PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of ijpppLink to Publisher's site
 
Int J Physiol Pathophysiol Pharmacol. 2010; 2(1): 12–19.
Published online 2009 November 22.
PMCID: PMC2860299
NIHMSID: NIHMS161546

Sm22α transcription occurs at the early onset of the cardiovascular system and the intron 1 is dispensable for its transcription in smooth muscle cells during mouse development

Abstract

SM22α, also known as SM22, has been widely used as a smooth muscle cell (SMC) marker and is known to be expressed in the embryonic heart. The intron 1 of Sm22 contains multiple important and evolutionarily conserved regulatory elements. To determine the role of the intron 1 in Sm22 transcriptional regulation and the function of SM22 during development, we generated a Sm22 knockout mouse by replacing the intron 1 and the translation initiation with a nuclear localized LacZ (nLacZ) reporter. The resulting Sm22 knockout mice (Sm22-/-) were viable and fertile without any apparent developmental defects. Using X-gal staining assay, we found that Sm22 transcription was detectable in the chorion formation region and in the heart field before formation of the heart tube at E7.5, namely much earlier than the looped heart stage where it had been previously reported. The expression of lacZ progressively expanded throughout the heart tube by E8.5. LacZ was transiently expressed in the heart and somites and then became restricted to the vascular and visceral SMC organs. These results indicate that SM22 is not required for mouse basal homeostatic function and that the intron 1 is dispensable for Sm22 transcription during development. Given the importance of vasculature in organogenesis and in diseases, this mouse line may be a valuable tool to trace the development and pathology of the cardiovascular system.

Keywords: SM22α, Transgelin, smooth muscle cells, intron 1, knockout mouse, cardiac crescent

Introduction

SM22α, also known as transgelin or simply as SM22 , is a 22 KD protein highly expressed in vascular and visceral smooth muscle cell (VSMC) tissues and its expression is sensitive to cell shape changes [1-3]. SM22 is a member of the calponin family, containing a calponin homology domain conserved from yeast to human [4, 5]. SM22 directly binds to the actin cytoskeleton and induces actin bundling [2, 4-6]. However, little is known about the function of SM22 in SMC development.

The transcription of Sm22 is highly expressed in the cardiovascular system during embryogenesis [7-11]. Specifically, the Sm22 promoter is highly expressed in the heart tube and selectively expressed in a subset of arterial SMCs, but not in venous or visceral SMCs. However, it has not been known whether Sm22 transcription is expressed in the heart fields before formation of the heart tube.

Several regulatory elements that regulate Sm22 transcription have been characterized in transgenic mice. The CArG boxes (the SRF binding site), especially the proximal CArG box, play a central role in controlling the expression of the Sm22 promoter in arterial SMCs [12, 13]. The TCE (TGFB Control Element) and the SBE site (a Smad Binding Site) are found to be important for Sm22 transcription during embryogenesis in transgenic mice [14, 15]. Interestingly, a G/C-rich element (a SP1 binding site) in the Sm22 promoter is dispensable for Sm22 transcription in arterial SMCs but is required for the down regulation of Sm22 transcription in response to vascular injury [16]. Given the complexity of vascular development and pathogenesis of vascular diseases, much remains to be uncovered about the regulatory network that controls Sm22 transcription.

In an ongoing effort to identify transcriptional regulatory elements for Sm22 expression, we performed bioinformatics sequence analyses of Sm22 and found that the intron 1 of Sm22 contained multiple important evolutionarily conserved regulatory elements. The intron 1 of several SMC marker genes such as SM α-actin, SM-MHC, and Calponin contains critical regulatory elements for their transcription in SMCs in vivo [17-19]. To determine the role of the intron 1 of Sm22 in transcriptional regulation in development, we generated Sm22 knockout mice in which a nuclear localized LacZ reporter gene was knocked into the first intron of the Sm22. Consistent with previous reports [9, 20], SM22 deficiency did not affect mouse development; the knockout mice were viable and fertile. We analyzed the temporospatial patterns of LacZ activities in Sm22 knockout mice and found that the expression of the LacZ reporter was detectable in the chorion formation region and in the heart field at E7.5. LacZ activities were transiently detected in the heart tube and somites during embryogenesis. The expression in the vascular and visceral tissues continuously increased throughout embryogenesis into adulthood. These results demonstrate that the regulatory elements in the intron 1 of Sm22 are not essential for Sm22 transcription during development. Given the importance of vasculature in organogenesis and in diseases, this mouse line may be a valuable tool to trace the development and pathology of the cardiovascular system.

