Visualization of Feline Calicivirus Replication in Real-time with Recombinant Viruses Engineered to Express Fluorescent Reporter Proteins

doi:10.1016/j.virol.2009.12.035

Virology. Author manuscript; available in PMC 2011 April 25.

Published in final edited form as:

Virology. 2010 April 25; 400(1): 18–31.

Published online 2010 February 4. doi: 10.1016/j.virol.2009.12.035

PMCID: PMC2855553

NIHMSID: NIHMS178446

Visualization of Feline Calicivirus Replication in Real-time with Recombinant Viruses Engineered to Express Fluorescent Reporter Proteins

Eugenio J. Abente,^1,² Stanislav V. Sosnovtsev,¹ Karin Bok,¹ and Kim Y. Green^1,²^*

¹Laboratory of Infectious Diseases, NIAID, NIH, Bethesda, MD 20892

²Department of Cell Biology and Molecular Genetics, University of Maryland, College Park, MD 20742

^* Corresponding author: Norovirus Gastroenteritis Unit, National Institute of Allergy and Infectious Diseases, National Institutes of Health, 50 South Drive, Bldg. 50, Room 6318, Bethesda, MD, 20892. Phone: 301 594-1665, Fax: 301 480-5031, Email: kgreen/at/niaid.nih.gov

The publisher's final edited version of this article is available at Virology

See other articles in PMC that cite the published article.

Publisher's Disclaimer

Abstract

Caliciviruses are non-enveloped, icosahedral viruses with a single-stranded, positive sense RNA genome. Transposon-mediated insertional mutagenesis was used to insert a transprimer sequence into random sites of an infectious full-length cDNA clone of the feline calicivirus (FCV) genome. A site in the LC gene (encoding the capsid leader protein) of the FCV genome was identified that could tolerate foreign insertions, and two viable recombinant FCV variants expressing LC fused either to AcGFP, or DsRedFP were recovered. The effects of the insertions on LC processing, RNA replication, and stability of the viral genome were analyzed, and the progression of a calicivirus single infection and co-infection were captured by real-time imaging fluorescent microscopy. The ability to engineer viable recombinant caliciviruses expressing foreign markers enables new approaches to investigate virus and host cell interactions, as well as studies of viral recombination, one of the driving forces of calicivirus evolution.

Keywords: Feline calicivirus, transposon mutagenesis, recombinant, replication, gene expression

Introduction

Feline calicivirus (FCV), a member of the genus Vesivirus of the family Caliciviridae, is an important disease agent in cats. Clinical signs of disease can vary among FCV strains, and include conjunctivitis, oral ulceration, upper respiratory disease, and in severe cases, a systemic infection (Gaskell, 1985; Pesavento, Chang, and Parker, 2008; Radford et al., 2007). Although vaccines for FCV have been employed for over 20 years, a high incidence of mortality can occur in isolated outbreaks (Hurley et al., 2004; Ossiboff et al., 2007). Vaccine failure has been attributed to the absence of sterilizing immunity, occasional vaccine breakdowns, and in the case of the live vaccine, occasional vaccine-induced disease (Radford et al., 2006).

Feline caliciviruses contain an approximately 7.8-kb positive-sense RNA genome that is covalently linked at the 5′-end to the viral protein VPg (Herbert, Brierley, and Brown, 1997; Mitra, Sosnovtsev, and Green, 2004; Schaffer et al., 1980), and polyadenylated at the 3′-end (Neill and Mengeling, 1988). The viral genome is packaged (Burroughs and Brown, 1978) into small (approximately 35 nm in diameter), nonenveloped, icosahedral particles (T = 3) that are composed of 180 copies of VP1 and approximately 1-10 copies of VP2 (Chen et al., 2006; Chen, Neill, and Prasad, 2003; Peterson and Studdert, 1970; Prasad et al., 1999; Prasad, Matson, and Smith, 1994; Sosnovtsev and Green, 2000). The genome consists of three open reading frames. Open reading frame 1 (ORF1) encodes a large polyprotein precursor that is proteolytically cleaved by a viral protease into six mature nonstructural proteins (NS1-NS6/7) (Sosnovtsev, Garfield, and Green, 2002; Sosnovtseva, Sosnovtsev, and Green, 1999). ORF2 encodes a precursor to the major capsid protein that is post-translationally cleaved into the leader capsid protein (LC; of unknown function) and the mature capsid protein (VP1) (Carter et al., 1992; Fretz and Schaffer, 1978; Neill, Reardon, and Heinrikson, 1991; Sosnovtsev, Sosnovtseva, and Green, 1998). ORF3 encodes a small, basic protein (VP2) that is reported as essential for virus infectivity and capsid stability (Bertolotti-Ciarlet et al., 2003; Glass et al., 2000; Sosnovtsev et al., 2005; Sosnovtsev and Green, 2000).

In addition to the genus Vesivirus, the family Caliciviridae contains three other established genera: Norovirus, Sapovirus, and Lagovirus (Green, 2001; Green et al., 2000). Evidence for further diversity within the family has been reported (Farkas et al., 2008; Oliver et al., 2006; Oliver et al., 2004). Human noroviruses, which are the major cause of non-bacterial gastroenteritis in humans, are of particular importance for public health (Green et al., 2002a; Kapikian, 2000; Kapikian et al., 1972). Pediatric gastroenteritis caused by noroviruses is now recognized as second only to that caused by the rotaviruses (Patel et al., 2009; Patel et al., 2008; Trujillo et al., 2006). Despite advances in the development of molecular tools for the study of these viruses such as a human norovirus replicon system (Chang and George, 2007; Chang et al., 2006) and a cultivatable murine norovirus (MNV) (Karst et al., 2003; Wobus et al., 2004), analysis of the replication strategy of the human viruses has been challenging due to the unavailability of a permissive cell culture system.

The reverse genetics systems developed for FCV (Sosnovtsev and Green, 1995), and more recently for MNV (Chaudhry, Skinner, and Goodfellow, 2007; Ward et al., 2007) have facilitated studies of the calicivirus replication strategy (Chaudhry, Skinner, and Goodfellow, 2007; Mitra, Sosnovtsev, and Green, 2004; Sosnovtsev et al., 2005; Sosnovtsev, Sosnovtseva, and Green, 1998; Ward et al., 2007). Although antigenic domain swaps have been engineered successfully into recombinant FCV strains with reverse genetics (Neill, Sosnovtsev, and Green, 2000), there are no reports of the recovery of viable caliciviruses expressing foreign proteins. One strategy to engineer recombinant viruses derived from cDNA clones employs a modified Tn7 transposon mutagenesis system (Atasheva et al., 2007; Moradpour et al., 2004). This mutagenesis system inserts a 15-base pair sequence into infectious cDNA molecules at random sites (Biery, Lopata, and Craig, 2000; Craig, 1996; Peters and Craig, 2001; Stellwagen and Craig, 1997a; Stellwagen and Craig, 1997b), and viruses that can tolerate insertions are recovered and characterized. The Tn7 transposon system has been successfully applied to single-stranded RNA viruses to identify sites within the viral genome that can tolerate and stably express foreign proteins (Atasheva et al., 2007; Moradpour et al., 2004; Teterina, Levenson, and Ehrenfeld, 2009).

The goal of this study was to determine whether transposon mutagenesis could be applied to the generation of recombinant caliciviruses expressing foreign sequences. A region of the FCV genome that included the entire ORF2 and the 5′ end of ORF3 was scanned to identify sites that could tolerate the 15-nt insertion. Two sites were identified: one mapped within the LC protein (ORF2), and the other to the extreme N-terminus of VP2 (ORF3). Further analysis revealed that the FCV genome could tolerate larger sequence insertions only in the LC site, a viral protein of unknown function. Two recombinant FCV viruses were engineered to express either the reef coral Discosoma sp. red (DsRed) or the jellyfish Aequorea coerulescens green (GFP) fluorescent proteins fused to the LC protein. The progression of viral CPE and protein expression were captured by real-time imaging, followed by generation of the first direct evidence for co-infection of a single cell by two distinct calicivirus variants. The ability to engineer viable, recombinant calicivirus variants expressing foreign markers should enhance many areas of research, including elucidation of the basic mechanisms of replication and evolution.

