PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC 2010 September 30.
Published in final edited form as:
PMCID: PMC2858456
NIHMSID: NIHMS192799

Role of G-proteins in odor-sensing and CO2–sensing neurons in Drosophila

Abstract

A central question in insect chemoreception is whether signaling occurs via G-proteins. Two families of seven-transmembrane-domain chemoreceptors, the Or and Gr receptor families, have been identified in Drosophila (Clyne et al., 1999; Vosshall et al., 1999; Clyne et al., 2000). Or receptors mediate odor responses while two Gr receptors, Gr21a and Gr63a, mediate CO2 response (Hallem et al., 2004; Jones et al., 2007; Kwon et al., 2007). Using single-sensillum recordings, we systematically investigate the role of Gα proteins in vivo, initially with RNAi constructs, competitive peptides, and constitutively active Gα proteins. The results do not support a role for Gα proteins in odor sensitivity. In parallel experiments, manipulations of Gαq, but not other Gα proteins, affected CO2 response. Transient, conditional, and ectopic expression analyses consistently supported a role for Gαq in the response of CO2-sensing neurons, but not odor-sensing neurons. Genetic mosaic analysis confirmed that odor responses are normal in the absence of Gαq. Gγ30A is also required for normal CO2 response. The simplest interpretation of these results is that Gαq and Gγ30A play a role in the response of CO2-sensing neurons, but are not required for Or-mediated odor signaling.

Keywords: Olfactory, Drosophila, Transduction, Receptor, GPCR, signal transduction

Introduction

The role of G-proteins is a fundamental issue in insect chemosensory signaling. Chemoreception in vertebrates and C. elegans utilizes seven-transmembrane-domain receptors that signal via G-proteins. Insects also have large families of Or (Odor receptor) and Gr (Gustatory receptor) proteins that are predicted to contain seven transmembrane domains; however, Or and Gr proteins lack sequence similarity to G-protein-coupled receptors (GPCRs), and the topology of Ors differs from that of GPCRs (Neuhaus et al., 2005; Benton et al., 2006; Lundin et al., 2007).

The role of G-proteins in chemosensory signaling has been examined in Drosophila, but a clear consensus has not been reached. Studies suggest that Gαs and Gγ1 play a role in the response of Gr5a-expressing taste neurons (Ishimoto et al., 2005; Ueno et al., 2006). The requirement for G-proteins in olfaction is unclear. Two recent studies found that an Or receptor and a ubiquitously expressed co-receptor, Or83b, form a ligand-gated ion channel (Sato et al., 2008; Wicher et al., 2008). However, the studies proposed different mechanisms for activation of the channel complex. One study found that G-protein-mediated signaling plays a negligible role in receptor activation (Sato et al., 2008), whereas the other found that the Or receptor complex is activated by cyclic-nucleotides and acts as a GPCR (Wicher et al., 2008). Other studies have reported that olfactory receptor neurons (ORNs) require G-proteins: mutations in Gαq were found to reduce the sensitivity of antennal neurons to several odors (Kain et al., 2008), and expression of Gαq RNAi in ORNs led to decreased odor-evoked behavioral responses (Kalidas and Smith, 2002).

While most antennal ORNs express Or receptors, which mediate responses to odors, one class of ORNs in the antenna expresses two Gr receptors that mediate a response to CO2 (Jones et al., 2007; Kwon et al., 2007). Many insect species have a similar class of ORNs dedicated to CO2 sensation (Grant et al., 1995; Lu et al., 2007; Syed and Leal, 2007). However, the mechanism of CO2 transduction in insects is unknown.

In this study we investigate whether G-proteins are required for either Or- or Gr-mediated responses in the antenna. We disrupted signaling of each Drosophila Gα and Gγ protein individually in vivo, via several independent means, and generated null clones of Gαq, Gαo and Gαs. We also investigated the subunits. We found that individually disrupting each and had little or no effect on the Or-mediated responses tested. However, disruption of Gαq or Gγ30A decreased the Gr-mediated CO2 response. Using mosaic analysis, conditional and ectopic expression analyses, and transient expression of constitutively active Gα proteins, we show that Gαq is necessary for both the development and function of the CO2-sensing neuron. Our results support a model in which Gαq and Gγ30A play a role in CO2 response but are not required for Or-mediated olfactory transduction.

Materials and Methods

Drosophila stocks and transgenes

To generate DGαq-GAL4, 5.1 kb of DNA upstream of the ATG of Gαq-3 was inserted into the pGAL4 vector. The primers used were 5′-AGCGACAAACTGGGGAACAACTG and 5′-GCTAACTAGATTTATAGACGCTTTCGCGTG. To generate the UAS-Gα peptide constructs, PAGE-purified, phosphorylated complementary primers were annealed and cloned into a UAS expression vector. Each peptide consists of a start codon, a glycine, which has been shown to stabilize the peptide (Gilchrist et al., 2002), and the last eleven amino acids of the specified Gα. Primer sequences were: 5′-AATTCATGGGACTGCAATCGAACCTTAAGGAATATAATTTGGTCTAAGC and 5′-GGCCGCTTAGACCAAATTATATTCCTTAAGGTTCGATTGCAGTCCCATG (Gαq); 5′-AATTCATGGGACAAAGGATGCACCTTCGTCAATATGAATTGTTATAGGC and 5′-GGCCGCCTATAACAATTCATATTGACGAAGGTGCATCCTTTGTCCCATG (Gαs); 5′-AATTCATGGGACTCTCGGAGAACGTGTCCAGCATGGGCCTATTCTAGGC and 5′-GGCCGCCTAGAATAGGCCCATGCTGGACACGTTCTCCGAGAGTCCCATG (Gα73B); 5′-AATTCATGGGAATAGCAAACAACCTGCGCGGCTGTGGACTGTACTAAGC and 5′-GGCCGCTTAGTACAGTCCACAGCCGCGCAGGTTGTTTGCTATTCCCATG (Gαo); 5′-AATTCATGGGAATCAAGAACAATCTGAAACAAATTGGCTTATTCTGAGC and 5′-GGCCGCTCAGAATAAGCCAATTTGTTTCAGATTGTTCTTGATTCCCATG (Gαi); 5′-AATTCATGGGAGTGATTAATATCTCTCTAAACCGGAACTGGATATAAGC and 5′-GGCCGCTTATATCCAGTTCCGGTTTAGAGAGATATTAATCACTCCCATG (Gαq scrambled).

Gr21a-mCD8-GFP was from Barry Dickson (Research Institute of Molecular Pathology, Vienna, Austria). UAS-DGαs RNAi was from Michael Forte (Vollum Institute, Portland, OR). Gαq221C, UAS-Gαq1F1 RNAi, UAS-Gαq, UAS-GαqGTP, and Gαq-GAL4 were from Gaiti Hasan (Tata Institute of Fundamental Research, Bangalore, India). UAS-GαiGTP was from Fumio Matsuzaki (RIKEN, Kobe, Japan). norpA24 was from William Pak (Purdue University, West Lafayette, IN). Gr21a-GAL4 was from Kristin Scott (University of California, Berkeley, Berkeley, CA). Or83b-GAL4 and UAS-Gαq RNAi were from Dean P. Smith (University of Texas Southwestern, Dallas, TX). P{GawB}NP1535 precise excision was from Teiichi Tanimura (Kyushu University, Fukuoka, Japan). UAS-GαoGTP, Gαo007, and UAS-ptx were from Andrew Tomlinson (Columbia University, New York, NY). concertinaRC10 was from Eric Wieschaus (Princeton University, Princeton, NJ). Gαq1 and inaD were from Charles Zuker (University of California, San Diego, La Jolla, CA). The UAS-Gαo RNAi, UAS-Gα73B RNAi, UAS-Gαs RNAi, UAS-Gγ30A RNAi and UAS-Gγ1 RNAi lines were obtained from the National Institute of Genetics Fly Stock Center (Shizuoka, Japan). UAS-Gαs, UAS-GαsGTP, yw; PNP1535/CyO and yw; P{GawB}NP6216/CyO were obtained from the Drosophila Genetic Resource Center (Kyoto, Japan). Gβ76C1, tub-GAL80ts, ey-FLP, FRT 42B, GαsR60, FRT 42B, tubP-GAL80/Cyo, FRT 42D, tubP-GAL80/Cyo, UAS-DsRed, UAS-GFP, PBac{RB}Ggamma30Ae00834, hs-GAL4, GαsR60 and Df(2L)ED678/Cyo were obtained from the Bloomington Drosophila Stock Center (Bloomington, IN). Or22a-GAL4, UAS-Gr63a, UAS-Gr21a and Δhalo, in which Or22a and Or22b are deleted, were previously described (Dobritsa et al., 2003; Kwon et al., 2007).

