC4993 is a 369 b.p. amplicon directed against exon 2 of DMob4, while DRSC29567 is a 364 b.p. amplicon directed against exon 3 (Fig. 2B). There are no predicted off-target fragments within the DRSC29567 amplicon, and a single predicted off-target fragment for the DRSC4993 amplicon (matching a portion of Drosophila gene CG31107). The slight difference in the morphology phenotypes of the two Mob4-directed amplicons may be related to off-target effects of DRSC4993 (DRSC4993 vs. DRSC29567 p = 0.002, Fig. 1). For dsRNA production, T7-tailed oligonucleotides (DRSC04993: 5′TAATACGACTCACTATAGGGAGATCTGTCGCTGGCCCG/5′TAATACGACTCACTATAGGGAGATGCTAGGGAAGTACTTGTTG; DRSC29567 5′TAATACGACTCACTATAGGGAGATGTGGAAGTACGAGCACCTG/5′TAATACGACTCACTATAGGGAGATGCGAGAAGATGCGATACAC) were used to PCR amplify the DRSC amplicons from w1118 genomic DNA. Double stranded RNA was then synthesized from the T7-tailed amplicons using the MEGAshortscript T7 In Vitro Transcription Kit according to the manufacturers protocol (Ambion, Austin TX). Synthesized dsRNAs were purified with RNeasy kits prior to use in cell culture experiments (Qiagen, Valencia, CA). The primary cultures, RNAi experiments, and morphometric analysis were all conducted as previously described (Sepp et al., 2008). For image analysis, we utilized custom algorithms that are previously described (Sepp et al., 2008). For each amplicon, we treated 72 wells, and imaged 4 sites/well with an ImagExpress Micro automated microscope (Molecular Devices, Sunnyvale, CA). To verify that dsRNA amplicons knock down DMob4 expression, 1 × 106 S2 cells were plated in serum-free media, and treated with 15 μg of dsRNA for 30 minutes. Cells were then diluted 1/3 with serum-containing media and incubated for 5 days prior to Western blot analysis.

Figure 1
RNAi knockdown of DMob4 in primary cultures alters neurite morphology
Figure 2
Molecular analysis of DMob4

Generation of DMob4 antibody

Full-length DMob4 was PCR amplified from the EST LD21194 (Drosophila Genomics Resource Center) using Xho I and Kpn I tailed oligonucleotides (5′ primer CCTCGAGATGAAGATGGCTGACGGCTCG; 3′ primer GGTACCCTAAGCCTCGCTTTCGCCAGGG) and subcloned into the pGEM-T Easy vector system (Promega). DMob4 clones were sequence verified and subcloned into pTrcHis A (Invitrogen, Carlsbad, California) as a Xho I, Kpn I, fragment for the production of N-terminal 6X His Tagged protein. His-tagged DMob4 was purified from BL-21 (DE3) E. coli with a 1.0 mL HisTrapHP nickel column (GE Healthcare), and was injected into guinea pigs (Invitrogen, Camarillo, CA, USA) for antibody production. For downstream applications, the DMob4 antibody was affinity purified on HiTrap NHS-activated HP columns (1.0 mL) according to manufacturer’s specifications.

RNA in situ hybridizations

In situ hybridization studies of DMob4 in embryos, were performed as previously described ((Kearney et al., 2004). To produce a linearized template for dig-labeled RNA probe synthesis, the full-length DMob4 EST LD21194 (Drosophila Genomics Resource Center) was PCR-amplified, with oligonucleotides specific to the pOT2a backbone vector (OT2Afor: 5′GAACGCGGCTACAATTAATACA and OT2Arev: 5′GCCGATTCATTAATGCAGGT). The resultant PCR product contains pOT2A-derived T7 and SP6 RNA polymerase initiation sites to enable in vitro anti-sense and sense (respectively) probe transcription. For dig-labeled RNA probe synthesis and in situ analysis, the following reagents were used: Proteinase K (Roche Molecular Biochemicals), DIG RNA Labeling Kit (Sp6/T7) (Roche Molecular Biochemicals), T7 and SP6 RNA polymerase (New England Biolabs), Anti-Digoxigenin-AP Fab fragments used at 1:2000 (Roche Molecular Biochemicals), and BCIP/NBT color development substrate (Promega).

Immunohistochemistry

Staining of embryos and larvae was performed according to standard protocols (Rothwell and Sullivan, 1999). In brief, embryos were fixed in PEM buffer, 4% formaldehyde for 20 minutes, and washed/permeabilized in PBS plus 0.05% Tween-20. Larvae were reared at 21°C and wandering 3rd instars were dissected in calcium free HL3.1 saline (Feng et al., 2004), the larvae were fixed for 30 minutes in HL3.1, 4% formaldehyde, and washed/permeabilized in PBS, 0.1% Triton-X 100. To obtain 3rd in star DMob4EYΔL3/Df(2R)42 mutants, homozygous mutants were collected as 1st instars from standard media vials, and then nursed to the 3rd instar stage on molasses-agar plates containing semi-liquid yeast paste (Red Star inactive) supplemented with cold temperature-treated mashed banana to 50%, and Penicillin-Streptomycin to a final concentration of 50 I.U./mL, 50 ug/mL respectively (Mediatech Inc., Manassas, VA). Mutant larvae were transferred to fresh yeast/banana/pen-strep media daily until they attained the 3rd instar stage. For NMJ morphology analysis, supernumerary boutons were defined as strings of 5 or fewer boutons that extend from the central NMJ axis. The following antibodies and concentrations were used: 22C10 mouse monoclonal 1:5 (DSHB, University of Iowa), mouse anti-acetylated α-tubulin clone 6-11B-1 1:250 (T7451, Sigma-Aldrich), mouse anti-tyrosinated α-tubulin TUB-1A2 1:1000 (T9028, Sigma-Aldrich), guinea pig anti-DMob4 1:600, rabbit anti-HRP Rhodamine 1:150 (Jackson Immunoresearch), nc82 1:200 (DSHB, University of Iowa), rabbit anti-synaptotagmin-1 1:500 (Littleton et al., 1993). Alexa Fluor 488 and Alexa Fluor 594 conjugated secondary antibodies were used at 1:400 (Molecular Probes/Invitrogen, Carlsbad, California). Tissue preparations were imaged on a LEICA TCS-SP2 confocal LSM microscope.

Western Blot Analysis and Biochemical Experiments

For standard SDS-PAGE/Western analysis, 1.5 larvae/lane was loaded onto gels. For quantitative Western analysis, total protein levels were determined in lysates (10 larvae/100 μL lysisis buffer: 20 mM HEPES, pH 7.5; 50 mM KCl, 2 mM EGTA, 1 mM MgCl2, 0.2 % NP-40, plus protease inhibitiors) using a BCA protein assay kit (Pierce Protein Research Products, Rockford, Illinois), and then 6.5 μg/lane was loaded onto gels. To reduce background bands on Western blots, the viscera of the 3rd instar larvae were removed prior to homogenization in sample buffer (standard SDS-PAGE) or lysis buffer (quantitative SDS-PAGE). For immunoblotting, antibodies were used at the following concentrations: mouse anti-Dlg (4F3, DSHB) 1:1000, guinea pig anti-DMob4 1:2000, rabbit anti-Synaptogyrin 1:10,000, mouse anti-α-Tubulin clone B-5-1-2 1:5000 (T5168 Sigma-Aldrich), IR700 and IR800 conjugated secondary antibodies 1:3000 (Rockland Immunochemicals, Inc.). Western blots were imaged and quantified using an Odyssey infrared scanner (LICOR).

Adult Behavioral Analysis

Viability assays were performed at 21°C. Virgin male and female Drosophila were collected in separate vials (15 flies/vial) and flipped onto fresh media 3 times per week. The number of deceased animals was noted at the time of each flip. Longevity plots were analyzed separately for the males and females of a given strain; and then data were pooled, since there was no statistically significant difference between sexes. The numbers of flies used to obtain the longevity scores are as follows: DMob4EYΔL307/DMob4EYΔL307 (male n=520; female n=582), DMob4EYΔL307/DMob4EYΔL3 (male: n=211; female n=286), EYΔHV1223(male n=507; female n=589).