Materials and Methods

Viruses and Cells

Feline calicivirus strain vR6, derived from the infectious cDNA clone of the Urbana strain designated pR6, was described previously (Sosnovtsev et al., 2005), and will be referred to as wild-type (wt). Crandell-Rees feline kidney (CRFK) cells were grown in Dulbecco's modified Eagle's medium (designated as maintenance medium, Lonza Inc., Allendale, NJ) containing amphotericin B (0.25 μg/ml, Mediatec, Inc, Manassas, VA), penicillin (250 U/ml, Mediatec), streptomycin (250 μg/ml, Mediatec) and L-Glutamine (2mM, Mediatec) supplemented with 10% heat-inactivated fetal bovine serum (Invitrogen Corporation, Carlsbad, CA)

Construction of Intermediate Plasmid

A plasmid designated Topo-VP1/VP2 was generated by cloning DNA fragments derived by PCR from pR6 as template into Invitrogen's Topo TA vector. The primer pair: sense primer, 5′-GGCATGACCGCCCTACACTGT (designated URB5273F) and antisense primer, 5′- GCGTTGTTGTCCAAGCGCAGCC (designated URB7391R) amplified the entire ORF2 and the first 96 nt of ORF3. The amplified and cloned FCV sequences included the unique restriction sites BstBI and AvrII, which were used for directional cloning back into the pR6 backbone following transposon mutagenesis.

Construction of cDNA Library of FCV Clones Containing a Randomly Inserted 15-bp Sequence

The protocol was designed based on procedures previously published (Moradpour et al., 2004; Teterina, Levenson, and Ehrenfeld, 2009). To focus the mutagenesis on a specific region of the FCV genome, the transposon-mediated mutagenesis was performed on the intermediate plasmid, Topo-VP1/VP2.

A cDNA library of Topo subclones with random transprimer insertions was created by using the GPS-LS linker scanning system according to the manufacturer's instructions (New England Biolabs, Beverly, MA). The GPS-LS insertion mutagenesis is performed in three major steps: first, a 1383 bp transprimer sequence, that is flanked by PmeI restriction sites and encodes the chloramphenicol resistance gene, is randomly inserted into a DNA target; second, all but 10 bp of the transprimer is removed by PmeI digestion; and finally, the ligation of the mutagenized DNA target results in a 15 bp insertion (10 bp from the transprimer which includes the PmeI site, and a 5 bp duplication of target DNA created by the transposition reaction).

Briefly, upon producing the GPS reaction mixture of an unamplified library of transprimer insertions, 5 μl of the reaction were transformed into competent cells. Competent cells were grown for 1 hour at 37°C with 600 μl of S.O.C. media (Invitrogen). Two hundred μl of the cell mix were added to 3 plates containing both chloramphenicol and kanamycin to select for transformants, and incubated overnight at 37°C. The first library of random mutations consisted of approximately 2,763 colonies. Ten ml of LB broth were added to the plates and the colonies were scraped and collected. Plasmid DNA was purified from the resuspended colonies using a DNA Mini-Prep kit (Qiagen, Valencia, CA). The three samples of DNA plasmid were then proportionally combined into a pool that contained approximately 3 μg of DNA. One μg of pooled DNA was digested using the restriction enzyme that flanked the region of interest (BstBI and AvrII), and separated on a 1% agarose gel. The scanned region of interest (the 2027 bp sequence of FCV bordered by the restriction sites BstBI and AvrII) plus the transprimer insertion was identified based on its size, and gel purified. The region of interest plus the transprimer insertion was ligated back into the parental full-length cDNA backbone of the pR6 plasmid, and transformed into competent cells. Identical to the previous pooling step, competent cells were grown for 1 hour at 37°C with 600 μl of S.O.C. media (Invitrogen). Two hundred μl of the cell mix were added to 3 plates containing both chloramphenicol and carbenicillin to select for transformants, and incubated overnight at 37°C. The second library of random insertion consisted of approximately 1,093 colonies. Ten ml of LB broth were added to the plates and the colonies were scraped and collected. Plasmid DNA was purified from the resuspended colonies as described above and three samples of DNA plasmid were then proportionally combined into a pool that contained approximately 3 μg of DNA. One μg of the pool was digested using the restriction enzyme PmeI. The digestion reaction was separated on a 1% agarose gel, and the parental backbone, minus the transprimer, was excised and gel purified. The pool of mutagenized parental backbone was religated, and transformed into competent cells. Identical to the previous pooling steps, competent cells were grown for 1 hour at 37°C with 600 μl of S.O.C. media (Invitrogen). The cell mix (200 μl) was added to 3 plates containing carbenicillin to select for transformants, and incubated overnight at 37°C. The final library of random mutations consisted of approximately 2,348 colonies. Ten ml of LB broth were added to the plates and the colonies were scraped and collected. Plasmid DNA was purified from the resuspended colonies as above, and the three samples of DNA plasmid were then proportionally combined into a pool that contained approximately 5 μg of DNA. Two μg of the final pool of mutagenized full-length FCV, containing 15-nt insertions randomly distributed in ORF2 and the first 12 nucleotides of ORF3 (the region of FCV bordered by the restriction sites BstBI and AvrII) were used to test for recovery of virus.

Recovery of Virus

Virus was recovered from plasmid DNA by using the MVA/T7 expression system, described previously (Sosnovtsev, Garfield, and Green, 2002). Briefly, confluent CRFK cell monolayers in 6-well plates (approximately 2 × 10⁶ cells) were infected with MVA/T7 (a gift of Dr. Bernard Moss) at an MOI of 10 and incubated for 1 h at 37°C. The supernatant was removed, and 2 ml of maintenance media were added to the cells. Transfections were carried out using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Following incubation for 24-48 hours at 37°C, medium from the transfected cell monolayer was transferred to a fresh cell monolayer, which was monitored for the development of viral CPE. If CPE was observed, the supernatant was used to perform a plaque assay, and individual plaques were analyzed.

To confirm that recovered virus originated from the engineered constructs, reverse-transcriptase (RT)-PCR products derived from viral RNA were analyzed by direct sequencing. RNA was purified using the RNeasy mini kit (Qiagen). As a control for the presence of DNA from the original plasmid used to synthesize the RNA for transfection, PCR was performed on the isolated viral RNA in the absence of RT.

Construction of Recombinant FCV Infectious Clones

To reconstruct the recovered transposon-modified virus, the RNA extracted from the plaque of a mutagenized virus that contained a 15-nt insertion in the LC (encoding a PmeI restriction site; Table 1) was used for RT-PCR amplification using the following primer pair that is complementary to the FCV genome: sense primer 5′-GAGTTGCATCTTGAGCCGCC (UrbanaFL5174F) and antisense primer 5′-GCGTTGTTGTCCAAGCGCAGCC (UrbanaFL7391R). This DNA fragment was treated with BstBI and AvrII and subsequently cloned back into the infectious cDNA clone pR6 using the same restriction sites to reconstruct the mutagenized LC viral sequence. The reconstructed plasmid containing the 15-nt insertion in the LC protein was designated pR6-LC-15.

TABLE 1

Two sites within the ORF2 and 3 region of FCV can tolerate a 15-nt insertion

The multiple cloning site was then inserted into pR6 clone using a QuikChange XL Site-Directed Mutagenesis kit (Stratagene's, La Jolla, CA) and PCR mutagenesis. The sequences of oligonucleotides used to mutagenize the cDNA clone are available upon request. The infectious clone with the multiple cloning site was designated pR6-LC (Fig. 1A).

Figure 1

Recombinant FCV constructs

The DsRed and GFP monomeric proteins were PCR-amplified using the pDsRed-Monomer-N1 and pAcGFP1-Monomer-N1 vectors as templates (Clontech), respectively, to include bordering KpnI and AflII sites that flanked a ‘linker’ amino acid (GGS) sequence. The PCR amplified DsRed or GFP fragments were digested, purified, and ligated into the KpnI and AflII sites of the pR6-LC clone a Rapid Ligation kit (Roche). The resulting plasmids were designated pR6-LC-GFP and pR6-LC-DsRed (Fig. 1B).

Plaque Assay

Viruses were titered on CRFK cells. CRFK cells were seeded onto 6-well plates, and upon confluency, the monolayers were infected with serial dilutions of virus prepared in Dulbecco's modified Eagle's medium. Plates were incubated for 60 min (37°C, 5% CO₂), with gentle agitation every 15 min. The inocula were removed, and monolayers were overlaid with 2 ml maintenance media containing 1% agarose gel (Invitrogen). Plates were then incubated for approximately 48 hr at 37°C, in humidified 5% CO₂. Cells were fixed with 10% formaldehyde and the agarose overlay was removed. The fixed cells were stained with 1% (w/v) crystal violet solution, washed, and viral plaques were counted.

Western Blot Analysis

Confluent monolayers of CRFK cells in 150 cm² flasks were infected with vR6, vR6-LC-GFP, and vR6-LC-DsRed respectively, and following complete lysis (approximately 48 hours), the flasks were submitted to three freeze-thaw cycles. The insoluble material was pelleted by centrifugation at 2,655 × g for 10 min and the pellet was resuspended in 500 μl PBS. A 10 μl aliquot was mixed with an equal volume of 2× Tris-glycine SDS sample buffer (Invitrogen) containing 5% β-mercaptoethanol. The sample was subjected to SDS-PAGE and Western blot analysis as described below.