Isolation of a Gαq mutant

The Gαq28 deletion line was generated by P-element excision of the yw; P{GawB}NP6216/CyO strain, which carries the P{GawB} insertion element in the 5′ UTR of Gαq. The P-element was mobilized using Δ2–3. ~400 w flies were screened by PCR for deletions in the Gαq coding region. Only one mutant, Gαq28, had a deletion that extended into the coding region. The mutation was mapped and confirmed by single-egg PCR analysis using the following primers: 5′-GCTGAACTGCCAGGAA ATCCG and 5′-TTTAAATCTACAAACATTCGCAGT.

Electrophysiology

All single-unit recordings were performed as described previously (de Bruyne et al., 2001). All recordings were from female antennal sensilla with the exception of the MARCM and empty neuron experiment recordings, which were from males and females. Age- and gender-matched flies were used for the control recordings. All flies tested had constructs that were either injected or backcrossed into w1118 flies, ensuring a similar genetic background. Flies expressing the appropriate GAL4 construct alone were used as the control in all experiments except for the ab1C peptide experiments. peptide constructs were injected into a wild-type strain that appears to have a low CO2 response. Therefore, flies carrying the UAS-Gα peptide alone were used as the control in these experiments. Methyl butyrate, ethyl acetate and butyric acid were obtained from Sigma (St. Louis, MO). Methyl butyrate and ethyl acetate were dissolved in paraffin oil while butyric acid was dissolved in water. A 500 ms pulse of odorant was puffed into a continuous air stream which was directed at the antenna. CO2 recordings were performed essentially as described previously (Kwon et al., 2007). Briefly, a 25 ml/s air stream was replaced for 500 ms by a 25 ml/s flow of 0.1%, 0.5%, 1%, 2%, 5%, or 20% CO2 dissolved in N2 (Airgas, Cheshire, CT). The firing rate for both olfactory and CO2 recordings were calculated by counting the number of spikes fired during the 500 ms stimulus period and multiplying by two. Neither background nor control pulse firing rates were subtracted. Statistical analysis of the methyl butyrate and butyric acid responses was performed using two-tailed Student’s t-test.

Immunohistochemistry

w; Gq-GAL4/Gr21a-mCD8-GFP; UAS-DsRed and w; DGq-GAL4/Gr21a-mCD8-GFP; UAS-DsRed flies were used to localize Gαq. Sixteen micrometer sections of the antenna were fixed in 4% paraformaldehyde, washed extensively in PBS + 0.3% Triton-X (PBS-T) and fixed in PBS-T + 5% normal goat serum. The primary antibodies used were anti-DsRed (1:200, catalog no. 632496, Clontech, Mountain View, CA) and anti-GFP (1:200, catalog no. 11814460001, Roche, Indianapolis, IN). Secondary antibodies used were anti-rabbit IgG conjugated to Alexa-Fluor 568 (1:250, A10042, Invitrogen, Carlsbad, CA) and anti-rabbit IgG conjugated to Alexa-Fluor 488 (1:500, A11001, Invitrogen, Carlsbad, CA). Samples were mounted in Vectashield (Vector Laboratories, Burlingame, CA) and viewed on a Bio-Rad MRC 1024 confocal microscope.

Generation of null clones

Gαq, Gαo, and Gαs null clones were generated using the MARCM system (Lee and Luo, 2001). ey-FLP was used to generate clones in the antenna (Hummel et al., 2003). The Gr21a-GAL4 reporter was used to identify clones including a CO2 neuron while the Or22a-GAL4 reporter was used to identify clones including an ab3A neuron. The control recordings in the MARCM experiments were taken from GFP neurons on the same antennae as the GFP+ neurons, as a precaution against genetic background and age effects.

Flies of the following genotypes were tested:

  1. w; FRT 42B, Gαq28/FRT 42B, tubP-GAL80; X-GAL4, UAS-GFP/ey-FLP (Gαq);
  2. w; FRT 42D, GαsR60/FRT 42D, tubP-GAL80; X- GAL4, UAS-GFP/ey-FLP (Gαs);
  3. w; FRT 42D, Gαo007/FRT 42D, tubP-GAL80; X- GAL4, UAS-GFP/ey-FLP (Gαo);
  4. w; FRT 42B/FRT 42B, tubP-GAL80; X-GAL4, UAS-GFP/ey-FLP (control).

Flies of the following genotype were used for the Gαs rescue experiment: UAS-Gαs; FRT 42D, GαsR60/FRT 42D, tubP-GAL80; X-GAL4, UAS-GFP/ey-FLP. These flies express Gαs only in ab1C or ab3A that are genotypically null for Gαs. Using MARCM, we were able to reliably produce Gαq−/− ab3A, Gαs−/− ab3A, and Gαs−/−ab1C, at frequencies of approximately 5 GFP+ neurons/antenna. However, despite using two different Gαq deletion alleles, Gαq221C and Gαq28, in combination with each of two different markers of ab1C neurons, Gr21a-GAL4 and Gr63a-GAL4, few if any GFP+ ab1C were generated. In two cases we observed no GFP+ ab1C, in the third case we found a single GFP+ ab1C in 74 antennae examined, and in the fourth case we observed a very low frequency of GFP+ ab1C. Furthermore, the few GFP+ ab1C neurons generated do not resemble any of the GFP+ cells in the other experiments. These labeled ab1C have much weaker GFP fluorescence, and the fluorescence could often be observed only in the cell body. Due to their low frequency and very weak GFP fluorescence, we are not confident that these GFP+ ab1C are Gαq−/−.

Spatiotemporal expression of Gαq inhibitors

TARGET was used to express UAS-GαqGTP or UAS-Gαq1F1 RNAi selectively in adult flies (McGuire et al., 2003). w; UAS-X; Gr21a-GAL4, tub-GAL80ts flies were raised at 18°C and transferred to 29°C one day post-eclosion. Genetically identical, age-matched flies which were maintained at 18°C rather than transferred to 29°C were used as the control. As a further guard against leaky GαqGTP or Gαq1F1 RNAi expression, we examined the antennae of 20d old adult w; UAS-GFP; Gr21a-GAL4, tub-GAL80ts flies raised and maintained at 18°C. These flies did not show any GFP activity, confirming that tub-GAL80ts suppresses Gr21a-GAL4 at the permissive temperature (not shown). Finally, we compared the responses of Gr21a-GAL4 flies that carried a UAS construct to those of controls that did not carry a UAS construct. Flies that do not have the UAS construct had similar CO2 responses to the control flies that were not heat shocked.

hs-GAL4 and UAS-GαqGTP or UAS-GαsGTP were used to transiently express GαqGTP or GαsGTP in adult flies. 7 day old adult flies reared at 18°C were heat shocked for 30 minutes at 37°C and allowed to recover for 1 hour at 25°C. Siblings that were placed at 25°C for 1.5 hours were used as controls.

Statistical Analysis

Each ORN is tested with multiple concentrations of each ligand. Therefore, we compared the responses from different genotypes using a two-way ANOVA with repeated measures in one factor followed by a Holm-Sidak post hoc test to compare individual concentrations. The between group factor is the genotype of the fly and the repeated measure is the concentration of the ligand. Two-tailed t-tests were used to compare the spontaneous firing rates of neurons.