Electron microscopy

Wandering 3rd instar wild type and DMob4 mutant larvae were dissected in calcium free HL3.1 saline (Feng et al., 2004), and fixed in 1% glutaraldehyde, 0.2 M sodium phosphate buffer, pH 7.2, for 30 minutes. The larvae were washed in 0.2 M sodium phosphate buffer, and then incubated for 1 hour in 1% OsO4 in ddH2O. Osmium was removed, and larvae were washed in ddH20. The preparations were stained en bloc for 1/2 hour in freshly prepared 2% uranyl acetate, washed in ddH20, dehydrated in an increasing ethanol series, and finally in propylene oxide; they were infiltrated with resin by incubation for 30 min in 1/3 ratio of propylene oxide/araldite, and overnight in pure araldite. The larvae were embedded in fresh araldite, and the resin was cured at 60°C for 24 hrs. All fixation and dehydration steps were conducted at room temperature. Ultra-thin sections were imaged with a FEI Tecnai Spirit BioTwin transmission electron microscope fitted with an Advanced Microscopy Techniques digital camera (Whitehead Institute, MIT, Cambridge, Massachusetts).

Electrophysiology

Evoked postsynaptic currents were recorded from ventral longitudinal muscle 6 at abdominal segment A3 in 3rd instar larvae using two-microelectrode voltage-clamp (OC725, Warmer Instruments, Hamden, CT) at −80 mV holding potential (Acharya et al., 2006). All experiments were performed in modified HL3 solution composed of: 70 mM NaCl; 5mM KCl; 4 mM MgCl2; 2 mM CaCl2; 10 mM NaHCO3; 115 mM sucrose; 5 mM HEPES-Na; pH 7.2. Data acquisition and analysis were performed using pClamp software (Axon Instruments, Foster City). For stimulation, nerves were cut close to the ventral ganglion and sucked into a pipette filled with working solution. The nerve was stimulated at frequencies indicated in each experiment using a programmable pulse stimulator (Master-8, A. M. P. I., Jerusalem, Israel) with a 0.1 ms duration. Nerve threshold for evoked release was estimated in each experiment (minimal stimulation) and the intensity of stimulation was increased two-fold (maximal stimulation).

Results

DMob4 regulates neurite outgrowth in Drosophila primary cultures

We identified DMob4 (CG3403) in a genome-wide RNAi screen for genes required for neurite outgrowth or regulation of neuronal morphology (Sepp et al., 2008). We selected DMob4 for further characterization due to its homology with other Mob proteins and its potential role in the regulation of endocytosis and vesicular trafficking with neurons (Fig. S1b). To confirm that DMob4 regulates neuronal morphology, we performed RNAi knockdown experiments in primary cultures prepared from Drosophila embryos in which GFP is expressed under the control of the pan-neuronal driver elav-Gal4. RNAi knockdown of DMob4 with two independent, non-overlapping dsRNA amplicons, DRSC04993 and DRSC29567, altered neurite morphology relative to controls (control vs DRSC4993, p = 2.22 e-16; control vs. DRSC29567, p = 1.41 e-6) (Fig. 1A, B). In control cultures, neuroblasts proliferate into multi-cell aggregates called neuromeres. Long and straight neurites typically extend from neuromere clusters as the cultures mature. DMob4 knockdown resulted in a disruption of neuronal morphology that was quantified with custom algorithms. Loss of DMob4 decreased the size of neuromere clusters, while increasing the complexity of neurite branching with shorter neurites and an increased thickness of neurite bundles (Fig. 1B). The two DMob4 dsRNA amplicons target distinct regions of DMob4 and are equally effective at knocking-down DMob4 protein levels (Fig. 1C, Fig. 2B). The RNAi results indicate that reduced DMob4 levels within developing neurons causes defects in neurite branching and morphology in Drosophila primary neurons.

To analyze DMob4 expression within the nervous system, we performed in situ hybridization on Drosophila embryos using digoxigenin-labeled RNA probes (Fig. 1D). DMob4 transcripts were dynamically distributed in the embryo, with abundant maternal DMob4 expression in eggs and enrichment of zygotic transcripts in the CNS during development. Beginning at Stage 10, DMob4 is present in the ventral neurogenic region, and is abundant in the condensed ventral nerve cord by Stage 17 (arrow in Fig. 1D). This staining pattern was not observed in embryos probed with negative control sense probes. Therefore, DMob4 is expressed widely in developing embryos and enriched in the nervous system.

DMob4 is a Phocein homolog

Crystal structures of yeast, Xenopus and human Mob1 family members indicate that Mob proteins are composed of several alpha helical domains coordinated around a central zinc ion (Fig. S1A). In Drosophila, there are four Mob proteins: Mob1/mats (CG13852), Mob2 (CG11711), Mob3 (CG4946), and Mob4 (CG3403). Sequence alignment of the Drosophila Mobs with human Mob1 (Q9H8S9.4) demonstrates that the two histidine and two cysteine residues necessary for zinc coordination are conserved, suggesting that DMobs have a similar 3-dimensional structure (Fig. S1B). Of the Drosophila Mobs, Mob1, Mob3, and Mob4 are each predicted to produce a single transcript encoding an ~25 kDa polypeptide. Mob2 produces four transcripts encoding proteins of larger size (i.e. 78.3, 57.2, 45.8 and 58.9 KDa). DMob4 has a unique N-terminal domain and extensive sequence divergence across its entire length as compared to other DMobs (Fig. S1B). Reciprocal-best-BLAST analysis indicates that DMob4 is the sole Drosophila homologue of vertebrate Phoceins, which constitute a subfamily of the Mob proteins. Rat Phocein, the first characterized member of this subfamily, is highly expressed in Purkinje cells of the cerebellum which have elaborate dendritic trees. DMob4 shares ~80% identity with mouse, rat and human Phoceins (Fig. 2A).

Generation of DMob4 mutant alleles

The Drosophila Mob4 locus resides at cytological band 42C5, and spans 1.5 kb. DMob4 is closely flanked by Rab2 and CG3270 (Fig. 2B). To further characterize the role of DMob4, we generated null mutations in the locus using a P-element excision screen with the EY23407 strain, which contains a transposable element inserted into the 5′ UTR of DMob4. We mapped the EY23407 insertion site to 33 b.p. upstream of the DMob4 translation start codon by plasmid rescue. This line was designated DMob4EY23407. The DMob4EY23407 strain is homozygous lethal. Since the insertion does not disrupt the DMob4 open reading frame we conducted an excision screen with DMob4EY23407 to generate definitive null alleles. Since the locus is compact, with Rab2 and CG3270 within a few 100 base pairs flanking DMob4 (Fig. 2B), we generated small deletions that had breakpoints entirely within the DMob4 gene. We screened 1329 white-eyed DMob4EY23407Δ/CyO excision strains for lethality (lines were designated EYΔ L#), and used PCR to assay for desired deletions. We isolated two novel DMob4 excision mutants: DMob4EYΔL3 and DMob4EYΔL307 (Fig. 2B). Both excision lines have 5′ breakpoints that begin 33 b.p. upstream of the DMob4 initiator methionine, at the original insertion site of the EY23407 element. DMob4EYΔL3 contains a 357 b.p. deletion, while DMob4EYΔL307 contains a 116 b.p. deletion. Both excision lines disrupt the initiator methionine of DMob4. We isolated a precise excision allele EYΔHV1223, which is homozygous viable, and served as a control for future experiments.