For VP1 detection over time, CRFK cells were infected at an MOI of 1 with vR6, vR6-LC-GFP, and vR6-LC-DsRed. At the desired time point, approximately 300 μl of Tris-glycine SDS sample buffer was added directly to the monolayer to disrupt the cells, and the lysate was stored at -70°C until further use.

Samples were heated at 95°C for 5 min in 1× Tris-glycine SDS sample buffer (Invitrogen) containing 5% β-mercaptoethanol. Western blot analysis was performed using 4-20% Tris-glycine SDS-PAGE gels (Lonza). Proteins were transferred by dry blotting to nitrocellulose membranes using Invitrogen's iBlot apparatus, and membranes were incubated with guinea pig anti-FCV virion hyperimmune serum, rabbit anti-LC hyperimmune serum, rabbit polyclonal anti-DsRed (Clontech), or mouse monoclonal anti-GFP (Clontech). The binding of the primary antibodies was detected with goat anti-guinea pig (Kirkegaard & Perry Laboratories, Gaithersburg, MD), anti-rabbit or anti-mouse secondary antibodies (Thermo Scientific, Waltham, MA) conjugated with horseradish-peroxidase, followed by development with the SuperSignal Chemiluminescent Substrate (Thermo Scientific).

Western blots were stripped using the Restore Plus Western Blot Stripping Buffer (Thermo Scientific), and incubated with monoclonal HRP-conjugated anti-β-actin antibody. SeeBlue Plus2 Pre-Stained Standard (Invitrogen) was used to estimate molecular weights of the proteins detected by Western blot.

Subgenomic Expression Plasmids

To construct vectors expressing the FCV capsid precursor protein for trans-cleavage analysis, the entire FCV subgenomic RNA region present in pR6, pR6-LC-GFP, or pR6-LC-DsRed was cloned into the pCI expression vector (Promega, Madison, WI). The following primer pair was used to amplify the subgenomic region of each construct (including ORF2, ORF3, the 3′-NTR, poly-A tail, and a unique NotI restriction site downstream of the poly-A tail), and to introduce a SalI restriction site (boldface) upstream of the subgenomic transcription initiation site: sense primer 5′-CGCCCTACACTGTGAGTCGACTGTGTTCGAAGTTTG (pR6-SubGen-SalI F) and antisense primer that is downstream of the NotI restriction site 5′-CCCAGTCACGACGTTGTAAAAC (pR6-Dnstream PolyA R). The DNA fragments were treated with SalI and NotI, and cloned into pCI vectors (Promega) using the same restriction sites. The plasmids were designated pCI-vR6, pCI-vR6-LC-GFP, and pCI-vR6-DsRed (Fig. 1C). All plasmids were confirmed by sequence analysis.

Coupled In Vitro Transcription and Translation Reaction and Immunoprecipitation Assay

One to 5 μg of plasmid DNA were used as template in a coupled transcription and translation reaction (TNT T7 Coupled Reticulocyte Lysate System; Promega). For radiolabeling of synthesized protein, [³⁵S] methionine (>1,000 Ci/mmol) from Amersham/GE Healthcare (Waukesha, WI) was added at a concentration of 1.5 mCi/ml.

Immunoprecipitation of the LC protein from the TNT reaction was performed as described previously (Sosnovtsev, Sosnovtseva, and Green, 1998). Briefly, 20 μl of the TNT reaction were incubated with 40 μl of either mock-infected lysate or vR6 infected lysate at 37°C for 3 hr. The resulting mixture was diluted with 60 μl of radioimmunoprecipitation assay (RIPA) buffer. The mixtures were incubated with rabbit post-immunization serum (5 μl) raised against the FCV LC protein expressed in E. coli, and the immune complexes were precipitated with protein A beads (Sigma Chemical Co., Saint Louis, MO). The binding and washing conditions were performed as described previously (Sosnovtsev, Sosnovtseva, and Green, 1998). Following separation of the proteins in a 4-12% Tris-glycine SDS-PAGE gel, the gel was dried and exposed to Biomax MR film (Kodak, Rochester, NY) for autoradiography.

Multiple-cycle Growth Kinetics

CRFK monolayers were infected with vR6, vR6-LC-GFP, or vR6-LC-DsRed at a multiplicity of infection (MOI) of 0.01 and incubated at 37°C in 5% CO₂. Cell lysates were collected at various times post-infection (p.i.) and frozen at -70°C. Following three freeze-thaw cycles, the titer at each time-point was determined by plaque assay in CRFK cells as described above. Results depicted in Fig. 2B represent the mean value of each time point duplicate determined in two independent plaque titration assays, and the error bars represent one standard deviation. The graph was prepared using the software Prism from GraphPad (La Jolla, CA).

Figure 2

Recombinant FCV expressing GFP and DsRed fused to the LC are viable and show growth kinetics similar to wt FCV

Extraction of Viral RNA

CRFK monolayers (2 × 10⁶ cells) were mock infected or infected with vR6, vR6-LC-DsRed or vR6-LC-GFP at a multiplicity of infection of 1 and incubated at 37°C in 5% CO₂. At 8 h p.i. 300 μl of Trizol (Invitrogen) reagent was added directly to the monolayer, and RNA was extracted following the instructions of the manufacturer. The viral RNA of individual plaques was purified using Qiagen's RNeasy mini kit.

Preparation of RNA Transcripts and Biotinylated RNA Probes

An RNA probe was designed as described in Green et al. (Green et al., 2002b). Briefly, using pR6 as a template, a forward primer that contained a T7 RNA polymerase promoter sequence and a reverse primer were used to generate a DNA fragment that was complementary to nt 5686 to 5987 of the ORF2. DNA fragments were agarose gel purified and extracted from the agarose (Qiagen). Approximately 1 μg of the DNA fragment was used as the template for in vitro transcription with the Ribomax Express T7 transcription kit (Promega). Transcribed RNA was purified with the RNeasy mini kit (Qiagen).

Purified RNA fragments were subsequently biotinylated with the reagents in the BrightStar psoralen-biotin nonisotopic labeling kit (Ambion, Carlsbad, CA). Briefly, 0.5 μg of RNA was cross-linked to the psoralen-biotin reagent on ice with a 365-nm UV light for 45 min. Unincorporated label was removed by 1-butanol extraction. The biotinylated RNA probes were stored at -70°C.

Northern Blotting

Northern blot analysis for the detection of FCV RNA was performed with the NorthernMax-Gly system (Ambion) as described by Green et al. (Green et al., 2002b), with slight modifications. Briefly, the viral RNA was denatured with glyoxal loading dye for 30 min at 50°C, and separated in a 1% LE-agarose gel. The RNA was transferred to a Bright-Star-Plus membrane by capillary blotting. The membrane was treated with UV light to cross-link the RNA to the membrane, and was then incubated with Ultrahyb buffer at 68°C for 30 min. The membrane was then incubated overnight at 68°C with the sense biotinylated RNA transcript probe. Detection of bound biotinylated RNA probe was conducted following the instructions of the Bright Star BioDetect kit (Ambion).

Nucleotide Sequence Analysis

All plasmids were sequenced to confirm the presence of the desired engineered insertions. Nucleotide sequencing analysis was performed on an ABI 3730 automated sequencer (Applied Biosystems, Carlsbad, CA) with the Big Dye Terminator reagents, version 3.1.

Recovery of transposon mutagenized virus was confirmed by direct sequence analysis of RT-PCR products derived from viral RNA as described previously (Sosnovtsev, Sosnovtseva, and Green, 1998). The sequences of oligonucleotides used to amplify and sequence virus-specific cDNA fragments are available upon request.

The following primer pair, that flanks the site of insertion into the LC coding sequence, was used in a “diagnostic” PCR to examine the stability of the insert: sense primer 5′- CTTGAGTCTATCCTGGGCGATG (UrbFL5500F), and the antisense primer 5′- ATCAGCAGCGGTTGACATTTG (UrbFL5758R).

Microscopy Analysis

Plaques were visualized using a Leica DMI4000 B microscope, and images were captured using a QImaging Retiga-2000R camera (Surrey, BC Canada). Images were processed using iVision 4.0.14 software (BioVision. Exton, PA).