Materials and methods

Generation of Sm22 mutant mice

A Sm22 targeting vector was designed to replace the intron 1 and the translation initiation region of Sm22 in exon2 with a nuclear localized LacZ and pGKneo cassette using a modified pKO-lacZ vector (a generous gift from L Gan, Rochester, NY) [21], in which a nuclear localization signal was inserted into the LacZ/pGK-neo-TK cassette. Genomic DNA fragments flanking the intron 1 and exon2 of the Sm22 were PCR-amplified using the genomic DNA from a SV129 mouse as the template. The left arm fragment contained 5kb 5’upstream sequence and the entire exon 1; the right arm fragment contained the 4.5 kb Sm22 genomic sequence starting at 63 nucleotides downstream of the SM22 translation initiation codon in exon 2. The left and right arms were inserted into the targeting vector pKO-nLacZ. Through homologous recombination, the intron 1 was substituted by the nLacZ-pGK-neo cassette, placing the expression of LacZ under the control of the endogenous Sm22 promoter without the intron 1.

The targeting vector was linearized at the NotI site and was injected into SV129 derived ES cells. G418-resistant ES colonies with correct homologous recombination were identified by PCR genotyping and Southern blot using a probe 3’ to Sm22. The Sm22+/- mice were backcrossed into B6 and SV129 genetic background for at least 4 generations. The Sm22+/- mice were maintained in mixed genetic background for phenotype analyses. The targeted ES cells and Sm22 knockout chimera mice were generated in Dr. Beverly Koller’s lab at the University of North Carolina.

The wild type (WT), Sm22+/- and Sm22-/- mice were identified by PCR using allele-specific primers: “a” (5'CCCAGCCCAGACACCGAAGCTA C 3' in exon 1), “b” (5' TCCCTTGGCCTCATTTGTCACCTC 3' in intron 1), and “c” (5'TACCACAGCGGATGGTTCGG 3' in lacZ gene). “d” (GTGGAAGGCCTGCTTAGCACAAAT in intron 1) “e” ACTCACCACACCATTCTTCAGCCA in exon2). The PCR products were 1.35kb (for the targeted allele), 313bp and 303bp (for the WT allele) using primers a/c, a/b and d/e respectively. The PCR amplification was performed in 30 cycles by denaturation at 95°C for 15”, annealing at 60°C for 30”, and elongation at 72°C for 1.5 min.

All animal experimentation was performed according to the National Institutes of Health guidelines and approved by the Institutional Animal Care and Use Committee (IACUC) at Wayne State University.

Western blot

SMC tissues were isolated from WT, Sm22+/-, and Sm22-/- mice. Equal amount (20 μg) lysates were used for SDS-polyacrylamide gel electrophoresis (PAGE) analyses. The SDS-PAGE gel was transferred to Immun-Blot PVDF Membrane (Bio-Rad) and subsequently probed with anti-SM22α goat polyclonal antibody (Santa Cruz, sc-18513) and anti β-actin monoclonal antibodies (Sigma, A5316). Primary antibodies were detected using NEN Chemiluminescence Western Blotting substrates (NEN, NEL102).

X-gal staining

The expression of LacZ in Sm22+/- mice was detected by X-gal (β-glactosidase) staining. Mouse Sm22+/- embryos at different developmental stages and tissues from Sm22+/- mice were collected by breeding CD1 female with Sm22-/- male. X-gal staining was performed as previously described [8]. After X-gal staining, the tissues were fixed in 4% paraformaldehyde. The paraffin sections were then counterstained with H&E before being photographed.