RESULTS

Knock-down of Gαq reduces CO2 response but not odor response

As a first step towards testing the role of G-proteins in olfactory responses we identified the genes that are expressed in the antenna. The Drosophila genome contains eight genes. We found evidence for antennal expression of six of them, concertina, Gαq, Gαs, Gα73B, Gαo, and Gαi, by RT-PCR analysis of adult antennal RNA (not shown).

Drosophila antennae contain three functional types of large antennal basiconic (ab) sensilla, ab1, ab2 and ab3 (Fig. 1a,b). ab2 contains two ORNs, ab2A and ab2B, and ab3 contains ab3A and ab3B (de Bruyne et al., 2001). The odor response of each of these neurons is mediated by an Or receptor unique to that ORN and Or83b, a broadly expressed co-receptor (Hallem et al., 2004; Larsson et al., 2004). ab1 contains four ORNs. Three of the neurons, ab1A, ab1B and ab1D, have odor responses that are also mediated by a unique Or receptor and Or83b. The other neuron, ab1C, responds uniquely to CO2. This neuron does not express Or83b; instead the CO2 response is mediated by two Grs, Gr21a and Gr63a (Jones et al., 2007; Kwon et al., 2007).

Figure 1
Experimental systems. (a) Drosophila head. Arrowhead indicates antenna. (b) Schematic of antenna. Different colored dots represent different functional types of basiconic sensilla. (c) Disruption of G proteins in the endogenous CO2 neuron. (d) Heterologous ...

To investigate the roles of the six Gα proteins in olfactory and CO2 transduction in the antenna, we focused on responses from three Or-expressing ORNs, ab1A, ab2A and ab3A, and the Gr-expressing ORN, ab1C (Fig 1b). To test whether disruption of Gα affects the function of the ORNs, we carried out extracellular electrophysiological recordings (Clyne et al., 1997; de Bruyne et al., 2001) that allowed us to measure the response of a single ORN to either odors or CO2. Among the six genes expressed in the antenna, a homozygous viable mutant was available for one, concertina. We tested this mutant by electrophysiological recording and found that ab1A, ab2A, ab3A and ab1C responded normally to broad concentrations of odorants and CO2 (n = 6; P > 0.5 for each neuron class tested, not shown). Therefore, concertina was not investigated further.

We then performed genetic manipulations that resulted in either loss-of-function or gain-of-function to investigate the roles of the five remaining genes. We used either Or83b-GAL4 (Kalidas and Smith, 2002) or Gr21a-GAL4 (Scott et al., 2001) to drive expression of RNAi constructs or competitive peptides (loss-of-function), or constitutively active Gα proteins (gain-of-function) (Fig. 1c). Since Or83b-GAL4 is expressed exclusively in Or-expressing ORNs and Gr21a-GAL4 is expressed solely in ab1C, we could ask whether the different Gα proteins function in ORNs as opposed to other cell types.

First we examined the requirement of G-proteins in ORNs by knocking down Gα activity with available RNAi constructs. We found that RNAi against Gαq, Gαs, Gαo, and Gα73B did not reduce the odor responses of ab1A, ab2A or ab3A (Fig. 2a). Our results might seem to contradict a previous report showing that flies expressing this Gαq RNAi construct had decreased behavioral responses to odors (Kalidas and Smith, 2002). One possible explanation is that Gαq is required for behavioral response in a process that occurs downstream of ligand recognition and transduction, perhaps by coupling to other GPCRs. For instance, recent studies have found that ORNs express GABAB receptors at the axon terminals and that expression of a Gαo inhibitor alters synaptic transmission between the ORN and second-order neurons (Olsen and Wilson, 2008; Root et al., 2008).

Figure 2
RNAi. (a) RNAi against Gαq, Gαs, Gαo and Gα73B did not decrease odor responses of ab1A, ab2A or ab3A (P > 0.05), ORNs whose responses are mediated by Or receptors(Dobritsa et al., 2003; Hallem et al., 2004; Larsson ...

A second report showed that a different Gαq RNAi construct, Gαq1F1, decreased the electrophysiological odor response of ab2A (Kain et al., 2008). We also tested Gαq1F1 RNAi using the same broad odorant concentration range used to test the previous Gαq RNAi construct and, consistent with our previous results, we did not observe a decrease in odor response in ab1A, ab2A or ab3A (n = 6; P > 0.1 for each neuron class, not shown). The discrepancy with the other study may be due to the use of different drivers: we used Or83b-GAL4 while the previous analysis of ab2A used Gαq-GAL4, which expresses in non-neuronal support cells as well as in ORNs (Talluri et al., 1995; Kain et al., 2008). Therefore, the reduction in olfactory sensitivity in the previous study could have been due to effects on cells other than ORNs.

In contrast, Gαq RNAi, but not other RNAi constructs, produced a major decrease in CO2 response (Fig. 1e, ,2b).2b). The CO2 response was significantly reduced across a wide response range (Fig. 2b). If this reduction in CO2 response is in fact due to an RNAi-mediated reduction in levels of Gαq, then overexpression of Gαq RNA should rescue the response. Indeed, overexpression of Gαq-3 RNA, the antennal Gαq splice variant (Talluri et al., 1995; Ratnaparkhi et al., 2002; Kain et al., 2008), restored the CO2 response in flies expressing Gαq RNAi (Fig. 2b). To test whether CO2 response depends specifically on the antennal Gαq splice variant, we tested flies with a missense mutation that only affects the other major Gαq splice variant, Gαq-1 (Scott et al., 1995) and found no defect in response to concentrations of CO2 ranging from 0.1% to 20% (n = 9; P > 0.1, not shown). We also tested the second Gαq RNAi construct, Gαq1F1, for its effects on CO2 response and obtained results similar to those with the first Gαq RNAi construct. Gαq1F1 RNAi decreased CO2 response across a wide concentration range; at concentrations greater than 0.1% there was a 25–30% decrease in CO2 response (n = 12; P < 0.001, not shown). Again, expression of Gαq-3 RNA rescued the defect (n = 9, not shown).

Recent studies have suggested that Gαs may have a role in chemosensory transduction (Wicher et al., 2008). Therefore, we tested an additional Gαs RNAi construct, DGαs RNAi, with the same broad concentration range of odorants. Expression of DGαs RNAi in Gr5a-expressing taste neurons reduced Gαs expression levels and reduced electrophysiological responses to sugar (Ueno et al., 2006). However, consistent with our results with the other Gαs RNAi construct, DGαs RNAi did not decrease the odor or CO2 responses of ab1A, ab2A, ab3A or ab1C (n = 6–12, not shown). Taken together, our RNAi data suggest that Gαq is required for CO2 response, while no Gα proteins are required for Or-mediated responses.

Competitive Gαq peptide reduces CO2 response but not odor response

As a complementary approach to RNAi, we next used competitive peptides to knock down Gα protein activity. Peptides consisting of the eleven C-terminal amino acids of a Gα protein have been shown to bind to GPCRs and compete with the endogenous Gα (Hamm et al., 1988; Gilchrist et al., 1999). Such peptides do not activate downstream signaling pathways and have been shown to decrease the receptor-mediated response to ligands in cell culture and in transgenic mice (Rasenick et al., 1994; Akhter et al., 1998).

We generated UAS lines that express the eleven C-terminal amino acids of Gαq, Gαs, Gαo, Gα73B and Gαi, and expressed each using Or83b-GAL4 or Gr21a-GAL4. Consistent with the RNAi results, none of the peptides affected the Or-mediated ab1A, ab2A and ab3A responses (n = 6; P > 0.05 for each neuron class, not shown). However, the Gαq peptide decreased ab1C response to concentrations of CO2 ranging from 0.5% to 20% (n = 24; P < 0.001, not shown). Also consistent with the RNAi results, Gαs, Gαo, Gα73B, and Gαi peptides did not affect the ab1C response to any of the five CO2 concentrations tested (n = 9–21; P > 0.05, not shown). As an additional control for the specificity of the Gαq peptide, we generated a scrambled Gαq peptide that has the same amino acid composition as the Gαq peptide, but in a random order. Flies expressing the Gαq scrambled peptide responded to CO2 at levels comparable to control flies at all concentrations tested (n = 15; P > 0.05, not shown).