We next performed Western analysis to determine if DMob4EYΔL3 and DMob4EYΔL307 deletions alter levels of DMob4 protein expression. For these studies, we generated a guinea pig polyclonal antibody against the full-length DMob4 protein which is 223 a.a. (25.7 kDa). The antibody recognizes a ~25 kDa band on Western blots of larval extracts prepared from control animals (precise excision allele DMob4EYΔHV1223), consistent with the predicted molecular weight of DMob4. No DMob4 protein was observed on Western blots of larval extracts prepared from homozygous DMob4EYΔL3 3rd instar larvae (Fig. 2C), or from DMob4EY23407 (data not shown), indicating these alleles are protein nulls. DMob4-specific bands were observed on Westerns blots of extracts prepared from embryo lysates of the same mutants, likely representing DMob4 protein translated from maternally deposited transcripts observed by mRNA in situ hybridization (Fig. 1D). Western blot analysis of 3rd instar larvae prepared from the DMob4EYΔL307 strain revealed that this mutant produces an N-terminal truncated DMob4 protein. Heterozygous DMob4EYΔL307/CyO animals produce two bands on Western blots: one at 25 kDa representing full length DMob4 protein, and a smaller fragment at 22 kDa representing the truncated protein (Fig. 2C). Homozygous DMob4EYΔL307 animals only produce the smaller 22 kDa DMob4 protein product (Fig. 2C). Analysis of the DMob4EYΔL307 DNA sequence revealed an alternative in-frame initiator methionine in exon 2, downstream of the 3′ breakpoint of the EYΔL307 deletion. The predicted translational product of this truncated transcript is 32 a.a. shorter than the full length 223 a.a protein with a M.W. of 22 kDa, in agreement with the observed M.W. of DMob4 in homozygous DMob4EYΔL307. Expression levels of the homozygous DMob4EYΔL307 mutants appear reduced relative to controls, suggesting the deletion has less efficient transcription. Thus, DMob4EYΔL307 is a hypomorph and produces N-terminal truncated DMob4, while DMob4EYΔL3 and DMob4EY23407 are protein nulls.

Lethal phase analysis and rescue of DMob4 mutants

To determine the lethal phase of DMob4 mutant alleles, we monitored the survival rates of allelic combinations (Table 1). We used the deletion strain Df(2R)42 in cis to the mutants to control for the possibility of second site mutations on the DMob4EYΔL chromosomes. Df(2R)42 has breakpoints at 42C2-42D3 and spans the DMob4 locus. Lethal phase analysis revealed that DMob4EYΔL3 homozygous mutants die mostly as 1st and 2nd instar larvae, though ~10% can survive to the 3rd instar stage. Approximately 35% of homozygous DMob4EY23407 animals survive to the 3rd instar stage. The least severe allele, the N-terminal truncation mutant DMob4EYΔL307, survives to the adult stage and can be maintained as a homozygous stock.

Table 1
Lethal phase analysis of DMob4 allelic combinations at 21°C

Since Rab2 and DMob4 lie head-to-head on chromosome 2R and their start codons are separated by only a few hundred base pairs, we wanted to ascertain that the lethality observed for DMob4 mutants was not due a loss of Rab2 activity. We therefore crossed DMob4EY23407 and DMob4EYΔL3 to the Rab2c02699 null allele. Although Rab2c02699 is homozygous lethal, the DMob4EY23407/Rab2c02699 and DMob4EYΔL3/Rab2c02699 transheterozygotes are viable to adult stages, and have no obvious morphological or behavioral defects, indicating DMob4EY23407 and DMob4EYΔL3 lesions are specific to DMob4.

The N-terminus of Mob proteins is solvent-exposed and flexible, and does not appear to be an integral part of the conserved globular core (Stavridi et al., 2003; Ponchon et al., 2004; Mrkobrada et al., 2006). The N-terminus is conserved in the Phocein family, and therefore may have critical functions. In yeast, X-ray crystal structural analysis of Mob1p suggests that the N-terminus can interact with the C-terminal core domain and is necessary for homo-dimer formation. Since the DMob4EYΔL307 is adult viable, we extended our longevity analysis into adulthood to more closely examine the physiological consequences of loss of the DMob4 N-terminus. We found that DMob4EYΔL307 mutants have significantly decreased adult longevity (Fig. 2D). The precise excision allele was used as a control for longevity studies. DMob4EYΔL307 homozygous animals had a ~20% decrease in adult longevity, while DMob4EYΔL307/DMob4EYΔL3 mutants had a ~38% decrease in adult longevity. Collectively, these studies suggest that the N-terminal 32 amino acids are necessary for complete functionality of DMob4.

To confirm that the DMob4 phenotypes we observed were due to loss of DMob4, we conducted rescue experiments using a UAS-DMob4 (wild type) transgene (Table 2). We also conducted rescue experiments using the human homolog of DMob4: Phocein/Mobkl3 variant-1, to test for evolutionary conservation of function. The human Phocein protein is 80% identical to DMob4 at the amino acid level (Fig. 2A). For rescue experiments, we used the GAL4/UAS system to drive expression of the wild type constructs in the DMob4EYΔL3 null mutant background. To control for differences in expression levels of the UAS-transgenes, we used the attP-attB integration system and targeted the UAS-DMob4 and human UAS-phocein attB rescue constructs to the attP2 integration site on chromosome 3 (Markstein et al., 2008; Ni et al., 2008). Using the actin-Gal4 ubiquitous driver, we were able to rescue DMob4EYΔL3 larval lethality with both DMob4 and human phocein transgenes to a comparative level (Table 2). We conducted PCR analysis on rescued animals to ensure that they were homozygous for the DMob4EYΔL3 mutant chromosome (Fig. S2). Rescued animals were able to pupate and eclose as adults (Table 2), suggesting that human phocein and Drosophila Mob4 are functionally equivalent orthologs.

Table 2
Rescue of DMob4EYΔL3 lethality using tissue-specific drivers and Drosophila or Human transgenes

RNA in situ analysis revealed that DMob4 is expressed in the nervous system (Fig. 1D). We tested if the observed DMob4EYΔL3 larval lethality could be solely attributed to loss of DMob4 function in the nervous system using rescue experiments with the nervous system specific driver ElavC155. Driving expression of DMob4 in the nervous system of DMob4EYΔL3 null mutants partially rescued lethality. 24% of ElavC155;UAS-DMob4 rescued null animals are able to pupate, compared to 0% for mutants (Table 2). In contrast, expressing DMob4 in muscles using the Myosin Heavy Chain-GAL4 (MHC-GAL4) driver did not rescue the lethality. ElavC155;UAS-DMob4 rescued pupae failed to eclose, indicating that DMob4 also has essential functions outside the nervous system.

Tissue distribution and subcellular localization of DMob4

Anti-DMob4 antiserum was used for immunohistochemical analysis of embryos and larvae to examine the developmental expression of the protein. DMob4 is widely expressed in embryos and larvae. At the syncytial blastoderm stage, DMob4 staining is intense in the cell cortex, below the nuclei (Fig. S3). Zygotic genes are not yet active at this stage of development, suggesting that DMob4 protein, like the transcript, is maternally loaded into the egg. As cellularization advances, DMob4 localizes to the poles and mitotic spindles of dividing cells, together with a more widespread cytosolic distribution. In late-stage embryos, DMob4 is expressed in all tissues examined, including muscles, trachea, gut, peripheral glia and neurons, with strong expression in the embryonic ventral nerve cord (Fig. S3). During larval development the ubiquitous expression of DMob4 persists. At the neuromuscular junction (NMJ), DMob4 fills synaptic boutons and surrounds nc82-positive active zones (Fig. 3A–C, concave arrow head). This peri-active zone distribution is common for proteins implicated in endocytosis (Marie et al., 2004). In peripheral nerves, DMob4 is expressed at high levels in axons, but it is also present in the ensheathing glia (Fig. 3H). A fraction of DMob immunostaining in axons is punctate, suggesting that some DMob4 may be associated with vesicles undergoing transport. These staining patterns are abolished in null mutants (Fig. 3D–F), confirming specificity of the antisera.