Results and discussion

Targeting strategy for generating the Sm22 knockout mouse

Sequence analyses of Sm22 revealed that its intron 1 contained several evolutionarily conserved regions (Figure 1A). We were interested in characterizing the regulatory network for Sm22 transcription and in determining the function of SM22 in cardiovascular development. Therefore, our strategy of generating a Sm22 knockout mouse was to replace the intron 1 and the translation initiation of Sm22 with a nuclear localized LacZ reporter (Figure 1B). Homologous recombination resulted in the deletion of intron 1 in the Sm22 and placed the LacZ-pGKneo cassette under the control of the endogenous Sm22 promoter without the intron 1. We anticipated that the expression of Sm22 would be abolished in Sm22-/-mice. We also expected that analyses of the phenotypes of Sm22-/- mice would reveal the functional role of SM22 in development. The role of intron 1 in Sm22 transcriptional regulation could be determined by the expression of LacZ using X-gal staining.

Figure 1
Generation of Sm22α knockout mice. (A) VISTA genome browser output for sequence comparison of the mouse Sm22 with the human SM22. The exons (in blue) including the UTRs (in yellow) are highly conserved between mouse and human. The intron 1 contains ...

The wild type, Sm22+/-, and Sm22-/-mice were identified by allele-specific PCR genotyping (Figure 1C). The loss of SM22 in SMC tissues such as the aorta and the bladder from the Sm22-/-were confirmed by Western blot (Figure 1D). In agreement with previous studies [9, 20], Sm22-/-mice were viable and fertile with no obvious phenotypes during normal development. These results suggest that SM22 is not required for development and for the basal homeostatic functions of SMCs.

Temporospatial expression patterns of LacZ in the early cardiovascular system

Previous studies showed that the transcription of Sm22 is high in the heart at E8.0 [7-9]. The cardiogenesis arises from progenitors in the cardiac crescent region and the secondary heart field at E7.5 [22-24]. To determine whether Sm22 transcription occurs in early cardiogenesis, we examined the LacZ expression in a series of timed Sm22+/-embryos at E6.0 to E8.5.

At E7.5, LacZ activities were detectable in the chorion formation area and in the cells lying medial and immediate cranial to the cardiac crescent (Figure 2A). The precise fate of these cells remains to be determined. Consistent with the highly dynamic nature of cardiogenesis at this stage, the expression of LacZ expanded rapidly and progressively towards the arterial pole as the heart tube forms (Figure 2B-D). By E8.5, LacZ activities were highly expressed in the heart (Figure 2E).

Figure 2
Transcriptional activation of LacZ in the early cardiovascular system. The Sm22+/- embryos at E7.5-E8.5 were harvested for whole-mount X-gal staining. (A) At E7.5, X-gal staining was detected in the chorion (c) formation area and in cells lying medial ...

Transcriptional expression patterns of the Sm22 during embryogenesis and in the adult

The LacZ reporter was highly expressed in the looped heart at E9.0 (Figure 3A). In addition, LacZ activities in the aorta and somites became evident at this stage. LacZ activities continued increasing in the aorta and somites at E10 (Figure 3B). The expression of LacZ in the heart and somites diminished while the expression in the aorta and in the branches of arteries throughout the embryos became prominent at E12 (Figure 3C). At E13, a noticeable high level of LacZ expression was observed in the aorta and arteries as well as in the newly formed visceral organs such as esophagus, stomach, intestine and bladder (Figure 3D).

Figure 3
The LacZ temporospatial expression patterns in Sm22+/- mice from E9 to E13. The Sm22+/- embryos at E9-E13 were harvested for whole-mount X-gal staining. (A) The LacZ activities began to be detectable in the heart (h), aorta (a) and somites (s) at E9. ...

LacZ expression increased continuously in vascular and visceral SMC organs throughout embryogenesis and into adulthood. In adults, X-gal staining showed LacZ activities in the aorta and coronary arteries but not in the myocardium (Figure 4A). In the lung, LacZ expression was high in the pulmonary arteries and pulmonary veins but not in the simple squamous epithelium of alveoli (Figure 4B, 4G). LacZ activities were high in visceral SMC organs such as the stomach and intestine, but not the esophagus in the digestion system (Figure 4C, 4E). LacZ expression was also high in the bladder (Figure 4F). Histology analyses showed that the LacZ activities were specifically expressed in arterial, venous and visceral SMCs. In the thigh, LacZ expression was observed in the femoral artery, femoral vein, but not the nerve fiber, fat and skeletal muscles (Figure 4D, 4G). In the intestine, LacZ expression was detected in the muscularis externa consisting of both circular and longitudinal smooth muscle layers (Figure 4I).