Constitutively active Gαq reduces CO2 response

The previous two methods sought to knock down Gα protein signaling. We next used a gain-of-function manipulation: expression of a constitutively active form of a Gα protein, GαGTP. GαGTP proteins contain a single point mutation that renders them unable to hydrolyze GTP and therefore constitutively active (Bourne et al., 1991). If a certain Gα protein mediates olfactory or CO2 transduction, constitutive activation of the G-protein should mimic prolonged exposure to odors or CO2, resulting in ORN adaptation and subsequent decrease in sensitivity.

GαqGTP nearly abolished CO2 response at all tested doses (Fig. 3b). The decreased CO2 response is not due to cell death: ab1C expressing GαqGTP and GFP appear morphologically normal, as observed in confocal images (not shown). The severe reduction of CO2 sensitivity after long-term expression of GαqGTP is consistent with the notion that Gαq mediates CO2 transduction. Mutations in human rhodopsin that result in a constitutively active opsin protein lead to photoreceptor adaptation and loss of cell sensitivity (Jin et al., 2003). Constitutive activation of ab1C may result in a similar loss of CO2 sensitivity.

Figure 3
Constitutively active Gα proteins. (a) GαqGTP decreased the odor responses of ab1A, ab2A, and ab3A (P ≤ 0.01) whereas GαsGTP, GαoGTP, and GαiGTP did not (P > 0.05). (b) GαqGTP dramatically ...

The effect of GαqGTP is specific: expression of GαsGTP, GαoGTP, and GαiGTP did not affect CO2 response (Fig. 3b). Thus the finding that CO2 response is specifically affected by GαqGTP is in agreement with previous results.

Odor responses of ab1A, ab2A and ab3A were not reduced by expression of GαsGTP, GαoGTP or GαiGTP (Fig. 3a), consistent with our previous data. However, GαqGTP did reduce the odor responses of ab1A, ab2A and ab3A (Fig. 3a). Notably, the effect of GαqGTP on CO2 response is much more severe than on odor responses. To better understand the different effects of GαqGTP on the Or- and Gr-mediated responses in these long-term expression studies, we next examined how transient expression of GαqGTP affects the neurons.

Transient expression of GαqGTP increases the spontaneous firing of CO2-sensing neurons but not odor-sensing neurons

As shown above, long-term expression of GαqGTP resulted in decreased responses from both odor-sensitive and CO2–sensitive neurons (Fig. 3a,b). Based on our previous data, which showed that loss of Gαq function affected Gr- and Or-expressing neurons differently, long-term expression of GαqGTP may be decreasing the odor and CO2 responses via different mechanisms. For instance, GαqGTP could decrease responses by causing either adaptation or deterioration in health. To distinguish between these two possibilities and to investigate whether Grs or Ors signal through Gαq, we transiently expressed GαqGTP in adult flies using hs-GAL4 and tested the flies immediately. Non-heat-shocked siblings were used as controls. If Gαq mediates odor or CO2 responses, transient expression of GαqGTP should mimic constitutive receptor activation, even in the absence of a ligand. Consistent with this prediction, we found that transient expression of GαqGTP produced a three-fold increase in the spontaneous firing rate of ab1C (Fig. 4a,b). This effect is specific to ab1C: GαqGTP expression in ab3A does not affect its spontaneous firing rate (Fig. 4c,d). The effect is also specific to GαqGTP, as transient GαsGTP expression in neither ab1C nor ab3A affects its spontaneous firing rate (n = 12; P > 0.4 for each neuron class, not shown).

Figure 4
Transient expression of GαqGTP. (a) Traces of ab1C spontaneous firing from control flies and flies transiently expressing GαqGTP. Dots mark spikes from ab1C, which can be distinguished by their relative amplitudes; other spikes derive ...

The increase in spontaneous firing observed in ab1C is consistent with the direct involvement of Gαq in CO2 signaling. Conversely, short-term expression of GαqGTP in ab3A did not affect spontaneous firing. Consistent with our Gαq loss-of-function results, this result suggests that Gαq does not act directly in ab3A signaling. An indirect role, such as a role in neuronal maintenance, may thus account for the effect of long-term GαqGTP expression in ab1A, ab2A, and ab3A (Fig 3a). The finding that transient expression of GαqGTP increases the spontaneous firing of ab1C but not ab3A further suggests that Gαq is involved directly in CO2 signaling but not odor signaling.

Next we examined the odor and CO2 responses of ab3A and ab1C neurons that transiently express GαqGTP. Our results thus far suggest that long-term expression of GαqGTP decreases ab1C responses via adaptation of the neuron, whereas GαqGTP may affect the health of ab3A. If this interpretation is correct, we would predict that short-term expression of GαqGTP should affect their responses differently. In accordance with this prediction, ab3A neurons that transiently express GαqGTP have normal responses to odorant dilutions ranging from 10−8 to 10−2 (n = 9; P > 0.8, not shown). Conversely, ab1C neurons that transiently express GαqGTP have a reduced response to CO2 (n = 12; P < 0.001, not shown). Moreover, the reduction in CO2 response is much less pronounced than in flies that expressed GαqGTP for longer. In heat shocked flies, the response to 1% CO2 is reduced by 33% compared to 88% for long-term expression (Fig. 3b and not shown). The most likely explanation for these results is that the longer expression period of GαqGTP produces a greater degree of adaptation and results in a greater loss of sensitivity.

The results, taken together, are consistent with a model in which G-proteins act directly in Gr21a/Gr63a signaling but not in Or signaling.

Verification of Gαq expression in CO2-sensitive neurons

Above we used three independent means of altering levels of Gαq signaling in ab1C, and all three affected CO2 response. Others have shown that Gαq is expressed in a majority of ORNs, including the large basiconic ORNs tested in this study (Talluri et al., 1995; Kain et al., 2008). However, to confirm that ab1C expresses Gαq we carried out a double-label analysis. To visualize ab1C, we used a Gr21a-GFP direct fusion line (Couto et al., 2005) and observed GFP in a subset of large basiconic sensilla on the proximomedial region of the antenna, consistent with the location of ab1C neurons (de Bruyne et al., 2001).

To determine whether Gαq is expressed in these GFP-expressing cells, we first used an anti-Gαq antibody in a double-label experiment. However, the antibody showed a broad labeling pattern with a signal-to-noise ratio that was not sufficiently high for us to draw confident conclusions about colocalization. As a second means of determining whether the GFP-expressing ab1C cells express Gαq, we used two independently generated GAL4 lines driven by the Gαq promoter, Gαq-GAL4 (Kain et al., 2008) and DGαq-GAL4, which we generated. Flies carrying Gαq-GAL4; UAS-DsRed or DGαq-GAL4;UAS-DsRed both showed expression of DsRed in many cells broadly distributed across the antenna (not shown), as previously reported in Drosophila (Talluri et al., 1995; Ratnaparkhi et al., 2002; Kain et al., 2008), and consistent with results found with an Anopheles ortholog (Rutzler et al., 2006). Previous reports have shown that Gαq is expressed in a majority of ORNs as well as in non-neuronal support cells (Talluri et al., 1995; Kain et al., 2008). All GFP-positive cells were also positive for DsRed, indicating that all Gr21a-GFP-expressing neurons also express Gαq-GAL4 (not shown). Thus, these results support the conclusion that the CO2-sensing neurons express Gαq.

Analysis of odor and CO2 responses in Gαq, Gαs, and Gαo null clones

Next we examined ORNs that are null for Gα proteins. We examined Gαq, Gαs, and Gαo because these three genes have been identified in ORNs in many different species of insects (Talluri et al., 1995; Miura et al., 2005; Rutzler et al., 2006). Null alleles for Gαq (Banerjee et al., 2006), Gαs (Wolfgang et al., 2001) and Gαo (Katanaev et al., 2005) are homozygous lethal. Therefore, we used the mosaic analysis with a repressible cell marker (MARCM) system (Lee and Luo, 2001) to generate homozygous null mutant clones of these genes in the antenna. We used Gr21a-GAL4, UAS-GFP to identify mutant ab1C neurons and Or22a-GAL4, UAS-GFP to identify mutant ab3A neurons.