For live-cell imaging of single infection, cells were infected with vR6-LC-PmeIDsRed at an MOI of 10. For the co-infection experiment, cells were infected with both vR6-LC-GFP and vR6-LC-DsRed at a multiplicity of infection (MOI) of 2 and 1, respectively. The infected cells were then transferred to a temperature-controlled chamber (37°C/5% CO₂). Time-lapse confocal imaging was obtained using a Leica SP2-AOBS Confocal Microscope. Time-course images were processed using Imaris software (Bitplane, Zurich, Switzerland).

Results

Identification of Sites in the FCV Subgenomic Region that can Tolerate an Insertion

In our initial experiments to identify sites in the FCV genome that can tolerate insertions, a transposon mutagenesis approach was used to insert a 15-bp sequence (with a unique PmeI restriction enzyme site) at random locations throughout the entire ORF2 and the first 12 nucleotides of ORF3. The mutagenized FCV region was then cloned back into the infectious full-length cDNA clone, pR6, replacing wt sequences with the mutagenized sequences. In general, the titer of virus recovered from the library of mutagenized plasmids was 10 plaque forming units (p.f.u.), approximately 2 log₁₀ lower than the titer of virus recovered from a full-length clone encoding wild type (wt) virus. There was a high incidence of recovered wt virus after transfection with the mutagenized pool, which was likely due to instability of the recombinant viruses and reversion to wt. From the initial screening of recovered viruses, 3 out of 23 analyzed plaques were identified by sequence analysis as recombinant viruses containing a 15-nt insertion (Table 1), although 2 of the 3 plaques were identical recombinants. The LC protein tolerated the 15-nt insertion at the C-terminus (this recombinant was recovered twice from the library; the site of insertion is bordered by nucleotides 5577 and 5578), and VP2 tolerated the insertion at its N-terminus (bordered by nucleotides 7322 and 7323). Reverse genetics was employed to insert small epitope tags into these sites (HA, FLAG, and a tetra cysteine motif). Virus was recovered from recombinant cDNA clones expressing each of the three epitope tags fused to the LC, and the presence of each sequence in the viral genome was confirmed by sequence analysis. Of the three epitope tags that were inserted into the VP2 coding sequence, virus was recovered only from the recombinant cDNA clone that contained the HA insertion.

The ability of the LC protein to tolerate the insertion of foreign sequences was of interest because the function of this protein, which is unique to the genus Vesivirus, has not yet been identified. The LC protein is translated as part of the 72 kDa capsid precursor (668 amino acids in length) encoded in ORF2. The viral cysteine proteinase cleaves the precursor immediately following amino acid 124, releasing the LC (amino acids 1-124) and the mature VP1 (amino acids 125-668). To facilitate cloning of markers into the LC in order to study its function and to evaluate the characteristics of representative recombinant viruses, the pR6 infectious clone was engineered at the LC insertion site to create four new unique restriction sites (PmeI, KpnI, BspEI, AflII), bordered by nucleotides 5577 and 5578 of the FCV genome, (designated as pR6-LC; Fig. 1A). Viable viruses were recovered from the pR6-LC clone (data not shown).

Viability of Recombinant FCV Variants

In order to monitor a FCV infection in real-time, the coding sequence of the monomeric versions of GFP and DsRed were engineered into the pR6-LC clone using the unique KpnI and AflII sites (Fig. 1A), with the addition of a three amino acid “linker” sequence (GGS) flanking the fluorescent protein. The recombinant clones were designated pR6-LC-GFP and pR6-LC-DsRed, for the GFP and DsRed harboring constructs, respectively (Fig. 1B).

The recombinant clones yielded viable recombinant viruses that formed plaques in CRFK cell monolayers (Fig. 2A, panels 1-4). There was no visible difference in the CPE caused by the recombinant viruses and vR6 (cell rounding; Fig. 2A, panels 9-12). Microscopy revealed that plaques formed by vR6-LC-GFP and vR6-LC-DsRed were fluorescent at the expected wavelengths, and no fluorescence was observed in vR6-infected cells (Fig. 2A, panels 5-8).

The growth kinetics of the recombinant FCV viruses were compared with that of the wild-type parental virus, vR6, in a multi-step growth curve (Fig. 2B). Cell monolayers were infected with viruses at an MOI of 0.01 and samples were collected at 0, 6, 12, 18, 24, 30, and 48 hours p.i. The growth curves for all viruses were similar through the first 18 hours. At 24 hours p.i., vR6 reached a peak titer of approximately one log₁₀ higher than the recombinant viruses. By 48 hours p.i., viral titers were similar for all three viruses. These data indicate that the recombinant viruses spread similarly to wild-type, however they have a maximum titer one log₁₀ lower than wild-type.

Characterization of LC-fusion Precursor Protein In Vitro and in Virus-infected Cells

The recovery of viruses expressing relatively large fluorescent proteins fused to the LC prompted us to examine the cleavage efficiency between LC and VP1 in an in vitro cleavage assay. It was possible that the reduction in virus yield was due to a lower efficiency of the precursor cleavage event. The subgenomic regions of vR6, vR6-LC-GFP and vR6-LC-DsRed were each cloned into the pCI expression vector and the resulting plasmids, designated pCI-vR6, pCI-LC-GFP, pCI-LC-DsRed, contained the first AUG of ORF2 under the control of a T7 promoter. The radiolabeled translation products generated in a coupled in vitro transcription and translation reaction were resolved by SDS-PAGE, and the expected bands corresponding to proteins with predicted molecular masses of 73 (vR6), 101 (vR6-LC-GFP), and 100 (vR6-LC-DsRed) kDa were observed (Fig. 3A). Additional minor bands corresponding to proteins of lower molecular weight were likely the result of efficient internal translation at downstream AUGs of ORF2, as noted previously (Sosnovtsev, Sosnovtseva, and Green, 1998). To test for authentic cleavage of the recombinant precursor, radiolabeled TNT products derived from the pCI vectors were incubated at 37°C for 3 hr with a lysate (nonradiolabeled) prepared from either vR6-infected, or mock-infected, CRFK cells (Fig. 3B). The products of this incubation were immunoprecipitated using specific antibodies raised against the LC and the complexes were analyzed by SDS-PAGE and visualized with autoradiography. The expected cleavage event occurred only when the TNT samples were incubated with vR6-infected CRFK lysates, which are known to contain the active viral proteinase (lanes 4-6) (Sosnovtsev, Sosnovtseva, and Green, 1998). The cleaved LC protein in both the wt and recombinant form (indicated with an asterisk) were observed in addition to the approximately 60 kDa mature capsid (indicated with an arrow) that co-precipitated, as observed previously (Sosnovtsev and Green, 2000). Furthermore, anti-FCV virion serum was used to monitor VP1 processing over time in FCV-infected cells. The production of mature VP1 was similar for the three viruses (Fig. 3C), suggesting that processing of the capsid precursor by the viral proteinase (Sosnovtsev, Sosnovtseva, and Green, 1998) was unaffected. Taken together, these data show that the insertion of the fluorescent protein into the LC does not affect the observed efficiency of the capsid precursor cleavage both in vitro and in infected cells.

Figure 3

Evidence for efficient cleavage of the LC precursor of pR6-LC-GFP and pR6-LC-DsRed constructs in vitro and in vivo

Western blot analyses of CRFK cells infected with vR6, vR6-LC-GFP, and vR6-LC-DsRed were performed to investigate whether the recombinant FCV variants expressed LC as an intact fusion protein (Fig. 3D). The anti-LC serum detected the expected LC protein of 14 kDa in wt infected cells (lane 1), and larger LC fusion proteins in cells infected with vR6-LC-GFP (lane 2) and vR6-LC-DsRed (lane 3). A band of the expected molecular mass of approximately 42 kDa for the recombinant LC fusion protein was also detected using antibodies specific for GFP (lane 6) or DsRed (lane 11). It should be noted that when detecting recombinant LC proteins, bands corresponding to proteins of lower molecular masses were observed in some Western blots. Possible explanations include internal initiation of translation on the subgenomic RNA transcript, nonspecific degradation of the LC protein, or reversion of the population bearing recombinant LC to wt LC (see Fig. 6).

Figure 6

RT-PCR diagnostics and sequence analysis of vR6-LC-PmeIDsRed and revertants

Northern Blot Analysis of Recombinant Viral RNA

Two abundant positive sense RNA species corresponding to an approximately 7.8 kb genomic and 2.5 kb subgenomic RNA are produced during an FCV infection (Carter, 1990; Green et al., 2002b; Herbert, Brierley, and Brown, 1997; Neill and Mengeling, 1988). In order to determine whether expression of these RNA species were affected by the introduction of foreign RNA into the subgenomic region, a Northern blot analysis was performed to determine the characteristics of the replicating RNA of cells infected with vR6-LC-GFP and vR6-LC-DsRed (Fig. 4).