Figure 4
LacZ expression in adult Sm22-/- mice. A variety of tissues were harvested from the adult Sm22+/- mice. X-gal staining assay showed that LacZ expression was restricted to SMC tissues in the heart (A), lung (B), intestine (C), thigh (D), stomach (E) and ...

Taken together, the temporospatial expression patterns of LacZ reporter recapitulate those observed in transgenic and knockout mice in which the LacZ is under the control of Sm22 promoters and the endogenous Sm22 promoter [8-11, 25]. These results suggest that the intron 1 is not required for Sm22 transcription during SMC development.

In summary, this study demonstrated that the transcription of Sm22 occurred at the onset of cardiogenesis and vasculogenesis during development, at a stage much earlier than previously reported. Although the intron 1 contained multiple evolutionarily conserved regulatory elements, it appeared that these elements were not essential for Sm22 transcription under normal development. Consistent with this notion, the Sm22 promoters without or with the intron 1 have shown similar temporospatial expression patterns during development [8, 11, 12, 16, 25, 26]. Given the complexity of gene regulation in SMC phenotypic modulation [27], it is quite possible that some of these regulatory elements may participate in Sm22 transcriptional regulation under pathological conditions. Several SMC regulatory elements such as the SP1 in the Sm22 promoter and the CArGs in the SM α-actin promoter have been shown to be dispensable for the promoter activities in arteries but are required for the down regulation of the promoter activities in response to vascular injuries [16, 28]. Therefore, it is worthwhile to explore whether those evolutionarily conserved elements within the intron 1 are required for the down regulation of Sm22 transcription in response to vascular injury.

Increasing evidence supports the notion that the actin cytoskeleton plays important roles in SMC phenotypic modulation [29, 30]. SM22 is an actin binding protein highly expressed in SMCs and in the early cardiovascular system. In view of this, it is rather unexpected that SM22 is not required for mouse basal homeostatic function. Given the importance of the SM22 associated actin cytoskeleton in cell function, it is possible that the function of SM22 can be compensated through molecular redundancy. Indeed, SM22α and its homologue SM22β colocalize with the cytoskeletal actin filaments; it is thus likely that SM22β can compensate for the loss of SM22α [31, 32]. However, the defects of this compensation system may be revealed under pathological conditions. The analyses of Sm22-/-mice showed that ablation of SM22 reduces SMC contractility [32, 33] and increases atherosclerotic plaques in the ApoE-/-mice [20].

Although SM22 is not required for SMC homeostatic functions, SM22 may participate in SMC phenotypic modulation. Consistent with this notion, Sm22 expression is sensitive to cell shape change and is down regulated in vascular diseases and a variety of cancers [2, 34, 35]. Understanding the molecular mechanisms whereby SM22 mediates cytoskeleton remodeling may reveal that SM22 plays an active role in biological processes involved in the pathogenesis of vascular diseases and cancer.

Conclusion

This study demonstrates that the transcription of Sm22 occurs at the early onset of cardiogenesis and vasculogenesis. In spite of its high level of expression in the early heart, deficiency of SM22 in mouse does not perturb development. The evolutionarily conserved elements in the intron 1 of Sm22 are not required for SM22 expression in smooth muscle cells during development.

Acknowledgments

We are grateful to Alex Gow for sharing the dissection microscope camera and Giuseppe Rossi for editorial assistance. We are thankful to Jianbin Shen, Donghong Ju, Jianpu Zheng, Da-zhi Wang, and Randy Armant for valuable discussions. The work in Li's Laboratory was supported by grants from the NIH (HL058916 and HL087014 to L.L) and from American Heart Association (0555680Z to L.L.).