Figure 3
DMob4 expression in the peripheral nervous system of 3rd instar larvae

DMob4 mutants display synaptic overgrowth at the NMJ

Given that RNAi knock-down of DMob4 in primary neural cultures results in excessive branching of neurite processes, and that DMob4 is expressed at NMJs, we examined if loss of the protein caused defects in synapse formation in vivo. We stained homozygous DMob4EYΔL3 and DMob4EY23407 larvae with the neuronal membrane marker anti-HRP to label NMJs. We observed a supernumerary bouton phenotype in the DMob4 mutants, similar to what has been previously reported for several endocytosis mutants, including Dap160 (Fig. 4 A–D) (Koh et al., 2004; Dickman et al., 2006). We quantified the supernumerary bouton phenotype at muscle 6/7 and muscle 4 for various DMob4 allelic combinations and compared the phenotype to Dap160 endocytic mutants (Fig. 4E). At muscle 6/7 and muscle 4, DMob4EYΔL3 mutants have 8-fold more supernumerary boutons than Canton S or the precise excision EYΔHV1223 animals, while Dap160 mutants have 6-fold more. We also quantified the frequency of supernumerary boutons in Rab2c02699/DMob4EY23407 transheterozygotes and found no difference from controls, confirming that the observed supernumerary bouton phenotypes are specific to a loss of DMob4. To determine if DMob4 acts cell-autonomously in neurons to regulate synapse formation, we examined DMob4EYΔL3 homozygous mutants carrying the elavGAL4;UAS-DMob4 rescue transgene. Presynaptic expression of DMob4 partially suppresses the supernumerary bouton phenotype observed in nulls. The number of supernumerary boutons in the nulls is reduced by 2.6 fold when DMob4 is driven in the nervous system (Fig. 4B, C, E). This data indicates that DMob4 functions presynaptically to regulate normal synapse formation.

Figure 4
DMob4 mutant 3rd instar larvae have supernumerary boutons at NMJs

Electron microscopy of DMob4 mutants

Since supernumerary boutons are a phenotype observed in several endocytic mutants, and rat Phocein interacts with endocytosis/vesicle trafficking proteins (Eps-15, NDPK, and Dynamin-I), we performed electron microscopy on DMob4 nulls to investigate if there are any anomalies in endocytosis and/or vesicle trafficking in the mutants. We focused on the NMJ since it is a region of active endocytosis of synaptic vesicles and DMob4 is localized in synaptic boutons. Similarly, we examined axons of peripheral nerves since vesicular cargoes are transported long distances along elaborate microtubule networks and Mob4 is highly expressed in axons. At the NMJ of DMob4EYΔL3 mutants, we observed the presence of multiple abnormal cisternae-like endocytic structures budding from the plasma membrane of presynaptic terminals (Fig. 5B–D). Such cisternae were absent from control animals (Fig. 5A), consistent with a requirement for DMob4 function in synaptic endocytosis. In peripheral nerves of DMob4 mutants, we observed accumulations of microtubule-associated vesicles with larger diameters than in controls (Fig. 5E–H). This may reflect the transport of large abnormal endocytic cisternae, or perturbed axonal transport.

Figure 5
Transmission Electron Microscopy of DMob4 mutant NMJs and peripheral nerves

DMob4 mutants manifest membrane excitability defects

To quantitatively investigate endocytosis defects, we conducted electrophysiology experiments at 3rd instar larval NMJs of control and DMob4 mutants using two-electrode voltage clamp (Fig. 6). We first measured excitatory postsynaptic currents (EPSCs) at low frequency in 2 mM extracellular Ca2+. DMob4 mutant larvae displayed a small ~15% reduction in evoked EPSC amplitude (control: 278 +/− 52 nA (n=4), DMob4: 237 +/− 36 nA (n=5), indicating robust synaptic transmission persisted in the mutants. We next assayed for use-dependent alterations in synaptic function by recording EPSCs during stimulation trains of 10 or 50 Hz in 2 mM extracellular Ca2+ (Fig. 6A, B). Mutants with defective endocytosis typically display a gradual run-down of EPSCs with tetanizing stimuli as the synaptic vesicle pool depletes (Delgado et al., 2000). DMob4 mutants showed relatively normal synaptic depression during 10 Hz stimulation, but complete failures in EPSCs were observed after ~4 seconds with a faster 50 Hz stimulation train (Fig. 6B). This phenotype was observed in both DMob4EYΔL3 nulls and DMob4EYΔL307 hypomorphs, and was 100% penetrant in mutants and absent from controls. Mutant larvae that were allowed to recover from the high frequency stimulation trains displayed normal EPSCs with subsequent 10 Hz stimulations.

Figure 6
Electrophysiological analysis of DMob4 mutants

Neuronal expression of DMob4 with Elavc155GAL4 completely suppressed the EPSC phenotype of DMob4EYΔL3 nulls (Fig. 6A, B), while muscle-specific expression did not, indicating DMob4 is required presynaptically for normal membrane excitability. To further analyze synaptic transmission failures in DMob4 mutants, we tested potential contributing factors by altering stimulation intensities used to trigger action potentials. We observed supernumerary EPSC responses to single nerve stimuli in DMob4 mutants using stronger stimulation (2X nerve threshold, Fig. 6C), suggesting abnormal membrane excitability in the absence of DMob4. Excitability defects were also found at minimal stimulation intensities required to trigger a response (Fig. 6D). Delays between the onset of EPSC responses were observed at 50 Hz, even early in stimulation trains, consistent with a slower propagation of action potentials in mutant animals. Similar perturbations in membrane excitability properties have been observed in a variety of ion channel mutants, including the Na+/K+ ATPase, and the Shaker and Shab potassium channels mutants (Jan et al., 1977; Jan and Jan, 1978; Ueda and Wu, 2006), suggesting DMob4 is likely to modulate membrane excitability of neurons, in addition to its role in regulating morphology. The all-or-none failures in EPSCs observed in the DMob mutants likely mask any vesicle depletion phenotype characteristic of classical endocytotic mutants.

DMob4 mutants have defective axonal transport

While conducting lethal phase analysis on DMob4 mutants, we observed that mutant 3rd instar larvae have a tail-flip phenotype (Fig. 7A, B), with the posterior half of the mutant larva paralyzed. This phenotype has previously been described for microtubule motor mutants such as kinesin and dynein that disrupt axonal transport (Martin et al., 1999). We observed the tail-flip phenotype in all DMob4 strains, including DMob4EYΔL3, DMob4EY23407 and DMob4EYΔL307. The tail-flip phenotype was most severe in the DMob4EYΔL3 and DMob4EY23407 null strains.

Figure 7
Axonal transport defects in DMob4 mutants

Since microtubule motor mutants have defects in axonal transport and display a posterior tail-flip phenotype in 3rd instar larvae, we investigated whether DMob4 mutants also had defects in axonal transport. We immunolabeled homozygous DMob4EYΔL3 and DMob4EYΔL307 mutant 3rd instar larvae for the synaptic vesicle protein Synaptotagmin 1 (Syt 1) and counter-labeled for DMob4 (Fig. 7C–F). Syt 1 is transported in vesicles along microtubules and normally enriches at synapses. Syt 1 has a punctate distribution in the peripheral nerves of control animals (Fig. 7C). In contrast, DMob4EYΔL3 and DMob4EYΔL307 mutants accumulate large aggregates of Syt 1 along axons (Fig. 7E, F). We quantified the area of Syt-1 aggregate accumulation in control and DMob4 mutants, and found that DMob4 nulls had 6-fold more aggregates than controls, while the hypomorph had 4-fold more aggregates (Fig. 7G). Neural specific rescue of the DMob4 nulls with elavc155GAL4;UAS-DMob4 transgenes resulted in a complete elimination of the Syt-1 aggregates in the peripheral nerves (Fig. 7D, G). We also observed abnormal accumulation of the active zone marker bruchpilot (nc82) in peripheral nerves of DMob4 mutants (Fig. 3I). However, this marker is expressed at lower levels and therefore axonal transport phenotypes were less apparent than with Syt-1 immunolabelings. Together, these results suggest that DMob4 is necessary for vesicle transport in peripheral nerve axons.