As a control for efficiency of recombination, we first generated clones in a wild-type background that contained no mutations of G-protein genes. We found that GFP+ ab3A and ab1C were generated consistently: 5.5±1.1 and 4.5±0.8 GFP+ neurons were detected per antenna, respectively (n=22 antennae and n=20 antennae), with ~80% of all antennae examined having at least one GFP+ neuron. This control experiment established criteria by which to evaluate the frequency and appearance of GFP+ cells mutant for G-protein genes.

We then generated null clones of Gαs. The frequencies at which GFP+ ab3A and ab1C were generated (7.0±1.2 neurons/antenna and 5.7±0.7 GFP+ neurons/antenna) were similar to the frequencies in the control experiment. Gαs−/− ab1C showed normal responses to CO2 in 6d old flies, consistent with our previous analyses showing that Gαs is not required for CO2 signaling (Fig. 5a). When older flies (~20d) were examined, a decrease in CO2 response was observed in Gαs−/− ab1C neurons at all concentrations tested, with a 33% decrease in response at 1% CO2 (n = 16–18; P < 0.001). Since the decrease was observed only in older flies, it may reflect a progressive deterioration of neuronal health, rather than a specific defect in the forward pathway of CO2 signaling. The simplest interpretation of these results is that Gαs is not required for CO2 signaling.

Figure 5
MARCM analysis. (a) Gαs−/− ab1C had normal CO2 responses (P = 0.19). (b,c) Gαs−/− ab3A had a decreased response to near saturating concentrations of methyl butyrate (b) and butyric acid (c) (P < ...

The absence of Gαs in ab3A did not affect its response to low concentrations of methyl butyrate (0.05% and lower) or butyric acid (1% and lower) (Fig. 5b,c). However, at near saturating concentrations of both odorants tested, there was a small (≤17.0%) decrease in the odor response regardless of the age of the fly. These abnormalities were rescued by driving a copy of the Gαs gene specifically in ab3A, suggesting that the role of Gαs is cell-autonomous (Fig. 5d,e). Thus Gαs may contribute to ab3A odor responses but its contribution is very modest.

For Gαq, we generated a null allele, Gαq28. This allele was isolated by imprecise excision of a P-element in the 5′ UTR of Gαq-3. Gαq28 contains a 5428 bp deletion that removes the first eight exons of Gαq-3. Gαq28 yielded GFP+ ab3A at a frequency similar to that of the control experiment (5.3±1.3 versus 5.5±1.1 GFP+ neurons/antenna; n=14 and n=22 antennae, respectively). Consistent with our previous results, the absence of Gαq in ab3A did not affect olfactory responses to the two odors tested (Fig. 5f,g). A previous report showed that mosaic analysis with another Gαq null allele, Gαq221C, resulted in decreased electroantennogram (EAG) responses, which represent a decrease in the summed receptor potentials of populations of antennal neurons (Kain et al., 2008). To address this discrepancy, we tested the null allele used in this report (Gαq221C), and obtained results indistinguishable from those with Gαq28 both in terms of the frequency of clones generated and the phenotype of the Gαq221C clones (Fig. 5h,i). Taken together, the simplest interpretation of our results is that Gαq is not required for olfactory transduction in ab3A.

Efforts to produce Gαq−/− ab1C yielded very different results from those designed to produce Gαq−/− ab3A or control clones with marked ab1C neurons. First, GFP+ ab1C were either not generated or generated at a very low frequency in the Gαq MARCM experiments (see Materials and Methods). Despite using two different Gαq deletion alleles, Gαq28 and Gαq221C, and two different markers of ab1C neurons, Gr21a-GAL4 and Gr63a-GAL4, few if any GFP+ ab1C were generated, implicating a crucial role for Gαq in ab1C development and/or survival.

No Gαo−/− ab1C or ab3A neurons were identified. This is consistent with findings by others that Gαo is required for asymmetrical cell division and nervous system development (Katanaev et al., 2005; Katanaev and Tomlinson, 2006).

In summary, Gαs−/− ab1C had normal responses to CO2, Gαs−/− ab3A had small reductions in odor response, Gαq−/− ab3A were normal in response to two odorants tested, and efforts to determine the physiological effect of a complete loss of Gαq function in ab1C were inconclusive. The simplest interpretation of the repeated difficulty in obtaining Gαq−/− ab1C is that Gαq, like Gαo, plays a major role in ab1C development or survival.

PTX, an inhibitor of Gαo, does not affect CO2 or odor responses

The mosaic analysis described above supports a role for Gαo in olfactory system development. To test the possibility of a role for Gαo in ORN function we analyzed the effect of pertussis toxin (PTX) on odor and CO2 response. PTX is a selective inhibitor of Gαo, since Gαo is the only G-protein in Drosophila that contains the PTX recognition site (Ferris et al., 2006). We found that expression of ptx in ab1A, ab2A, ab3A and ab1C did not affect odor or CO2 responses across the broad concentration range tested (n = 6; P > 0.2 for each neuron class, not shown).

These results argue against a role for Gαo in the physiology of odor or CO2 signaling, consistent with our results from experiments with RNAi, competitive peptide, and GαoGTP.

Disruption of Gαq signaling in adults decreases CO2 response

Our results thus far suggest that while Gαq is not required for Or-mediated responses, it is required for the Gr-mediated CO2 response. To test whether Gαq plays a role in the physiology of the CO2 neuron, as opposed to an exclusively developmental role, we used the temporal and regional gene expression targeting (TARGET) system (McGuire et al., 2003). TARGET allows us to interfere with Gαq signaling selectively in adult flies: thus, expression of Gαq1F1 RNAi or GαqGTP in ab1C is repressed during development and expressed only after eclosion.

Expression of Gαq1F1 RNAi or GαqGTP selectively in adulthood was sufficient to decrease CO2 response (n=9–15; P < 0.001). In fact, for both constructs, a 30–83% decrease in response was observed at all CO2 concentrations tested, which ranged from 0.1% to 5%). The level of reduction observed in these flies was similar to that observed when the constructs were expressed with Gr21a-GAL4 alone (Fig. 3b and not shown). This similarity is not surprising given that the Gr21a-GAL4 driver is likely expressed late in development: although the developmental timecourse of Gr21a expression is unknown, Or genes in the antenna are first detected during the late pupal stage (Clyne et al., 1999; Elmore and Smith, 2001; Larsson et al., 2004).

Gαq increases CO2 response but not odor response in an in vivo expression system

Co-expression of Gr21a and Gr63a in an in vivo expression system, the “empty neuron system” (Dobritsa et al., 2003), conferred a CO2 response to ab3A, which normally does not respond to CO2 (Fig. 1d) (Kwon et al., 2007). However, the response was modest compared to the endogenous ab1C response, perhaps due to limiting quantities of another component in ab3A essential for a full CO2 response. We co-expressed Gαq and found that it dramatically increased the CO2 response (Fig. 6). The response increased by a factor of five, to a level comparable to that of the endogenous neuron, at 0.1%, 0.5% and 1% CO2 (n = 17–21; P > 0.1, not shown). This effect is specific to Gαq: co-expression of Gαs with Gr21a and Gr63a did not increase the CO2 response (Fig. 6). The effect of Gαq is also specific to the CO2 response: as a control, we expressed Gαq in wild-type ab3A neurons and found that overexpression of Gαq did not increase responses to a broad concentration range of the two odorants tested, arguing against the possibility that Gαq overexpression causes a general increase in ab3A excitability (n = 12; P > 0.05, not shown).