References

1. Lees-Miller JP, Heeley DH, Smillie LB. An abundant and novel protein of 22 kDa (SM22) is widely distributed in smooth muscles. Purification from bovine aorta. Biochemical Journal. 1987;244:705–709. [PubMed]
2. Shapland C, Hsuan JJ, Totty NF, Lawson D. Purification and properties of transgelin: a transformation and shape change sensitive ac-tin-gelling protein. J Cell Biol. 1993;121:1065–1073. [PMC free article] [PubMed]
3. Shapland C, Lowings P, Lawson D. Identification of new actin-associated polypeptides that are modified by viral transformation and changes in cell shape. J Cell Biol. 1988;107:153–161. [PMC free article] [PubMed]
4. Fu Y, Liu HW, Forsythe SM, Kogut P, McConville JF, Halayko AJ, Camoretti-Mercado B, Solway J. Mutagenesis analysis of human SM22: characterization of actin binding. J Appl Physiol. 2000;89:1985–1990. [PubMed]
5. Winder SJ, Jess T, Ayscough KR. SCP1 encodes an actin-bundling protein in yeast. Bio-chem J. 2003;375:287–295. [PubMed]
6. Gimona M, Kaverina I, Resch GP, Vignal E, Burgstaller G. Calponin repeats regulate actin filament stability and formation of podosomes in smooth muscle cells. Mol Biol Cell. 2003;14:2482–2491. [PMC free article] [PubMed]
7. Li L, Miano JM, Cserjesi P, Olson EN. SM22 alpha, a marker of adult smooth muscle, is expressed in multiple myogenic lineages during embryogenesis. Circulation Research. 1996;78:188–195. [PubMed]
8. Li L, Miano JM, Mercer B, Olson EN. Expression of the SM22alpha promoter in transgenic mice provides evidence for distinct transcriptional regulatory programs in vascular and visceral smooth muscle cells. J Cell Biol. 1996;132:849–859. [PMC free article] [PubMed]
9. Zhang JC, Kim S, Helmke BP, Yu WW, Du KL, Lu MM, Strobeck M, Yu Q, Parmacek MS. Analysis of SM22alpha-deficient mice reveals unanticipated insights into smooth muscle cell differentiation and function. Mol Cell Biol. 2001;21:1336–1344. [PMC free article] [PubMed]
10. Moessler H, Mericskay M, Li Z, Nagl S, Paulin D, Small JV. The SM 22 promoter directs tis-sue-specific expression in arterial but not in venous or visceral smooth muscle cells in transgenic mice. Development. 1996;122:2415–2425. [PubMed]
11. Kim S, IP HS, Lu MM, Clendenin C, Parmacek MS. A serum response factor-dependent transcriptional regulatory program identifies distinct smooth muscle cell sublineages. Molecular and Cellular Biology. 1997;17:2266–2278. [PMC free article] [PubMed]
12. Li L, Liu Z, Mercer B, Overbeek P, Olson EN. Evidence for serum response factor-mediated regulatory networks governing SM22alpha transcription in smooth, skeletal, and cardiac muscle cells. Developmental Biology. 1997;187:311–321. [PubMed]
13. Strobeck M, Kim S, Zhang JC, Clendenin C, Du KL, Parmacek MS. Binding of serum response factor to carg box sequences is necessary but not sufficient to restrict gene expression to arterial smooth muscle cells. J Biol Chem. 2001;276:16418–16424. [PubMed]
14. Adam PJ, Regan CP, Hautmann MB, Owens GK. Positive- and negative-acting Kruppel-like transcription factors bind a transforming growth factor beta control element required for expression of the smooth muscle cell differentiation marker SM22alpha in vivo. J Biol Chem. 2000;275:37798–37806. [PubMed]
15. Qiu P, Ritchie RP, Fu Z, Cao D, Cumming J, Miano JM, Wang DZ, Li HJ, Li L. Myocardin enhances Smad3-mediated transforming growth factor-beta1 signaling in a CArG box-independent manner: Smad-binding element is an important cis element for SM22alpha transcription in vivo. Circ Res. 2005;97:983–991. [PubMed]
16. Regan CP, Adam PJ, Madsen CS, Owens GK. Molecular mechanisms of decreased smooth muscle differentiation marker expression after vascular injury. J Clin Invest. 2000;106:1139–1147. [PMC free article] [PubMed]