DMob4 mutants have abnormal microtubule organization at synapses, axons, and muscles

Microtubules serve as the main scaffold along which motors such as kinesin and dynein transport vesicular cargo. Microtubules are also necessary to stabilize presynaptic terminals during synaptic development. In mature presynaptic terminals, microtubules adopt a looped structure. Since DMob4 mutants have abnormal synapse development and defective axonal transport, we investigated whether microtubule networks at synapses and in axons were disrupted. To examine microtubules in control and DMob4 mutant 3rd instar larvae, we immunolabeled the animals for the neuronal microtubule-associated protein Futsch (mAb 22C10). We observed abnormal microtubule organization at the synapse and along peripheral nerves of DMob4 mutants (Fig. 8). In control animals, typical 22C10-positive microtubule loops at terminal boutons were present (Fig. 8A). In DMob4 homozygous mutant synapses, microtubule loops were either absent or had multiple breaks (Fig. 8B, C). In synapses where microtubule loops were absent, the 22C10 staining either filled the boutons in a speckled pattern, or was weak and diffuse. The microtubule organization along peripheral nerves was also altered in DMob4 mutant animals. In control animals, microtubule networks ran parallel along the length of the nerves (Fig. 8D). In DMob4 mutants, microtubule networks had a distorted appearance (Fig. 8E), suggesting microtubule networks are disorganized at peripheral nerves, and synapses.

Figure 8
Abnormal microtubule morphology at NMJs, peripheral nerves, and muscles of DMob4 mutants

To investigate whether the abnormal distribution of the microtubule-associated protein Futsch (mAb 22C10) in DMob4 mutants was a reflection of overall microtubule disorganization, we examined microtubules directly by immunolabelling for α-Tubulin. Posttranslational modifications of α-Tubulin can be used to monitor different populations of microtubules. Stabilized microtubules are enriched for acetylated α-Tubulin, while nascent microtubules are enriched for tyrosinated [alpha] Tubulin(Palazzo et al., 2003; Fukushima et al., 2009). We examined both populations of α-Tubulin in DMob4 mutants.

In control animals, acetylated α-Tubulin immunolabeling gives a very stereotypic pattern in muscle fibers, with a high concentration around muscle nuclei and fibers radiating away from the nuclei in an elaborate meshwork (Fig. 8F). The muscle nuclei are also aligned along the longitudinal axis of the muscle fibers. In DMob4 mutants, there is a striking decrease in the extent of acetylated microtubule networks and the muscle nuclei are more randomly located throughout muscle fibers (Fig. 8G). We quantified the acetylated microtubule signal in muscles as a function of distance from the nuclear membrane (Fig. 8H). In controls, the microtubule signal decreases by 38% at 20 μm from the nucleus, while in DMob4 mutants it is reduced by 70%. These data strongly suggest that stabilized microtubule networks are disorganized in multiple subcellular compartments in DMob4 mutants. To extend these findings, we stained control and DMob4 mutants for tyrosinated-α-Tubulin, which labels newly formed microtubules (Fig. 9). We co-labeled the larvae for Syt-1 to monitor vesicular cargoes in the peripheral nerves and the morphology of synapses. We observed that tyrosinated microtubules are decreased in peripheral nerves, NMJs and muscles of DMob4 mutants (Fig. 9A–F). Since both acetylated- and tyrosinated α-Tubulin networks are diminished in DMob4 mutants, we conclude that DMob4 plays a critical role in the overall organization of microtubule networks in multiple cellular compartments.

Figure 9
Diminished levels of tyrosinated-microtubules in DMob4 mutants

To examine if the altered microtubule organization observed in DMob4 mutants is a consequence of decreased levels of total α-Tubulin, we conducted quantitative Western blot analysis. We found that total α-Tubulin levels are not significantly altered in DMob4 mutants, as compared to controls (Figure 10). These data indicate that total levels of α-Tubulin are not limiting in DMob4 mutants, and that DMob4 exerts its effect on microtubule organization through post-translational mechanisms.

Figure 10
Western blot analysis of total α-Tubulin levels in 3rd instar larvae

Discussion

Here we describe the first in vivo functional characterization of a Phocein protein in the nervous system using Drosophila. Phocein is a member of the Mob family of zinc-binding proteins that are enriched in Purkinje cell dendrites. A function for DMob4 in regulation of neurite branching was suggested from a genome-wide RNAi screen designed to identify genes necessary for neurite outgrowth and morphology (Sepp et al., 2008). Our mutant analysis of Dmob4 loss-of-function alleles revealed a host of nervous system defects, including abnormal synaptic development with extensive satellite bouton formation, disrupted axonal transport, disorganized microtubules, and action potential failure during high frequency stimulation. DMob4 is essential for viability, as null alleles are larval lethal and hypomorphic alleles have decreased adult longevity. The larval lethality of nulls can be rescued by expression of DMob4 or human phocein, indicating functional conservation and orthology of DMob4 across species. While other Mob family members have been found to function in mitotic cells to enable cell cycle progression, facilitate apoptosis, or regulate cell morphogenesis (Luca et al., 2001; Weiss et al., 2002; Hou et al., 2003; He et al., 2005; Lai et al., 2005; Praskova et al., 2008), we find that Phocein/DMob4 has a unique role in post-mitotic neurons to regulate synapse formation, axonal transport, and microtubule organization in the nervous system.

In yeast, Mobs function as activating subunits of the Dbf-2 family of protein kinases (Komarnitsky et al., 1998; Ho et al., 2002). There are two Drosophila Dbf-2 homologues, Tricornered and Warts, which interact with Mob1 (mats) and Mob2 (Justice et al., 1995; He et al., 2005; Lai et al., 2005). The kinase binding partners for Drosophila Mob3 and Mob4 are not known. Mutations in warts and mats cause overproliferation phenotypes, while mutations in tricornered results in a split denticle belt phenotype (Justice et al., 1995; He et al., 2005). We did not observe these phenotypes in DMob4 mutants, suggesting it is unlikely to function as an activating subunit for Tricornered or Warts. What might be the target kinase(s) for DMob4? NDPK (Nucleoside-diphosphate kinase) associates with rat Phocein (Baillat et al., 2002), and is an interesting candidate kinase, given its established roles in endocytosis and microtubule dynamics (Biggs et al., 1990; Krishnan et al., 2001). NDPK is the main enzyme that synthesizes GTP from GDP in many species, and a large fraction of cellular NDPK is associated with microtubules (Postel, 1998). During microtubule polymerization, GTP is bound to tubulin dimers and is necessary for tubulation. During endocytosis, GTP binding by dynamin triggers oligomerization at the necks of clathrin-coated vesicles to drive fission. Based on studies in mammals, Phocein is also part of the STRIPAK protein complex, which contains multiple STE-kinases (Goudreault et al., 2008). As such, several Drosophila STRIPAK STE-kinase homologs might also be regulated by DMob4. The mammalian/Drosophila STRIPAK complex is likely to be well conserved, as many of the non-kinase components, including Striatin (Drosophila Cka), FGFR (Drosophila Heartless), Dynein, and PP2A, are present in Drosophila.

DMob4 function in endocytosis and vesicular traffic

Phocein was previously found to localize to the Golgi apparatus and dendritic spines of Purkinje cells (Baillat et al., 2001; Haeberle et al., 2006). The association of Phocein with proteins that have well-established roles in vesicular traffic and endocytosis (Eps-15, NDPK, and Dynamin-1), in addition to its subcellular localization to sites of active endocytosis, lead to a hypothesis that Phocein may function in membrane budding and vesicle trafficking (Baillat et al., 2001; Baillat et al., 2002; Haeberle et al., 2006). Our in vivo characterization of DMob4 mutants supports a role for the protein in endocytosis and vesicular traffic. In Drosophila, many endocytosis mutants have been identified that show a supernumerary bouton phenotype, including endophilin, synaptojanin, dynamin, AP180 and Dap-160 (Dickman et al., 2006). DMob4 mutants have a supernumerary bouton phenotype comparable to Dap-160 mutants. The excess synaptic growth in these mutants is predicted to arise from defective endocytotic processing of retrogradely-released synaptic growth factors such as the TGFβ homolog, Glass Bottom Boat (GBB), resulting in excessive signaling and enhanced synapse formation. TEM analysis of DMob4 mutant NMJs also reveal endocytic cisternae that are characteristic of defective endocytosis (Kosaka and Ikeda, 1983). Similar cisternae have been reported for eps-15 and dap-160 mutants (Koh et al., 2007). In mutants with severely impaired endocytosis, such as shibire, cisternae occur in large numbers and elongated tubules are evident (Kosaka and Ikeda, 1983). We did not observe such tubules in DMob4, implying the protein is not absolutely required for endocytosis, but likely plays a regulatory role. Our observation that N-terminal truncation mutants (DMob4EYΔL307) undergo temperature-sensitive paralysis (data not shown) further supports a role in endocytosis, as shi, dap-160 and eps-15 mutants show similar phenotypes (Koh et al., 2004). TEM analysis revealed an increase in the number and size of vesicles associated with axonal microtubules. This phenotype may reflect endocytosis defects or abnormal membrane budding events from other cellular compartments, in addition to defects in axonal transport. Many proteins that are integral to endocytosis at the synapse also function in budding of vesicles from the Golgi apparatus, including Clathrin, Dynamin and Eps-15 (Baillat et al., 2002; McNiven and Thompson, 2006; Soldati and Schliwa, 2006).