Figure 4

Northern blot analysis of genomic and subgenomic RNA from recombinant FCV-infected cells

RNA was isolated 8 hours p.i. from CRFK cells infected with vR6, vR6-LC-GFP or vR6-LC-DsRed. A biotinylated probe specific for the FCV ORF2 detected RNA consistent with the expected size of the wt subgenomic (approximately 2.5 kb) and genomic (approximately 7.7 kb) RNA for vR6 (Fig. 4, lane 1), along with additional minor virus-specific RNA species noted in previous studies (Carter, 1990). In contrast, RNA isolated from recombinant FCV infected cells yielded two larger abundant RNA species, with an expected shift in the size of subgenomic (approximately 3.2 kb) and genomic (approximately 8.4 kb) RNAs for the vR6-LC-GFP (Fig. 4, lane 2) and vR6-LC-DsRed viruses (Fig. 4, lane 3). A longer exposure of the vR6-LC-DsRed RNA Northern blot is included in lane 5 to show the presence of the genomic RNA. These data demonstrate that the fluorescent protein coding sequence is present and maintained in the genome throughout multiple replication cycles. It also demonstrates that the subgenomic RNA is transcribed at levels similar to wt, indicating that the subgenomic promoter was functional in the presence of a large proximal insertion.

Real-time Visualization of LC Production During a Single and Co-infection

Infection studies were performed with the individual recombinant viruses to monitor an FCV infection in real-time (Fig. 5, Supplementary Video 1, 2). A representative video (Supplementary Video 2) captured approximately 20 cells expressing DsRed in a CRFK monolayer infected with vR6-LC-PmeIDsRed at a high MOI (5). As the progression of CPE advances and apoptotic changes become apparent, an increase in the intensity of expression of DsRed can be observed. The initial localization of the LC was identified as perinuclear, as seen in Supplementary Video 2, and future studies will examine co-localization with cellular markers.

Figure 5

Real-time imaging of a co-infection

The availability of two recombinant viruses expressing distinct reporter proteins prompted us to perform co-infection studies. Although evidence for recombination has been documented extensively in the caliciviruses, it has been difficult to elucidate the interactions of two viral genomes replicating in the same cell. Infection of a CRFK monolayer with the GFP and DsRed recombinant viruses yielded occasional cells expressing both red and green markers, with co-localization evidenced by a yellow signal in the merged images. One such single cell co-infected with both viruses was monitored over time, and the increase in expression of GFP and DsRed was consistent with the progression of CPE (Fig. 5). The most intense signal from recombinant LC in a co-infection was observed 8 hours p.i. (Fig. 5; Video S1 can be viewed to observe fluorescence over a longer time course), although cells began to collapse and bleb approximately 5-6 hours p.i., a morphology consistent with reports of virus-induced apoptosis (Natoni et al., 2006; Roberts et al., 2003; Sosnovtsev et al., 2003). Supplementary Video 2 (which extended beyond the first 9.5 hrs shown in Fig. 5) showed a continued accumulation of recombinant LC after the cell had collapsed. Furthermore, the LC-GFP accumulated to higher observable levels then LC-DsRed. Several other co-infected cells were monitored as well, but there was no clear pattern of one recombinant virus out-competing the other.

The image analysis of co-infection enabled by the visualization of LC trafficking suggests that different viruses within the same cell can both co-localize and maintain distinct replication sites.

Stability of Recombinant Viruses

A PCR assay was developed to track the stability of foreign inserts in the FCV genome, similar to studies that have been performed with recombinant polioviruses (Mueller and Wimmer, 1998) (Fig. 6A). One clear indicator of changes in the inserted fluorescent protein gene was the appearance of non-fluorescent plaques in plaque-purified stocks. The RT-PCR diagnostics and sequencing analysis allowed us to track the sizes and types of deletions of revertant viruses.

RT-PCR was performed on RNA purified from fluorescent and non-fluorescent plaques, and vR6 virus (Fig. 6B). The vR6 RNA yielded a band of approximately 300 bp (Fig. 6B, lane 9). The RNA from a fluorescent plaque produced a PCR amplicon of approximately 1000 bp, the expected size of the region if bearing an intact DsRed gene (lane 2). Five of the six nonfluorescent plaques from viruses obtained immediately after recovery from an infectious cDNA clone (lanes 3 and 4) or from pooled viruses amplified in a T-150 flask (lanes 5-8) yielded a similar sized band (approximately 400 bp, lanes 3, 5-8) that was intermediate when compared with the DsRed expressing virus and vR6. RNA from plaque 2 (lane 4) produced a major band matching that of vR6, and a minor band similar in size to that produced from the other non-fluorescent plaques, consistent with a mixed population of viruses undergoing deletions and reversion to near wild type.

PCR products from the non-fluorescent plaques were gel purified and sequenced. Plaques 1, and 3-6 contained six nucleotides from the 5′-end of the original DsRed insert, in addition to 101 nucleotides from the 3′-end of the insert separated by two small gaps (Fig. 6C). The major band of Plaque 2 was selected for sequencing, and this deletion variant contained 8 nucleotides of the 5′-end of the DsRed gene insertion, and a single nucleotide that likely corresponds to the last nucleotide of the 3′-end of the insertion (Fig. 6C).

An FCV variant that contained an HA epitope fused to the VP2 was also generated. The stability of the HA tag in ORF3 was analyzed by sequence analysis (data not shown). Following recovery, the VP2-HA virus was serially passaged three times, and sequence analysis of RT-PCR products obtained from the third passage virus showed the presence of a modified HA epitope in the VP2 (Y---VPDYA, instead of the full YPYDVPDYA that had been introduced). No virus was recovered from a recombinant virus construct in which the FLAG epitope was introduced into the coding sequence of VP2, suggesting that the particular sequence of the insertion, in addition to length, may affect the stability and viability of recombinant viruses.

Discussion

Until now, recombinant caliciviruses generated by reverse genetics have contained only highly-related domain swaps from other caliciviruses (Neill, Sosnovtsev, and Green, 2000). The trans-encapsidation of a non-infectious FCV RNA that contains GFP fused to the VP1 sequence has been reported, although the low efficiency of the trans-encapsidation event did not allow for further characterization or analysis of the trans-encapsidated virion (Thumfart and Meyers, 2002). The introduction of heterologous sequences into the genome of a single-stranded positive-sense RNA virus presents several challenges because the insertion may affect RNA secondary structure, proteolytic processing of a polyprotein, and RNA packaging. Some approaches that have been successfully applied to engineer recombinant single-stranded positive-sense viruses include: cloning the heterologous sequence in frame with a viral protein (Bonaldo et al., 2002; Bonaldo et al., 2005; Burke et al., 1988; Evans et al., 1989), cloning an internal ribosomal entry site (IRES) adjacent to the heterologous sequence to create a dicistronic expression vector (Alexander, Lu, and Wimmer, 1994; Hefferon et al., 1997; Lu, Alexander, and Wimmer, 1995; Pierson et al., 2005), and cloning a heterologous sequence that contains an artificial viral cleavage site adjacent to a viral ORF (Andino et al., 1994; Bonaldo et al., 2007; Fan, Dennis, and Bird, 2008; Henke et al., 2001; Hofling et al., 2000; Mattion et al., 1994; Thomas et al., 2003). We decided to employ the Tn7 transposon mutagenesis system to identify sites in FCV that can tolerate an insertion because it has been successfully applied to other single-stranded, positive sense RNA viruses (Atasheva et al., 2007; Moradpour et al., 2004). For the hepatitis C virus, the mutagenesis system allowed researchers to develop a recombinant replicon system that expresses GFP fused to a nonstructural protein (Moradpour et al., 2004), which has been useful for analysis of HCV replication complexes (Wolk et al., 2008). Similar experiments were performed using Sindbis virus, in which a nonstructural protein was identified that could tolerate the insertion of a fluorescent protein (Atasheva et al., 2007), and analogous studies of replication complexes were conducted (Gorchakov et al., 2008).

Random transposon mutagenesis was applied to a region of FCV that encompassed ORF2 and the first 12 nucleotides of ORF3 to determine whether the virus could tolerate a 15-nt insertion. Despite a low coverage of the region of interest (~1×) by transposon mutagenesis, the initial analysis of a library of randomly mutagenized clones yielded two sites that could tolerate a 15-nt insertion. The two sites of insertion were located in different viral proteins: VP2 and the LC. It was unexpected that the VP2 could tolerate an insertion because it has been shown that the N-terminus of VP2 contains domains that are essential for viral replication (Sosnovtsev et al., 2005). Despite initially tolerating a heterologous sequence fused to VP2 (an HA epitope), the insertion of the recombinant virus was rapidly modified by partial deletion of the foreign insertion.