17. Mack CP, Owens GK. Regulation of smooth muscle alpha-actin expression in vivo is dependent on CArG elements within the 5' and first intron promoter regions. Circ Res. 1999;84:852–861. [PubMed]
18. Manabe I, Owens GK. CArG elements control smooth muscle subtype-specific expression of smooth muscle myosin in vivo. J Clin Invest. 2001;107:823–834. [PMC free article] [PubMed]
19. Miano JM, Carlson MJ, Spencer JA, Misra RP. Serum response factor-dependent regulation of the smooth muscle calponin gene. J Biol Chem. 2000;275:9814–9822. [PubMed]
20. Feil S, Hofmann F, Feil R. SM22alpha modulates vascular smooth muscle cell phenotype during atherogenesis. Circ Res. 2004;94:863–865. [PubMed]
21. Gan L, Wang SW, Huang Z, Klein WH. POU domain factor Brn-3b is essential for retinal ganglion cell differentiation and survival but not for initial cell fate specification. Dev Biol. 1999;210:469–480. [PubMed]
22. Harvey RP. Patterning the vertebrate heart. Nat Rev Genet. 2002;3:544–556. [PubMed]
23. Harvey RP, Meilhac SM, Buckingham ME. Landmarks and lineages in the developing heart. Circ Res. 2009;104:1235–1237. [PubMed]
24. Buckingham M, Meilhac S, Zaffran S. Building the mammalian heart from two sources of myocardial cells. Nat Rev Genet. 2005;6:826–835. [PubMed]
25. Xu R, Ho YS, Ritchie RP, Li L. Human SM22 alpha BAC encompasses regulatory sequences for expression in vascular and visceral smooth muscles at fetal and adult stages. Am J Physiol Heart Circ Physiol. 2003;284:H1398–1407. [PubMed]
26. Kuhbandner S, Brummer S, Metzger D, Chambon P, Hofmann F, Feil R. Temporally controlled somatic mutagenesis in smooth muscle. Genesis. 2000;28:15–22. [PubMed]
27. Kawai-Kowase K, Owens GK. Multiple repressor pathways contribute to phenotypic switching of vascular smooth muscle cells. Am J Physiol Cell Physiol. 2007;292:C59–69. [PubMed]
28. Hendrix JA, Wamhoff BR, McDonald OG, Sinha S, Yoshida T, Owens GK. 5' CArG degeneracy in smooth muscle alpha-actin is required for injury-induced gene suppression in vivo. J Clin Invest. 2005;115:418–427. [PMC free article] [PubMed]
29. Gunst SJ, Zhang W. Actin cytoskeletal dynamics in smooth muscle: a new paradigm for the regulation of smooth muscle contraction. Am J Physiol Cell Physiol. 2008;295:C576–587. [PubMed]
30. Tang DD, Anfinogenova Y. Physiologic properties and regulation of the actin cytoskeleton in vascular smooth muscle. J Cardiovasc Pharmacol Ther. 2008;13:130–140. [PMC free article] [PubMed]
31. Zhang JC, Helmke BP, Shum A, Du K, Yu WW, Lu MM, Davies PF, Parmacek MS. SM22beta encodes a lineage-restricted cytoskeletal protein with a unique developmentally regulated pattern of expression. Mech Dev. 2002;115:161–166. [PubMed]
32. Je HD, Sohn UD. SM22alpha is required for agonist-induced regulation of contractility: evidence from SM22alpha knockout mice. Mol Cells. 2007;23:175–181. [PubMed]
33. Zeidan A, Sward K, Nordstrom I, Ekblad E, Zhang JC, Parmacek MS, Hellstrand P. Ablation of SM22alpha decreases contractility and actin contents of mouse vascular smooth muscle. FEBS Lett. 2004;562:141–146. [PubMed]
34. Assinder SJ, Stanton JA, Prasad PD. Transgelan actin-binding protein and tumour suppressor. Int J Biochem Cell Biol. 2009;41:482–486. [PubMed]
35. Shanahan CM, Cary NR, Metcalfe JC, Weissberg PL. High expression of genes for calcification-regulating proteins in human atherosclerotic plaques. J Clin Invest. 1994;93:2393–2402. [PMC free article] [PubMed]

Articles from International Journal of Physiology, Pathophysiology and Pharmacology are provided here courtesy of e-Century Publishing Corporation