DMob4 function in axonal transport and microtubule dynamics

In addition to its role in endocytosis, phocein has been suggested to function during mitosis. GFP-DMob4 transgenes associate with centrioles and kinetochores in dividing Drosophila S2 cells (Trammell et al., 2008). Microtubules attach to these structures to generate force to push/pull chromosomes apart and enable their segregation to daughter cells. RNAi knockdown of DMob4 in S2 cells results in a mono-aster spindle phenotype that arises from a failure of microtubule minus-ends to focus at centrioles. RNAi knockdown of other Drosophila Mobs (DMob 1-3) does not affect spindle focusing, suggesting that DMob4/Phocein has a unique role in regulating microtubule dynamics. Although we did not examine mitotic defects in our mutants, we found that microtubule networks are disorganized in multiple cellular compartments, including NMJs, axons, and muscle fibers. How DMob4 functions to stabilize microtubule networks is currently unclear, but could be mediated through several pathways. The decrease in complexity of acetylated and tyrosinated tubulin networks we observe in DMob4 muscle fibers may reflect improper minus-end anchoring on muscle nuclei during development, consistent with the observations in S2 cells. The microtubule phenotypes could also result from abnormal microtubule severing, transport or sorting (Baas et al., 2005; Roll-Mecak and Vale, 2006). Microtubule severing by AAA-ATPases and active sorting of fragments by microtubule motors can rapidly change microtubule architecture. The supernumerary bouton phenotypes observed in DMob4 may also reflect contributions from altered microtubule dynamics, in addition to defective endocytosis (Dickman et al., 2006). Spastin mutants, which lack an AAA-ATPase with microtubule-severing activity, have elaborate supernumerary NMJ boutons, similar to DMob4 (Sherwood et al., 2004; Trotta et al., 2004). Microtubule phenotypes in DMob4 could also result from altered association of microtubule associated proteins (MAPs). Microtubule cross-linkers like Tau modulate microtubule stability, and DMob4 may alter their in vivo activity through regulation of PP2A activity. Phocein has been reported to associate with PP2A in many proteomic studies, and our preliminary studies also indicate that DMob4 associates with PP2A (data not shown). Further studies in DMob4 mutants will be required to assess these alternative causes for disorganized microtubule networks.

Irrespective of the mechanism of microtubule disorganization in DMob4, kinase/phosphatase imbalances likely contribute. Since certain Mobs have been shown to function as Dbf-2 kinase activators, and their overall 3-dimensional structure is likely to be conserved, including key residues for kinase binding (He et al., 2005), it is likely that DMob4 will also function as a kinase activator. As a component of the STRIPAK complex, which contains several serine/threonine kinases and a serine/threonine phosphatase (PP2A), loss of DMob4 could alter the balance of STRIPAK complex activity and substrate specificity (Goudreault et al., 2008). Indeed, PP2A is known to regulate the phosphorylation state of Tau and other MAPs (Sontag et al., 1996; Schild et al., 2006). Linkages between microtubule motors and their cargoes are also regulated by kinase/phosphatase switches. Jun kinases, for example, control the linkage between Kinesin and vesicular cargoes(Horiuchi et al., 2007). The STRIPAK complex may similarly regulate the association of Dynein with its cargoes, and Dynein is known to be differentially phosphorlyated (Mische et al., 2008). Thus, removal of DMob4 from the STRIPAK complex is likely to produce pleiotropic phenotypes as observed in DMob4 mutants.

Our in vivo analysis of DMob4 has identified a unique role for Phoceins in the regulation of microtubule organization and axonal transport. Defects in axonal transport or microtubule organization have been linked to many neurodegenerative diseases, including Huntington’s Disease, Hereditary Spastic Paraplegias, Amyotrophic Lateral Sclerosis and Alzheimer’s Disease (Duncan and Goldstein, 2006). It will be interesting to determine if disruption of phocein in mammals leads to neurodegenerative disease. Further studies of Drosophila Mob4 mutants should provide critical insights into how this important protein regulates axonal transport, endocytosis and microtubule organization in vivo.

Supplementary Material

Supp1

Figure S1. Polypeptide sequence analysis of Drosophila Mobs. (A) Crystal structure of human Mob1B (NCBI CN3D 4.1 structure) revealing general multi-domain alpha helical organization of Mob proteins and zinc binding site. (B) Amino acid sequence alignment of Drosophila melanogaster Mob proteins with human Mob1B indicates that Drosophila Mobs are significantly divergent from each other. Highly conserved residues are colored black, while less well conserved residues are colored orange. Helical domains and β-strands of Human Mob1B as determined from crystal structure analysis are overlayed on the linear amino acid sequence. The four amino acid residues (2 Cysteines and 2 Histidines) necessary for Zn2+ coordination (black arrowheads) are conserved between Drosophila Mob proteins.

Figure S2. Validation of DMob4 rescued animals. PCR analysis of DMob4EYΔL3 homozygous mutants rescued to adult stages with actin-GAL4:UAS-DMob4 indicates that the rescued animals carry the two copies of the EYΔL3 mutant chromosome which harbors a 357 b.p. deletion that spans the DMob4 initiator methionine.

Figure S3. Ubiquitous expression of DMob4 by immunohistochemistry with anti-DMob4 antisera. (A–D, F–G, I–K) Embryonic expression pattern of DMob4. (A) En face view of syncytial blastoderm embryo. (B) Longitudinal section of embryo at syncytial blastoderm stage embryo. (C–D) En face views of DMob4 localization patterns during mitosis and cellularization. (F, G) DMob4 expression in a whole-mount stage 16 embryo. Strong expression of DMob4 is seen in the CNS. (G) High magnification view of the CNS. Anti-DMob4 labels neurons of the longitudinal connectives and central commissure tracts. (E, H) Larval expression of DMob4. (E) DMob4 expression in the salivary gland epithelium is largely cytoplasmic. (H) DMob4 in the CNS is strong in the ventral nerve cord and peripheral nerves. (I–K) DMob4EYΔL3 homozygous mutant embryo (St. 16) stained for DMob4 (red) to indicate specificity of the DMob4 antiserum. Embryo co-stained with Futsch/22C10 (green) to reveal embryo orientation and the CNS. DMob4 staining observed in CNS of control embryos (F), is absent in DMob4 nulls (I).

Acknowledgments

We are grateful to Hugo Bellen and the Bloomington Stock Center for Drosophila stocks, the Drosophila Genomics Resource Center for ESTs, the Developmental Studies Hybridoma Bank for antibodies, the Drosophila RNAi Screening Center and staff for assistance with RNAi, Norbert Perrimon for use of microscopes, the NCBI for Cn3D crystal structure image of Human Mob1 protein, and Sonal Jhaveri for proof-reading and editing of the manuscript. This work was supported by grants from the NIH to P. Hong (R01 EB007042) and to J.T. Littleton (RO1 NS40296 and R01 NS052203).