Figure 6
Ectopic expression of the CO2 receptors in the empty neuron. (a) Sample traces of responses to 5% CO2 from neurons expressing Gr21a and Gr63a alone or with Gαq or Gαs. Bar indicates 500 ms pulse of 5% CO2. (b) Co-expression of Gαq ...

Gγ30A is also required for CO2 response

Our data support a role for Gαq in CO2 response in ab1C. In Drosophila phototransduction, Gγ30A is the binding partner of Gαq-1 (Schulz et al., 1999). Given that Gγ30A RNA was also detected using RT-PCR from adult antennal RNA (not shown), we wondered whether Gγ30A is also the binding partner of Gαq in ab1C.

In functional tests we found that Gγ30A RNAi decreased CO2 response (Fig. 7a). Consistent with this result, flies homozygous for a 6 kb insertion in Gγ30A have a reduced CO2 response (Fig. 7a). Flies with one copy of the insertion in heterozygous combination with a deletion spanning the Gγ30A gene region had a response to CO2 that was even further reduced (Fig. 7a). In contrast, most Or-mediated responses appeared normal in flies with this insertion (Fig. 7b). ab1A had a slight decrease in odor response. However, the effect is modest relative to the decrease in CO2 response.

Figure 7
. (a) RNAi against Gγ30A decreased the CO2 response (P < 0.001). Flies homozygous for an insertion in Gγ30A had a decreased CO2 response relative to heterozygotes used as a control for the genetic background (P < ...

There is only one other gene in the Drosophila genome, Gγ1. Gγ1 RNA was also detected using RT-PCR from adult antennal RNA (not shown). Gγ1 has been found to play a role in sugar-sensing by Gr5a-expressing gustatory neurons in the labellum (Ishimoto et al., 2005). A Gγ1 RNAi construct (Ishimoto et al., 2005) that decreased responses of gustatory neurons to sugar did not affect the CO2 response (Fig. 7a). An insertion in the 5′ UTR of Gγ1, which decreases Gγ1 expression by ~90% (Ishimoto et al., 2005), also did not affect CO2 response (Fig. 7a) or the odor responses of ab1A, ab2A or ab3A (Fig. 7b).

In summary, these results suggest that Gγ30A is required along with Gαq in the response of ab1C to CO2. The results also suggest that Or-mediated odor responses do not require Gγ30A or Gγ1.

Other visual transduction genes are not required for CO2 response

The involvement of Gαq and Gγ30A in both vision and CO2 sensing suggested that these two processes might share other signaling elements. We tested the phototransduction mutants Gβ76C (Gβ), inaD (a scaffolding protein) and norpA (phospholipase C). Null mutant flies of each of these three genes had normal responses to CO2 (not shown). This finding raises the possibility that while CO2 response requires Gαq and Gγ30A, these G-proteins may not signal through canonical G-protein-signaling pathways. A recent study proposed that Ors are both GPCRs and ligand-gated ion channels and that G-protein activation results in current through the Or channel (Wicher et al., 2008). Our data suggest that Gαq plays a direct role in CO2 signaling. However, we cannot determine whether Gαq activates conventional downstream signaling components or if it acts on a channel formed from Gr21a and Gr63a.

Discussion

Recent studies in heterologous systems have provided evidence that insect odor receptors can act as ligand-gated ion channels (Sato et al., 2008; Wicher et al., 2008). Canonical members of the Or family form a complex with the co-receptor Or83b (Larsson et al., 2004; Neuhaus et al., 2005; Benton et al., 2006), and the heteromeric receptor appears to play a direct role in olfactory signaling as an ion channel. Conversely, for Grs, there is evidence that taste neurons expressing Gr5a require G-proteins (Ishimoto et al., 2005; Ueno et al., 2006). These findings have raised an intriguing question: to what extent does signaling by the Or-Gr superfamily of insect chemoreceptors differ from that of chemoreceptors in vertebrates and C. elegans? Odor and taste receptors in these organisms are believed to signal directly through G-proteins. We have systematically examined the G-proteins of Drosophila using both loss-of-function and gain-of-function experiments for roles in chemosensory response. All experiments in this study were carried out in vivo, in Drosophila ORNs, as opposed to in heterologous systems.

We found that disruption, knock-down, or even complete elimination of G-proteins had little or no effect on Or-mediated signaling in vivo. Our results indicate that CO2 response, mediated by two Gr receptors, requires Gαq and Gγ30A. Further investigation using constitutively active Gαq, mosaic analysis and conditional expression showed that Gαq is required for both the survival and function of ab1C.

Reduction of G-protein function has little or no effect on Or-mediated odor response

Recent studies have proposed conflicting models for Or signaling. One study suggested in particular that Gαq is required by ab2A for full sensitivity to low concentrations of odors (Kain et al., 2008). However, the study used a pan-neuronal driver to mark Gαq−/− cells and examined a narrow response range. Using ORN class-specific GAL4 drivers and examining a broad response range of odor concentrations we tested three ORN classes, including ab2A, that had been manipulated in multiple ways to cause a loss of Gα function. We found that knock-down of Gαq in ab1A, ab2A and ab3A did not decrease odor responses. Most strikingly, ab3A neurons that were genotypically Gαq−/−, as determined with an ab3A-specific driver, showed a normal response across a broad response range for the odors tested. Thus, our findings do not support the model that Gαq is required for Or signaling.

A second recent study proposed that Or83b can act as a cyclic-nucleotide gated ion channel that depends on Gαs (Wicher et al., 2008). Our results suggest that Gαs is not required for the primary response to odors. Gαs−/− ab3A has a decreased response to higher concentrations of odors; however, this effect is modest and suggests that the primary pathway of olfactory transduction in ab3A neurons does not require Gαs.

The third study proposed that the Or-Or83b complex is a ligand-gated ion channel whose activation does not require G-proteins (Sato et al., 2008). Our results support this proposition that G-proteins are not required for primary Or signaling. A dual activation model was recently proposed to reconcile the different models of Or signaling (Nakagawa and Vosshall, 2009). In this model, Or activation results in a primary ionotropic response as well as a slow metabotropic component that modulates the Or complex. Our results could be interpreted to support this model, with the Gαs pathway potentiating the main response. However, we note that manipulation of Gαs signaling with RNAi, competitive peptides, and GαsGTP had no effect on the response of ab1A, ab2A or ab3A. Deletion of the Gαs gene produced at most a 17.1% reduction in response. Furthermore, the decreased response was only seen at the highest odor concentrations, at which the ORN is near or at its maximum response rate for the given odor. If the role of Gαs were to potentiate receptor function, one might expect that it would boost low signals or signals across multiple concentrations, rather than only at the highest concentrations.

Gr-mediated CO2 response requires G-proteins

In contrast to our results with Ors, we found that multiple, complementary approaches consistently revealed a role for G-proteins – Gαq and Gγ30A – in Gr-mediated CO2 response. Knock-down of Gαq via various genetic manipulations all resulted in reduced CO2 response in ab1C. One might hypothesize that Gαq plays an indirect role, such as in neuronal maintenance or in modulation of the response. However, this hypothesis is difficult to reconcile with the finding that transient expression of GαqGTP increases the spontaneous firing rate of ab1C. The simplest interpretation of the transient expression analysis is that Gαq plays a direct role in CO2 signaling, although the mechanism by which it acts is not revealed by our analysis.

Different requirements for G-proteins in different chemosensory neurons

Signaling in ab1C differs from that in ab1A, ab2A and ab3A in its requirements for G-proteins. This difference is consistent with other differences between ab1C and the other ORNs. ab1C expresses Gr members of the Or-Gr insect chemoreceptor superfamily, whereas most other ORNs express Or members. ab1A, ab2A and ab3A express the co-receptor Or83b; ab1C does not express Or83b, and a Gr gene analogous to Or83b has not been identified. Or83b-expressing ORNs have GABAB receptors, which signal through Gαo, at their axon terminals, thereby allowing for inhibitory modulation of synaptic transmission (Olsen and Wilson, 2008; Root et al., 2008). ab1C does not express GABAB receptors and does not exhibit presynaptic inhibition (Root et al., 2008).