Two heterologous sequences were cloned into the site identified in the LC protein (AcGFP, DsRed), and recombinant viruses were recovered. Further study of these viruses showed that they produced the LC protein as an intact GFP or DsRed fusion protein. The published data concerning the vesivirus LC protein is limited, and little is known about its structure and function. The precursor cleavage event that releases the LC from the mature VP1 occurs shortly after the capsid precursor is translated (Carter, 1989; Carter et al., 1992; Sosnovtsev, Sosnovtseva, and Green, 1998) and is essential for a productive virus infection. Recent data suggests that the LC enhances the replication of the Norwalk norovirus RNA replicon (Chang et al., 2008), in association with an increase in low density lipoprotein receptor mRNA levels (Chang, 2009); however, the mechanism of enhancement is not clear. It has been proposed that the LC may function as a nonstructural protein because it was not detected in purified FCV virions (Tohya et al., 1999). However, LC protein was not detected in isolated fractions containing active replication complexes (Green et al., 2002b). Until the function of the LC is elucidated, it will not be known whether a functional homolog is present in other caliciviruses. Further study of LC recombinant viruses may lead to new insight into the role of this protein in vesivirus replication.

An unexpected observation from the study was that the fluorescently tagged LC protein was not clearly visualized by microscopy until 7.5 h.p.i. (Fig. 5). The LC protein is encoded as part of the capsid precursor protein in ORF2 of the subgenomic RNA, and abundantly produced and detected as early as 2 h.p.i. in Western blots (Fig. 3C). The lag in detection of fluorescence from the LC fusion proteins in the recombinant viruses may be due to the time required for the folding and maturation of the chromophore following expression of the fluorescent protein. It is possible also that fusion of the fluorescent protein to the LC may affect the dynamics of the chromophore maturation, which could then lead to a lower signal readout. We are currently investigating the use of fluorescent proteins that are more photostable and produce brighter signals in an effort to enhance the observation of protein trafficking early in the virus life cycle.

RNA viruses can rapidly adapt to selective pressures due to recombination events, in addition to the well-characterized poor fidelity of RNA-dependent RNA polymerases (Duffy, Shackelton, and Holmes, 2008; Lin et al., 2009). Serial passage of the constructs presented in this paper resulted eventually in the reduction or loss of foreign protein expression, as the virus reverted back to wt or deleted sequences in the original insertion. Sequencing of these LC-modified viruses in individual plaques revealed that fragments of the foreign sequence often remained fused to the LC (Fig. 6), consistent with data reported for recombinant poliovirus revertants (Mueller and Wimmer, 1998). The proposed mechanism by which recombinant polioviruses revert to wild-type is via nonhomologous RNA recombination during minus strand synthesis (Mueller and Wimmer, 1998). It is possible that caliciviruses use the same mechanism for reversion, but further studies will be needed. Such studies may lead also to the design of recombinant viruses with greater stability. The length, primary nucleotide and amino acid sequences, and context of the insertion in the genome are likely important factors in stability. For example, variation was observed in the length of the insertions that were tolerated between LC and VP2 in the virus, with VP2 limited to small epitopes. And although a small HA epitope (9 amino acids) in VP2 was tolerated, albeit poorly, a six amino acid insertion that contained a tetra cysteine motif was lethal (unpublished data). Host cell factors may influence also the stability of recombinant viruses. The stability of a recombinant GFP-expressing hypovirus RNA genome was enhanced in its fungal host cell (Cryphonectria parasitica) when the host cell dicer gene dcl-2 was disrupted (Zhang and Nuss, 2008). It will be interesting to investigate what, if any, cellular factors affect the stability of foreign sequences for FCV.

There are several reports that caliciviruses undergo recombination in nature and emerging recombinants have been associated with at least two reported norovirus outbreaks (Fukuda et al., 2008; Vidal et al., 2006). The site of recombination has been predominantly located at, or near the ORF1/2 junction, within the polymerase or capsid sequence (Bull, Tanaka, and White, 2007; Chhabra et al., 2009; Coyne et al., 2006; Forrester et al., 2008; Fukuda et al., 2008; Guo et al., 2009; Jiang et al., 1999; Jin et al., 2008; Nayak et al., 2008; Nayak et al., 2009; Phan et al., 2007a; Phan et al., 2007b; Rohayem, Munch, and Rethwilm, 2005; Waters, Coughlan, and Hall, 2007). It has been shown that upon calicivirus infection, membrane rearrangement occurs (Green et al., 2002b; Love and Sabine, 1975; Studdert and O'Shea, 1975), which is thought to allow the formation of replication complexes. Enzymatically-active replication complexes can be isolated from FCV-infected cells (Green et al., 2002b), but it is not known how the dynamics of replication complex formation are affected during a co-infection. It is possible that mixed replication complexes are formed during a co-infection, sequestering genomic RNA from different viruses inside the same replication complex, allowing recombination to occur. Work is in progress to generate additional recombinant FCV variants with markers in other regions of the genome, in particular the nonstructural proteins encoded in ORF1. These viruses may further allow the characterization of replication sites during a co-infection, and lead to new insight into the mechanisms of recombination.

The fluorescently tagged viruses should provide also a supplementary tool for analysis of virus-host cellular interactions. In addition to confirming interactions of viral proteins with host cellular proteins biochemically, the recruitment of host cellular proteins to the site of viral translation can now be monitored in real-time. The availability of several host cellular proteins tagged with fluorescent protein should allow an in-depth analysis of the dynamics of the host cellular membrane rearrangement and the recruitment of host cellular proteins essential for virus replication.

Conclusions

Transposon-mediated mutagenesis was successfully applied to FCV, and recombinant FCV variants were engineered that expressed a fluorescent protein fused to the LC. Viral protein processing and RNA replication of the recombinant FCV variants were analyzed and did not differ significantly from the wild-type strain. The stability of the heterologous insertion was monitored by PCR and deleterious (non-fluorescent) viruses were sequenced, providing a new approach for the analysis of RNA repair and recombination. The ability to generate infectious FCV variants expressing foreign protein and RNA sequences has broad applications for basic research in calicivirus replication. Furthermore, this approach may lead also to practical applications such as gene delivery and improved vaccines for FCV and other members of the Caliciviridae.

Supplementary Material

01: Supplementary Video 1. Movie of a single cell co-infected with vR6-LC-GFP and vR6-LC-DsRed

This experiment corresponds to the gallery presented in Fig. 5 and the movie was prepared using Imaris.

Click here to view.^{(7.9M, mov)}

02: Supplementary Video 2. Movie of multiple cells infected with vR6-LC-PmeIDsRed

CRFK cells were infected with vR6-LC-PmeIDsRed (MOI of 10). 3 h.p.i. the cells were transferred to a closed chamber (37°C/5% CO₂) and monitored over time. Images were captured every 15 min for 19.5 h. The movie was generated using Imaris.

Click here to view.^{(41M, mov)}

Acknowledgments

We would like to thank Eric Levenson, Natalya L. Teterina, and Ellie Ehrenfeld for advice and technical assistance with the transposon mutagenesis assay. We would like to thank Dr. Juraj Kabat, Dr. Lily Koo, Dr. Stephen Becker and Dr. Owen M. Schwartz of the Biological Imaging Section in NIAID for assistance with the confocal imaging. We would like to thank Tanaji Mitra for technical assistance and Dr. Albert Z. Kapikian for support of this project.

This research was supported by the Intramural Research Program of the NIH, NIAID.