References

  • Acharya U, Edwards MB, Jorquera RA, Silva H, Nagashima K, Labarca P, Acharya JK. Drosophila melanogaster Scramblases modulate synaptic transmission. J Cell Biol. 2006;173:69–82. [PMC free article] [PubMed]
  • Aranda-Orgilles B, Aigner J, Kunath M, Lurz R, Schneider R, Schweiger S. Active transport of the ubiquitin ligase MID1 along the microtubules is regulated by protein phosphatase 2A. PLoS ONE. 2008;3:e3507. [PMC free article] [PubMed]
  • Baas PW, Karabay A, Qiang L. Microtubules cut and run. Trends Cell Biol. 2005;15:518–524. [PubMed]
  • Baillat G, Gaillard S, Castets F, Monneron A. Interactions of phocein with nucleoside-diphosphate kinase, Eps15, and Dynamin I. J Biol Chem. 2002;277:18961–18966. [PubMed]
  • Baillat G, Moqrich A, Castets F, Baude A, Bailly Y, Benmerah A, Monneron A. Molecular cloning and characterization of phocein, a protein found from the Golgi complex to dendritic spines. Mol Biol Cell. 2001;12:663–673. [PMC free article] [PubMed]
  • Bartoli M, Ternaux JP, Forni C, Portalier P, Salin P, Amalric M, Monneron A. Down-regulation of striatin, a neuronal calmodulin-binding protein, impairs rat locomotor activity. J Neurobiol. 1999;40:234–243. [PubMed]
  • Biggs J, Hersperger E, Steeg PS, Liotta LA, Shearn A. A Drosophila gene that is homologous to a mammalian gene associated with tumor metastasis codes for a nucleoside diphosphate kinase. Cell. 1990;63:933–940. [PubMed]
  • Colman-Lerner A, Chin TE, Brent R. Yeast Cbk1 and Mob2 activate daughter-specific genetic programs to induce asymmetric cell fates. Cell. 2001;107:739–750. [PubMed]
  • Delgado R, Maureira C, Oliva C, Kidokoro Y, Labarca P. Size of vesicle pools, rates of mobilization, and recycling at neuromuscular synapses of a Drosophila mutant, shibire. Neuron. 2000;28:941–953. [PubMed]
  • Devroe E, Erdjument-Bromage H, Tempst P, Silver PA. Human Mob proteins regulate the NDR1 and NDR2 serine-threonine kinases. J Biol Chem. 2004;279:24444–24451. [PubMed]
  • Dickman DK, Lu Z, Meinertzhagen IA, Schwarz TL. Altered synaptic development and active zone spacing in endocytosis mutants. Curr Biol. 2006;16:591–598. [PubMed]
  • Duncan JE, Goldstein LS. The genetics of axonal transport and axonal transport disorders. PLoS Genet. 2006;2:e124. [PMC free article] [PubMed]
  • Emoto K, Parrish JZ, Jan LY, Jan YN. The tumour suppressor Hippo acts with the NDR kinases in dendritic tiling and maintenance. Nature. 2006;443:210–213. [PubMed]
  • Feng Y, Ueda A, Wu CF. A modified minimal hemolymph-like solution, HL3.1, for physiological recordings at the neuromuscular junctions of normal and mutant Drosophila larvae. J Neurogenet. 2004;18:377–402. [PubMed]
  • Fukushima N, Furuta D, Hidaka Y, Moriyama R, Tsujiuchi T. Post-translational modifications of tubulin in the nervous system. J Neurochem. 2009;109:683–693. [PubMed]
  • Goudreault M, D’Ambrosio LM, Kean MJ, Mullin M, Larsen BG, Sanchez A, Chaudhry S, Chen GI, Sicheri F, Nesvizhskii AI, Aebersold R, Raught B, Gingras AC. A PP2A phosphatase high-density interaction network identifies a novel striatin-interacting phosphatase and kinase complex linked to the cerebral cavernous malformation 3 (CCM3) protein. Mol Cell Proteomics 2008 [PMC free article] [PubMed]
  • Haeberle AM, Castets F, Bombarde G, Baillat G, Bailly Y. Immunogold localization of phocein in dendritic spines. J Comp Neurol. 2006;495:336–350. [PubMed]
  • He Y, Emoto K, Fang X, Ren N, Tian X, Jan YN, Adler PN. Drosophila Mob family proteins interact with the related tricornered (Trc) and warts (Wts) kinases. Mol Biol Cell. 2005;16:4139–4152. [PMC free article] [PubMed]
  • Hergovich A, Bichsel SJ, Hemmings BA. Human NDR kinases are rapidly activated by MOB proteins through recruitment to the plasma membrane and phosphorylation. Mol Cell Biol. 2005;25:8259–8272. [PMC free article] [PubMed]
  • Ho Y, Gruhler A, Heilbut A, Bader GD, Moore L, Adams SL, Millar A, Taylor P, Bennett K, Boutilier K, Yang L, Wolting C, Donaldson I, Schandorff S, Shewnarane J, Vo M, Taggart J, Goudreault M, Muskat B, Alfarano C, Dewar D, Lin Z, Michalickova K, Willems AR, Sassi H, Nielsen PA, Rasmussen KJ, Andersen JR, Johansen LE, Hansen LH, Jespersen H, Podtelejnikov A, Nielsen E, Crawford J, Poulsen V, Sorensen BD, Matthiesen J, Hendrickson RC, Gleeson F, Pawson T, Moran MF, Durocher D, Mann M, Hogue CW, Figeys D, Tyers M. Systematic identification of protein complexes in Saccharomyces cerevisiae by mass spectrometry. Nature. 2002;415:180–183. [PubMed]
  • Horiuchi D, Collins CA, Bhat P, Barkus RV, Diantonio A, Saxton WM. Control of a kinesin-cargo linkage mechanism by JNK pathway kinases. Curr Biol. 2007;17:1313–1317. [PMC free article] [PubMed]
  • Hou MC, Wiley DJ, Verde F, McCollum D. Mob2p interacts with the protein kinase Orb6p to promote coordination of cell polarity with cell cycle progression. J Cell Sci. 2003;116:125–135. [PubMed]
  • Jan YN, Jan LY. Genetic dissection of short-term and long-term facilitation at the Drosophila neuromuscular junction. Proc Natl Acad Sci U S A. 1978;75:515–519. [PubMed]
  • Jan YN, Jan LY, Dennis MJ. Two mutations of synaptic transmission in Drosophila. Proc R Soc Lond B Biol Sci. 1977;198:87–108. [PubMed]
  • Justice RW, Zilian O, Woods DF, Noll M, Bryant PJ. The Drosophila tumor suppressor gene warts encodes a homolog of human myotonic dystrophy kinase and is required for the control of cell shape and proliferation. Genes Dev. 1995;9:534–546. [PubMed]
  • Kearney JB, Wheeler SR, Estes P, Parente B, Crews ST. Gene expression profiling of the developing Drosophila CNS midline cells. Dev Biol. 2004;275:473–492. [PMC free article] [PubMed]
  • Koh TW, Verstreken P, Bellen HJ. Dap160/intersectin acts as a stabilizing scaffold required for synaptic development and vesicle endocytosis. Neuron. 2004;43:193–205. [PubMed]
  • Koh TW, Korolchuk VI, Wairkar YP, Jiao W, Evergren E, Pan H, Zhou Y, Venken KJ, Shupliakov O, Robinson IM, O’Kane CJ, Bellen HJ. Eps15 and Dap160 control synaptic vesicle membrane retrieval and synapse development. J Cell Biol. 2007;178:309–322. [PMC free article] [PubMed]
  • Komarnitsky SI, Chiang YC, Luca FC, Chen J, Toyn JH, Winey M, Johnston LH, Denis CL. DBF2 protein kinase binds to and acts through the cell cycle-regulated MOB1 protein. Mol Cell Biol. 1998;18:2100–2107. [PMC free article] [PubMed]
  • Kosaka T, Ikeda K. Reversible blockage of membrane retrieval and endocytosis in the garland cell of the temperature-sensitive mutant of Drosophila melanogaster, shibirets1. J Cell Biol. 1983;97:499–507. [PMC free article] [PubMed]