Different ORNs also differ in their developmental requirements for G-proteins. We found that Gαq plays a role in the development of ab1C but not ab3A. These results are consistent with differences in morphology between ab1C and the other ORNs tested (Shanbhag et al., 1999). Moreover, a microRNA, miR-279, and its target, Nerfin-1, specifically regulate the development of CO2-sensitive neurons (Cayirlioglu et al., 2008).

There may be further differences in the requirements for G-proteins among chemosensory neurons that express Gr genes. There is evidence that Gαs and Gγ1 play a role in the sugar response of Gr5a-expressing taste neurons, but not in the bitter response of Gr66a-expressing taste neurons (Ishimoto et al., 2005; Ueno et al., 2006). The functional significance of the heterogeneity in G-protein requirements merits investigation.

Receptor promiscuity and the evolution of insect olfactory transduction: a unifying model

It is intriguing and perhaps revealing that despite the different requirements for G-proteins, receptors of the Or-Gr family are able to function in quite distinct contexts. The ab1C receptors Gr21a and Gr63a can also function in ab3A, although they are limited by the availability of Gαq (Fig. 6), which is not required for the function of the endogenous ab3A receptor, Or22a. Reciprocally, the Or receptors Or43a and Or83b can function when coexpressed in ab1C (Benton et al., 2006). Moreover, coexpression of Or22a and Or83b in either Gr66a- or Gr5a-expressing taste neurons confers odor responses to both (Hiroi et al., 2008).

Do receptors signal through alternate pathways when expressed in alternate contexts? Co-expression of Or43a and a promiscuous Gα, without Or83b, was found to confer an odor response to Xenopus oocytes (Wetzel et al., 2001). The Bombyx mori receptor BmOR1 did not respond to its ligand when expressed alone in Xenopus oocytes, but was capable of responding when coexpressed with either the Or83b ortholog, BmOR2, or with BmGαq (Nakagawa et al., 2005). The response was more robust with BmOR2, which is reminiscent of our finding that the CO2 response is greater when Gr21a and Gr63a are coexpressed with Gαq, a gene required for the endogenous CO2 response.

One simple, unifying model consistent with all these results taken together is that Ors and Grs are capable of acting via multiple mechanisms, one requiring Or83b and one requiring G-proteins, efficiently in one case and inefficiently in the other. Ors are believed to represent a relatively recent branch of an ancient Gr family (Robertson et al., 2003). Perhaps Ors evolved to rely exclusively on a ligand-gated ionotropic signaling mechanism, whereas Grs maintained the ability to signal via a G-protein-dependent mechanism. If so, a limited ability of Ors and Grs to each signal through another mechanism might reflect this evolutionary transition.

Acknowledgments

We thank J. Árnadóttir, K. Menuz, and C.-Y. Su for insightful discussions and helpful comments on the manuscript. This work was supported by a National Science Foundation predoctoral fellowship (C.A.Y.) and grants from the NIH (J.R.C.).