Footnotes

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

Alexander L, Lu HH, Wimmer E. Polioviruses containing picornavirus type 1 and/or type 2 internal ribosomal entry site elements: genetic hybrids and the expression of a foreign gene. Proc Natl Acad Sci U S A. 1994;91(4):1406–10. [PubMed]
Andino R, Silvera D, Suggett SD, Achacoso PL, Miller CJ, Baltimore D, Feinberg MB. Engineering poliovirus as a vaccine vector for the expression of diverse antigens. Science. 1994;265(5177):1448–51. [PubMed]
Atasheva S, Gorchakov R, English R, Frolov I, Frolova E. Development of Sindbis viruses encoding nsP2/GFP chimeric proteins and their application for studying nsP2 functioning. J Virol. 2007;81(10):5046–57. [PMC free article] [PubMed]
Bertolotti-Ciarlet A, Crawford SE, Hutson AM, Estes MK. The 3′ end of Norwalk virus mRNA contains determinants that regulate the expression and stability of the viral capsid protein VP1: a novel function for the VP2 protein. J Virol. 2003;77(21):11603–15. [PMC free article] [PubMed]
Biery MC, Lopata M, Craig NL. A minimal system for Tn7 transposition: the transposon-encoded proteins TnsA and TnsB can execute DNA breakage and joining reactions that generate circularized Tn7 species. J Mol Biol. 2000;297(1):25–37. [PubMed]
Bonaldo MC, Garratt RC, Caufour PS, Freire MS, Rodrigues MM, Nussenzweig RS, Galler R. Surface expression of an immunodominant malaria protein B cell epitope by yellow fever virus. J Mol Biol. 2002;315(4):873–85. [PubMed]
Bonaldo MC, Garratt RC, Marchevsky RS, Coutinho ES, Jabor AV, Almeida LF, Yamamura AM, Duarte AS, Oliveira PJ, Lizeu JO, Camacho LA, Freire MS, Galler R. Attenuation of recombinant yellow fever 17D viruses expressing foreign protein epitopes at the surface. J Virol. 2005;79(13):8602–13. [PMC free article] [PubMed]
Bonaldo MC, Mello SM, Trindade GF, Rangel AA, Duarte AS, Oliveira PJ, Freire MS, Kubelka CF, Galler R. Construction and characterization of recombinant flaviviruses bearing insertions between E and NS1 genes. Virol J. 2007;4:115. [PMC free article] [PubMed]
Bull RA, Tanaka MM, White PA. Norovirus recombination. J Gen Virol. 2007;88(Pt 12):3347–59. [PubMed]
Burke KL, Dunn G, Ferguson M, Minor PD, Almond JW. Antigen chimaeras of poliovirus as potential new vaccines. Nature. 1988;332(6159):81–2. [PubMed]
Burroughs JN, Brown F. Presence of a covalently linked protein on calicivirus RNA. J Gen Virol. 1978;41(2):443–6. [PubMed]
Carter MJ. Feline calicivirus protein synthesis investigated by western blotting. Arch Virol. 1989;108(1-2):69–79. [PubMed]
Carter MJ. Transcription of feline calicivirus RNA. Arch Virol. 1990;114(3-4):143–52. [PubMed]
Carter MJ, Milton ID, Turner PC, Meanger J, Bennett M, Gaskell RM. Identification and sequence determination of the capsid protein gene of feline calicivirus. Arch Virol. 1992;122(3-4):223–35. [PubMed]
Chang KO. Role of cholesterol pathways in norovirus replication. J Virol. 2009;83(17):8587–95. [PMC free article] [PubMed]
Chang KO, George DW. Interferons and ribavirin effectively inhibit Norwalk virus replication in replicon-bearing cells. J Virol. 2007;81(22):12111–8. [PMC free article] [PubMed]
Chang KO, George DW, Patton JB, Green KY, Sosnovtsev SV. Leader of the capsid protein in feline calicivirus promotes replication of Norwalk virus in cell culture. J Virol. 2008;82(19):9306–17. [PMC free article] [PubMed]
Chang KO, Sosnovtsev SV, Belliot G, King AD, Green KY. Stable expression of a Norwalk virus RNA replicon in a human hepatoma cell line. Virology. 2006;353(2):463–73. [PubMed]
Chaudhry Y, Skinner MA, Goodfellow IG. Recovery of genetically defined murine norovirus in tissue culture by using a fowlpox virus expressing T7 RNA polymerase. J Gen Virol. 2007;88(Pt 8):2091–100. [PMC free article] [PubMed]
Chen R, Neill JD, Estes MK, Prasad BV. X-ray structure of a native calicivirus: structural insights into antigenic diversity and host specificity. Proc Natl Acad Sci U S A. 2006;103(21):8048–53. [PubMed]
Chen R, Neill JD, Prasad BV. Crystallization and preliminary crystallographic analysis of San Miguel sea lion virus: an animal calicivirus. J Struct Biol. 2003;141(2):143–8. [PubMed]
Chhabra P, Dhongade RK, Kalrao VR, Bavdekar AR, Chitambar SD. Epidemiological, clinical, and molecular features of norovirus infections in western India. J Med Virol. 2009;81(5):922–32. [PubMed]
Coyne KP, Reed FC, Porter CJ, Dawson S, Gaskell RM, Radford AD. Recombination of Feline calicivirus within an endemically infected cat colony. J Gen Virol. 2006;87(Pt 4):921–6. [PubMed]
Craig NL. Transposon Tn7. Curr Top Microbiol Immunol. 1996;204:27–48. [PubMed]
Duffy S, Shackelton LA, Holmes EC. Rates of evolutionary change in viruses: patterns and determinants. Nat Rev Genet. 2008;9(4):267–76. [PubMed]
Evans DJ, McKeating J, Meredith JM, Burke KL, Katrak K, John A, Ferguson M, Minor PD, Weiss RA, Almond JW. An engineered poliovirus chimaera elicits broadly reactive HIV-1 neutralizing antibodies. Nature. 1989;339(6223):385–8. 340. [PubMed]
Fan ZC, Dennis JC, Bird RC. Bovine viral diarrhea virus is a suitable viral vector for stable expression of heterologous gene when inserted in between N(pro) and C genes. Virus Res. 2008;138(1-2):97–104. [PubMed]
Farkas T, Sestak K, Wei C, Jiang X. Characterization of a rhesus monkey calicivirus representing a new genus of Caliciviridae. J Virol. 2008;82(11):5408–16. [PMC free article] [PubMed]
Forrester NL, Moss SR, Turner SL, Schirrmeier H, Gould EA. Recombination in rabbit haemorrhagic disease virus: possible impact on evolution and epidemiology. Virology. 2008;376(2):390–6. [PubMed]
Fretz M, Schaffer FL. Calicivirus proteins in infected cells: evidence for a capsid polypeptide precursor. Virology. 1978;89(1):318–21. [PubMed]
Fukuda S, Sasaki Y, Takao S, Seno M. Recombinant norovirus implicated in gastroenteritis outbreaks in Hiroshima Prefecture, Japan. J Med Virol. 2008;80(5):921–8. [PubMed]
Gaskell RM. Induced upper respiratory tract diseases. 1st. Blackwell; Oxford, England: 1985.
Glass PJ, White LJ, Ball JM, Leparc-Goffart I, Hardy ME, Estes MK. Norwalk virus open reading frame 3 encodes a minor structural protein. J Virol. 2000;74(14):6581–91. [PMC free article] [PubMed]
Gorchakov R, Garmashova N, Frolova E, Frolov I. Different types of nsP3-containing protein complexes in Sindbis virus-infected cells. J Virol. 2008;82(20):10088–101. [PMC free article] [PubMed]
Green KY. Human Caliciviruses. In: Knipe DM, Howley PM, editors. Fields Virology. Lippincott Williams & Wilkins; Philadelphia, PA: 2001. pp. 841–874.
Green KY, Ando T, Balayan MS, Berke T, Clarke IN, Estes MK, Matson DO, Nakata S, Neill JD, Studdert MJ, Thiel HJ. Taxonomy of the caliciviruses. J Infect Dis. 2000;181 2:S322–30. [PubMed]
Green KY, Belliot G, Taylor JL, Valdesuso J, Lew JF, Kapikian AZ, Lin FY. A predominant role for Norwalk-like viruses as agents of epidemic gastroenteritis in Maryland nursing homes for the elderly. J Infect Dis. 2002a;185(2):133–46. [PubMed]
Green KY, Mory A, Fogg MH, Weisberg A, Belliot G, Wagner M, Mitra T, Ehrenfeld E, Cameron CE, Sosnovtsev SV. Isolation of enzymatically active replication complexes from feline calicivirus-infected cells. J Virol. 2002b;76(17):8582–95. [PMC free article] [PubMed]
Guo L, Song J, Xu X, Ren L, Li J, Zhou H, Wang M, Qu J, Wang J, Hung T. Genetic analysis of norovirus in children affected with acute gastroenteritis in Beijing, 2004-2007. J Clin Virol. 2009;44(1):94–8. [PubMed]
Hefferon KL, Khalilian H, Xu H, AbouHaidar MG. Expression of the coat protein of potato virus X from a dicistronic mRNA in transgenic potato plants. J Gen Virol. 1997;78(Pt 11):3051–9. [PubMed]