  • Krishnan KS, Rikhy R, Rao S, Shivalkar M, Mosko M, Narayanan R, Etter P, Estes PS, Ramaswami M. Nucleoside diphosphate kinase, a source of GTP, is required for dynamin-dependent synaptic vesicle recycling. Neuron. 2001;30:197–210. [PubMed]
  • Lai ZC, Wei X, Shimizu T, Ramos E, Rohrbaugh M, Nikolaidis N, Ho LL, Li Y. Control of cell proliferation and apoptosis by mob as tumor suppressor, mats. Cell. 2005;120:675–685. [PubMed]
  • Li H, Coghlan A, Ruan J, Coin LJ, Heriche JK, Osmotherly L, Li R, Liu T, Zhang Z, Bolund L, Wong GK, Zheng W, Dehal P, Wang J, Durbin R. TreeFam: a curated database of phylogenetic trees of animal gene families. Nucleic Acids Res. 2006;34:D572–580. [PMC free article] [PubMed]
  • Littleton JT, Bellen HJ, Perin MS. Expression of synaptotagmin in Drosophila reveals transport and localization of synaptic vesicles to the synapse. Development. 1993;118:1077–1088. [PubMed]
  • Luca FC, Mody M, Kurischko C, Roof DM, Giddings TH, Winey M. Saccharomyces cerevisiae Mob1p is required for cytokinesis and mitotic exit. Mol Cell Biol. 2001;21:6972–6983. [PMC free article] [PubMed]
  • Marie B, Sweeney ST, Poskanzer KE, Roos J, Kelly RB, Davis GW. Dap160/intersectin scaffolds the periactive zone to achieve high-fidelity endocytosis and normal synaptic growth. Neuron. 2004;43:207–219. [PubMed]
  • Markstein M, Pitsouli C, Villalta C, Celniker SE, Perrimon N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat Genet. 2008;40:476–483. [PMC free article] [PubMed]
  • Martin M, Iyadurai SJ, Gassman A, Gindhart JG, Jr, Hays TS, Saxton WM. Cytoplasmic dynein, the dynactin complex, and kinesin are interdependent and essential for fast axonal transport. Mol Biol Cell. 1999;10:3717–3728. [PMC free article] [PubMed]
  • McNiven MA, Thompson HM. Vesicle formation at the plasma membrane and trans-Golgi network: the same but different. Science. 2006;313:1591–1594. [PubMed]
  • Mische S, He Y, Ma L, Li M, Serr M, Hays TS. Dynein light intermediate chain: an essential subunit that contributes to spindle checkpoint inactivation. Mol Biol Cell. 2008;19:4918–4929. [PMC free article] [PubMed]
  • Mrkobrada S, Boucher L, Ceccarelli DF, Tyers M, Sicheri F. Structural and functional analysis of Saccharomyces cerevisiae Mob1. J Mol Biol. 2006;362:430–440. [PubMed]
  • Ni JQ, Markstein M, Binari R, Pfeiffer B, Liu LP, Villalta C, Booker M, Perkins L, Perrimon N. Vector and parameters for targeted transgenic RNA interference in Drosophila melanogaster. Nat Methods. 2008;5:49–51. [PMC free article] [PubMed]
  • Palazzo A, Ackerman B, Gundersen GG. Cell biology: Tubulin acetylation and cell motility. Nature. 2003;421:230. [PubMed]
  • Pi HJ, Lisman JE. Coupled phosphatase and kinase switches produce the tristability required for long-term potentiation and long-term depression. J Neurosci. 2008;28:13132–13138. [PMC free article] [PubMed]
  • Ponchon L, Dumas C, Kajava AV, Fesquet D, Padilla A. NMR solution structure of Mob1, a mitotic exit network protein and its interaction with an NDR kinase peptide. J Mol Biol. 2004;337:167–182. [PubMed]
  • Postel EH. NM23-NDP kinase. Int J Biochem Cell Biol. 1998;30:1291–1295. [PubMed]
  • Praskova M, Xia F, Avruch J. MOBKL1A/MOBKL1B phosphorylation by MST1 and MST2 inhibits cell proliferation. Curr Biol. 2008;18:311–321. [PubMed]
  • Roll-Mecak A, Vale RD. Making more microtubules by severing: a common theme of noncentrosomal microtubule arrays? J Cell Biol. 2006;175:849–851. [PMC free article] [PubMed]
  • Rothwell W, Sullivan W. Fluorescent analysis of Drosophila embryos. In: Sullivan W, Ashburner M, Hawley R, editors. Drosophila Protocols. Cold Spring Harbor Laboratory Press; 1999.
  • Schild A, Ittner LM, Gotz J. Altered phosphorylation of cytoskeletal proteins in mutant protein phosphatase 2A transgenic mice. Biochem Biophys Res Commun. 2006;343:1171–1178. [PubMed]
  • Sepp KJ, Hong P, Lizarraga SB, Liu JS, Mejia LA, Walsh CA, Perrimon N. Identification of neural outgrowth genes using genome-wide RNAi. PLoS Genet. 2008;4:e1000111. [PMC free article] [PubMed]
  • Sherwood NT, Sun Q, Xue M, Zhang B, Zinn K. Drosophila spastin regulates synaptic microtubule networks and is required for normal motor function. PLoS Biol. 2004;2:e429. [PMC free article] [PubMed]
  • Soldati T, Schliwa M. Powering membrane traffic in endocytosis and recycling. Nat Rev Mol Cell Biol. 2006;7:897–908. [PubMed]
  • Sontag E, Nunbhakdi-Craig V, Lee G, Bloom GS, Mumby MC. Regulation of the phosphorylation state and microtubule-binding activity of Tau by protein phosphatase 2A. Neuron. 1996;17:1201–1207. [PubMed]
  • Stavridi ES, Harris KG, Huyen Y, Bothos J, Verwoerd PM, Stayrook SE, Pavletich NP, Jeffrey PD, Luca FC. Crystal structure of a human Mob1 protein: toward understanding Mob-regulated cell cycle pathways. Structure. 2003;11:1163–1170. [PubMed]
  • Stoepel J, Ottey MA, Kurischko C, Hieter P, Luca FC. The mitotic exit network Mob1p-Dbf2p kinase complex localizes to the nucleus and regulates passenger protein localization. Mol Biol Cell. 2005;16:5465–5479. [PMC free article] [PubMed]
  • Tournebize R, Andersen SS, Verde F, Doree M, Karsenti E, Hyman AA. Distinct roles of PP1 and PP2A-like phosphatases in control of microtubule dynamics during mitosis. Embo J. 1997;16:5537–5549. [PubMed]
  • Trammell MA, Mahoney NM, Agard DA, Vale RD. Mob4 plays a role in spindle focusing in Drosophila S2 cells. J Cell Sci. 2008;121:1284–1292. [PMC free article] [PubMed]
  • Trotta N, Orso G, Rossetto MG, Daga A, Broadie K. The hereditary spastic paraplegia gene, spastin, regulates microtubule stability to modulate synaptic structure and function. Curr Biol. 2004;14:1135–1147. [PubMed]
  • Ueda A, Wu CF. Distinct frequency-dependent regulation of nerve terminal excitability and synaptic transmission by IA and IK potassium channels revealed by Drosophila Shaker and Shab mutations. J Neurosci. 2006;26:6238–6248. [PubMed]
  • Wei X, Shimizu T, Lai ZC. Mob as tumor suppressor is activated by Hippo kinase for growth inhibition in Drosophila. Embo J. 2007;26:1772–1781. [PubMed]
  • Weiss EL, Kurischko C, Zhang C, Shokat K, Drubin DG, Luca FC. The Saccharomyces cerevisiae Mob2p-Cbk1p kinase complex promotes polarized growth and acts with the mitotic exit network to facilitate daughter cell-specific localization of Ace2p transcription factor. J Cell Biol. 2002;158:885–900. [PMC free article] [PubMed]
  • Zallen JA, Peckol EL, Tobin DM, Bargmann CI. Neuronal cell shape and neurite initiation are regulated by the Ndr kinase SAX-1, a member of the Orb6/COT-1/warts serine/threonine kinase family. Mol Biol Cell. 2000;11:3177–3190. [PMC free article] [PubMed]