References

  • Akhter SA, Luttrell LM, Rockman HA, Iaccarino G, Lefkowitz RJ, Koch WJ. Targeting the receptor-Gq interface to inhibit in vivo pressure overload myocardial hypertrophy. Science. 1998;280:574–577. [PubMed]
  • Banerjee S, Joshi R, Venkiteswaran G, Agrawal N, Srikanth S, Alam F, Hasan G. Compensation of inositol 1,4,5-trisphosphate receptor function by altering sarco-endoplasmic reticulum calcium ATPase activity in the Drosophila flight circuit. J Neurosci. 2006;26:8278–8288. [PubMed]
  • Benton R, Sachse S, Michnick SW, Vosshall LB. Atypical membrane topology and heteromeric function of Drosophila odorant receptors in vivo. PLoS Biol. 2006;4:e20. [PMC free article] [PubMed]
  • Bourne HR, Sanders DA, McCormick F. The GTPase superfamily: conserved structure and molecular mechanism. Nature. 1991;349:117–127. [PubMed]
  • Carlson JR. Olfaction in Drosophila: from odor to behavior. Trends Genet. 1996;12:175–180. [PubMed]
  • Cayirlioglu P, Kadow IG, Zhan X, Okamura K, Suh GS, Gunning D, Lai EC, Zipursky SL. Hybrid neurons in a microRNA mutant are putative evolutionary intermediates in insect CO2 sensory systems. Science. 2008;319:1256–1260. [PMC free article] [PubMed]
  • Clyne P, Grant A, O’Connell R, Carlson JR. Odorant response of individual sensilla on the Drosophila antenna. Invert Neurosci. 1997;3:127–135. [PubMed]
  • Clyne PJ, Warr CG, Carlson JR. Candidate taste receptors in Drosophila. Science. 2000;287:1830–1834. [PubMed]
  • Clyne PJ, Warr CG, Freeman MR, Lessing D, Kim J, Carlson JR. A Novel Family of Divergent Seven-Transmembrane Proteins: Candidate Odorant Receptors in Drosophila. Neuron. 1999;22:327–338. [PubMed]
  • Couto A, Alenius M, Dickson BJ. Molecular, anatomical, and functional organization of the Drosophila olfactory system. Curr Biol. 2005;15:1535–1547. [PubMed]
  • de Bruyne M, Foster K, Carlson JR. Odor coding in the Drosophila antenna. Neuron. 2001;30:537–552. [PubMed]
  • Dobritsa AA, van der Goes van Naters W, Warr CG, Steinbrecht RA, Carlson JR. Integrating the molecular and cellular basis of odor coding in the Drosophila antenna. Neuron. 2003;37:827–841. [PubMed]
  • Elmore T, Smith DP. Putative Drosophila odor receptor OR43b localizes to dendrites of olfactory neurons. Insect Biochemistry and Molecular Biology. 2001;31:791–798. [PubMed]
  • Ferris J, Ge H, Liu L, Roman G. G(o) signaling is required for Drosophila associative learning. Nat Neurosci. 2006;9:1036–1040. [PubMed]
  • Gilchrist A, Li A, Hamm HE. G alpha COOH-terminal minigene vectors dissect heterotrimeric G protein signaling. Sci STKE. 2002;2002:PL1. [PubMed]
  • Gilchrist A, Bunemann M, Li A, Hosey MM, Hamm HE. A dominant-negative strategy for studying roles of G proteins in vivo. J Biol Chem. 1999;274:6610–6616. [PubMed]
  • Grant AJ, Wigton BE, Aghajanian JG, O’Connell RJ. Electrophysiological responses of receptor neurons in mosquito maxillary palp sensilla to carbon dioxide. J Comp Physiol [A] 1995;177:389–396. [PubMed]
  • Hallem EA, Ho MG, Carlson JR. The molecular basis of odor coding in the Drosophila antenna. Cell. 2004;117:965–979. [PubMed]
  • Hamm HE, Deretic D, Arendt A, Hargrave PA, Koenig B, Hofmann KP. Site of G protein binding to rhodopsin mapped with synthetic peptides from the alpha subunit. Science. 1988;241:832–835. [PubMed]
  • Hiroi M, Tanimura T, Marion-Poll F. Hedonic taste in Drosophila revealed by olfactory receptors expressed in taste neurons. PLoS ONE. 2008;3:e2610. [PMC free article] [PubMed]
  • Hummel T, Vasconcelos ML, Clemens JC, Fishilevich Y, Vosshall LB, Zipursky SL. Axonal targeting of olfactory receptor neurons in Drosophila is controlled by Dscam. Neuron. 2003;37:221–231. [PubMed]
  • Ishimoto H, Takahashi K, Ueda R, Tanimura T. G-protein gamma subunit 1 is required for sugar reception in Drosophila. Embo J. 2005;24:3259–3265. [PubMed]
  • Jin S, Cornwall MC, Oprian DD. Opsin activation as a cause of congenital night blindness. Nat Neurosci. 2003;6:731–735. [PubMed]
  • Jones WD, Cayirlioglu P, Kadow IG, Vosshall LB. Two chemosensory receptors together mediate carbon dioxide detection in Drosophila. Nature. 2007;445:86–90. [PubMed]
  • Kain P, Chakraborty TS, Sundaram S, Siddiqi O, Rodrigues V, Hasan G. Reduced odor responses from antennal neurons of G(q)alpha, phospholipase Cbeta, and rdgA mutants in Drosophila support a role for a phospholipid intermediate in insect olfactory transduction. J Neurosci. 2008;28:4745–4755. [PubMed]
  • Kalidas S, Smith DP. Novel genomic cDNA hybrids produce effective RNA interference in adult Drosophila. Neuron. 2002;33:177–184. [PubMed]
  • Katanaev VL, Tomlinson A. Dual roles for the trimeric G protein Go in asymmetric cell division in Drosophila. Proc Natl Acad Sci U S A. 2006;103:6524–6529. [PubMed]
  • Katanaev VL, Ponzielli R, Semeriva M, Tomlinson A. Trimeric G protein-dependent frizzled signaling in Drosophila. Cell. 2005;120:111–122. [PubMed]
  • Kwon JY, Dahanukar A, Weiss LA, Carlson JR. The molecular basis of CO2 reception in Drosophila. Proc Natl Acad Sci U S A. 2007;104:3574–3578. [PubMed]
  • Larsson MC, Domingos AI, Jones WD, Chiappe ME, Amrein H, Vosshall LB. Or83b encodes a broadly expressed odorant receptor essential for Drosophila olfaction. Neuron. 2004;43:703–714. [PubMed]
  • Lee T, Luo L. Mosaic analysis with a repressible cell marker (MARCM) for Drosophila neural development. Trends in Neurosciences. 2001;24:251–254. [PubMed]
  • Lu T, Qiu YT, Wang G, Kwon JY, Rutzler M, Kwon HW, Pitts RJ, van Loon JJ, Takken W, Carlson JR, Zwiebel LJ. Odor coding in the maxillary palp of the malaria vector mosquito Anopheles gambiae. Curr Biol. 2007;17:1533–1544. [PMC free article] [PubMed]
  • Lundin C, Kall L, Kreher SA, Kapp K, Sonnhammer EL, Carlson JR, Heijne G, Nilsson I. Membrane topology of the Drosophila OR83b odorant receptor. FEBS Lett. 2007;581:5601–5604. [PMC free article] [PubMed]
  • McGuire SE, Le PT, Osborn AJ, Matsumoto K, Davis RL. Spatiotemporal Rescue of Memory Dysfunction in Drosophila. Science. 2003;302:1765–1768. [PubMed]
  • Miura N, Atsumi S, Tabunoki H, Sato R. Expression and localization of three G protein alpha subunits, Go, Gq, and Gs, in adult antennae of the silkmoth (Bombyx mori) J Comp Neurol. 2005;485:143–152. [PubMed]
  • Nakagawa T, Vosshall LB. Controversy and consensus: noncanonical signaling mechanisms in the insect olfactory system. Curr Opin Neurobiol. 2009;19:284–292. [PMC free article] [PubMed]
  • Nakagawa T, Sakurai T, Nishioka T, Touhara K. Insect sex-pheromone signals mediated by specific combinations of olfactory receptors. Science. 2005;307:1638–1642. [PubMed]
  • Neuhaus EM, Gisselmann G, Zhang W, Dooley R, Stortkuhl K, Hatt H. Odorant receptor heterodimerization in the olfactory system of Drosophila melanogaster. Nat Neurosci. 2005;8:15–17. [PubMed]
  • Olsen SR, Wilson RI. Lateral presynaptic inhibition mediates gain control in an olfactory circuit. Nature. 2008;452:956–960. [PMC free article] [PubMed]
  • Rasenick MM, Watanabe M, Lazarevic MB, Hatta S, Hamm HE. Synthetic peptides as probes for G protein function. Carboxyl-terminal G alpha s peptides mimic Gs and evoke high affinity agonist binding to beta-adrenergic receptors. J Biol Chem. 1994;269:21519–21525. [PubMed]
  • Ratnaparkhi A, Banerjee S, Hasan G. Altered levels of Gq activity modulate axonal pathfinding in Drosophila. J Neurosci. 2002;22:4499–4508. [PubMed]
  • Robertson HM, Warr CG, Carlson JR. Molecular evolution of the insect chemoreceptor gene superfamily in Drosophila melanogaster. Proc Natl Acad Sci U S A. 2003;100(Suppl 2):14537–14542. [PubMed]
  • Root CM, Masuyama K, Green DS, Enell LE, Nassel DR, Lee CH, Wang JW. A presynaptic gain control mechanism fine-tunes olfactory behavior. Neuron. 2008;59:311–321. [PMC free article] [PubMed]
  • Rutzler M, Lu T, Zwiebel LJ. Galpha encoding gene family of the malaria vector mosquito Anopheles gambiae: expression analysis and immunolocalization of AGalphaq and AGalphao in female antennae. J Comp Neurol. 2006;499:533–545. [PMC free article] [PubMed]
  • Sato K, Pellegrino M, Nakagawa T, Nakagawa T, Vosshall LB, Touhara K. Insect olfactory receptors are heteromeric ligand-gated ion channels. Nature. 2008;452:1002–1006. [PubMed]
  • Schulz S, Huber A, Schwab K, Paulsen R. A novel Ggamma isolated from Drosophila constitutes a visual G protein gamma subunit of the fly compound eye. J Biol Chem. 1999;274:37605–37610. [PubMed]
  • Scott K, Becker A, Sun Y, Hardy R, Zuker C. Gq[alpha] protein function in vivo: Genetic dissection of its role in photoreceptor cell physiology. Neuron. 1995;15:919–927. [PubMed]
  • Scott K, Brady R, Cravchik A, Morozov P, Rzhetsky A, Zuker C, Axel R. A Chemosensory Gene Family Encoding Candidate Gustatory and Olfactory Receptors in Drosophila. 2001;104:661–673. [PubMed]
  • Shanbhag SR, Muller B, Steinbrecht RA. Atlas of olfactory organs of Drosophila melanogaster 1. Types, external organization, innervation and distribution of olfactory sensilla. Int J Insect Morphol Embryol. 1999;28:377–397.
  • Syed Z, Leal WS. Maxillary palps are broad spectrum odorant detectors in Culex quinquefasciatus. Chem Senses. 2007;32:727–738. [PubMed]
  • Talluri S, Bhatt A, Smith DP. Identification of a Drosophila G protein alpha subunit (dGq alpha-3) expressed in chemosensory cells and central neurons. Proceedings of the National Academy of Sciences of the United States of America. 1995;92:11475–11479. [PubMed]
  • Ueno K, Kohatsu S, Clay C, Forte M, Isono K, Kidokoro Y. Gsalpha is involved in sugar perception in Drosophila melanogaster. J Neurosci. 2006;26:6143–6152. [PubMed]
  • van der Goes van Naters W, Carlson JR. Insects as chemosensors of humans and crops. Nature. 2006;444:302–307. [PubMed]
  • Vosshall LB, Amrein H, Morozov PS, Rzhetsky A, Axel R. A spatial map of olfactory receptor expression in the Drosophila antenna. Cell. 1999;96:725–736. [PubMed]
  • Wetzel CH, Behrendt HJ, Gisselmann G, Stortkuhl KF, Hovemann B, Hatt H. Functional expression and characterization of a Drosophila odorant receptor in a heterologous cell system. Proc Natl Acad Sci U S A. 2001;98:9377–9380. [PubMed]
  • Wicher D, Schafer R, Bauernfeind R, Stensmyr MC, Heller R, Heinemann SH, Hansson BS. Drosophila odorant receptors are both ligand-gated and cyclic-nucleotide-activated cation channels. Nature. 2008;452:1007–1011. [PubMed]
  • Wolfgang WJ, Hoskote A, Roberts IJ, Jackson S, Forte M. Genetic analysis of the Drosophila Gs(alpha) gene. Genetics. 2001;158:1189–1201. [PubMed]