Henke A, Zell R, Ehrlich G, Stelzner A. Expression of immunoregulatory cytokines by recombinant coxsackievirus B3 variants confers protection against virus-caused myocarditis. J Virol. 2001;75(17):8187–94. [PMC free article] [PubMed]
Herbert TP, Brierley I, Brown TD. Identification of a protein linked to the genomic and subgenomic mRNAs of feline calicivirus and its role in translation. J Gen Virol. 1997;78(Pt 5):1033–40. [PubMed]
Hofling K, Tracy S, Chapman N, Kim KS, Smith Leser J. Expression of an antigenic adenovirus epitope in a group B coxsackievirus. J Virol. 2000;74(10):4570–8. [PMC free article] [PubMed]
Hurley KE, Pesavento PA, Pedersen NC, Poland AM, Wilson E, Foley JE. An outbreak of virulent systemic feline calicivirus disease. J Am Vet Med Assoc. 2004;224(2):241–9. [PubMed]
Jiang X, Espul C, Zhong WM, Cuello H, Matson DO. Characterization of a novel human calicivirus that may be a naturally occurring recombinant. Arch Virol. 1999;144(12):2377–87. [PubMed]
Jin M, Xie HP, Duan ZJ, Liu N, Zhang Q, Wu BS, Li HY, Cheng WX, Yang SH, Yu JM, Xu ZQ, Cui SX, Zhu L, Tan M, Jiang X, Fang ZY. Emergence of the GII4/2006b variant and recombinant noroviruses in China. J Med Virol. 2008;80(11):1997–2004. [PubMed]
Kapikian AZ. The discovery of the 27-nm Norwalk virus: an historic perspective. J Infect Dis. 2000;181 2:S295–302. [PubMed]
Kapikian AZ, Wyatt RG, Dolin R, Thornhill TS, Kalica AR, Chanock RM. Visualization by immune electron microscopy of a 27-nm particle associated with acute infectious nonbacterial gastroenteritis. J Virol. 1972;10(5):1075–81. [PMC free article] [PubMed]
Karst SM, Wobus CE, Lay M, Davidson J, Virgin HWt. STAT1-dependent innate immunity to a Norwalk-like virus. Science. 2003;299(5612):1575–8. [PubMed]
Lin SS, Wu HW, Elena SF, Chen KC, Niu QW, Yeh SD, Chen CC, Chua NH. Molecular evolution of a viral non-coding sequence under the selective pressure of amiRNA-mediated silencing. PLoS Pathog. 2009;5(2):e1000312. [PMC free article] [PubMed]
Love DN, Sabine M. Electron microscopic observation of feline kidney cells infected with a feline calicivirus. Arch Virol. 1975;48(3):213–28. [PubMed]
Lu HH, Alexander L, Wimmer E. Construction and genetic analysis of dicistronic polioviruses containing open reading frames for epitopes of human immunodeficiency virus type 1 gp120. J Virol. 1995;69(8):4797–806. [PMC free article] [PubMed]
Mattion NM, Reilly PA, DiMichele SJ, Crowley JC, Weeks-Levy C. Attenuated poliovirus strain as a live vector: expression of regions of rotavirus outer capsid protein VP7 by using recombinant Sabin 3 viruses. J Virol. 1994;68(6):3925–33. [PMC free article] [PubMed]
Mitra T, Sosnovtsev SV, Green KY. Mutagenesis of tyrosine 24 in the VPg protein is lethal for feline calicivirus. J Virol. 2004;78(9):4931–5. [PMC free article] [PubMed]
Moradpour D, Evans MJ, Gosert R, Yuan Z, Blum HE, Goff SP, Lindenbach BD, Rice CM. Insertion of green fluorescent protein into nonstructural protein 5A allows direct visualization of functional hepatitis C virus replication complexes. J Virol. 2004;78(14):7400–9. [PMC free article] [PubMed]
Mueller S, Wimmer E. Expression of foreign proteins by poliovirus polyprotein fusion: analysis of genetic stability reveals rapid deletions and formation of cardioviruslike open reading frames. J Virol. 1998;72(1):20–31. [PMC free article] [PubMed]
Natoni A, Kass GE, Carter MJ, Roberts LO. The mitochondrial pathway of apoptosis is triggered during feline calicivirus infection. J Gen Virol. 2006;87(Pt 2):357–61. [PubMed]
Nayak MK, Balasubramanian G, Sahoo GC, Bhattacharya R, Vinje J, Kobayashi N, Sarkar MC, Bhattacharya MK, Krishnan T. Detection of a novel intergenogroup recombinant Norovirus from Kolkata, India. Virology. 2008;377(1):117–23. [PubMed]
Nayak MK, Chatterjee D, Nataraju SM, Pativada M, Mitra U, Chatterjee MK, Saha TK, Sarkar U, Krishnan T. A new variant of Norovirus GII.4/2007 and inter-genotype recombinant strains of NVGII causing acute watery diarrhoea among children in Kolkata, India. J Clin Virol 2009 [PubMed]
Neill JD, Mengeling WL. Further characterization of the virus-specific RNAs in feline calicivirus infected cells. Virus Res. 1988;11(1):59–72. [PubMed]
Neill JD, Reardon IM, Heinrikson RL. Nucleotide sequence and expression of the capsid protein gene of feline calicivirus. J Virol. 1991;65(10):5440–7. [PMC free article] [PubMed]
Neill JD, Sosnovtsev SV, Green KY. Recovery and altered neutralization specificities of chimeric viruses containing capsid protein domain exchanges from antigenically distinct strains of feline calicivirus. J Virol. 2000;74(3):1079–84. [PMC free article] [PubMed]
Oliver SL, Asobayire E, Dastjerdi AM, Bridger JC. Genomic characterization of the unclassified bovine enteric virus Newbury agent-1 (Newbury1) endorses a new genus in the family Caliciviridae. Virology. 2006;350(1):240–50. [PubMed]
Oliver SL, Brown DW, Green J, Bridger JC. A chimeric bovine enteric calicivirus: evidence for genomic recombination in genogroup III of the Norovirus genus of the Caliciviridae. Virology. 2004;326(2):231–9. [PubMed]
Ossiboff RJ, Sheh A, Shotton J, Pesavento PA, Parker JS. Feline caliciviruses (FCVs) isolated from cats with virulent systemic disease possess in vitro phenotypes distinct from those of other FCV isolates. J Gen Virol. 2007;88(Pt 2):506–17. [PubMed]
Patel MM, Hall AJ, Vinje J, Parashar UD. Noroviruses: a comprehensive review. J Clin Virol. 2009;44(1):1–8. [PubMed]
Patel MM, Widdowson MA, Glass RI, Akazawa K, Vinje J, Parashar UD. Systematic literature review of role of noroviruses in sporadic gastroenteritis. Emerg Infect Dis. 2008;14(8):1224–31. [PMC free article] [PubMed]
Pesavento PA, Chang KO, Parker JS. Molecular virology of feline calicivirus. Vet Clin North Am Small Anim Pract. 2008;38(4):775–86. vii. [PubMed]
Peters JE, Craig NL. Tn7: smarter than we thought. Nat Rev Mol Cell Biol. 2001;2(11):806–14. [PubMed]
Peterson JE, Studdert MJ. Feline picornavirus. Structure of the virus and electron microscopic observations on infected cell cultures. Arch Gesamte Virusforsch. 1970;32(2):249–60. [PubMed]
Phan TG, Kaneshi K, Ueda Y, Nakaya S, Nishimura S, Yamamoto A, Sugita K, Takanashi S, Okitsu S, Ushijima H. Genetic heterogeneity, evolution, and recombination in noroviruses. J Med Virol. 2007a;79(9):1388–400. [PubMed]
Phan TG, Nishimura S, Sugita K, Nishimura T, Okitsu S, Ushijima H. Multiple recombinant noroviruses in Japan. Clin Lab. 2007b;53(9-12):567–70. [PubMed]
Pierson TC, Diamond MS, Ahmed AA, Valentine LE, Davis CW, Samuel MA, Hanna SL, Puffer BA, Doms RW. An infectious West Nile virus that expresses a GFP reporter gene. Virology. 2005;334(1):28–40. [PubMed]
Prasad BV, Hardy ME, Dokland T, Bella J, Rossmann MG, Estes MK. X-ray crystallographic structure of the Norwalk virus capsid. Science. 1999;286(5438):287–90. [PubMed]
Prasad BV, Matson DO, Smith AW. Three-dimensional structure of calicivirus. J Mol Biol. 1994;240(3):256–64. [PubMed]
Radford AD, Coyne KP, Dawson S, Porter CJ, Gaskell RM. Feline calicivirus. Vet Res. 2007;38(2):319–35. [PubMed]
Radford AD, Dawson S, Coyne KP, Porter CJ, Gaskell RM. The challenge for the next generation of feline calicivirus vaccines. Vet Microbiol. 2006;117(1):14–8. [PubMed]
Roberts LO, Al-Molawi N, Carter MJ, Kass GE. Apoptosis in cultured cells infected with feline calicivirus. Ann N Y Acad Sci. 2003;1010:587–90. [PubMed]
Rohayem J, Munch J, Rethwilm A. Evidence of recombination in the norovirus capsid gene. J Virol. 2005;79(8):4977–90. [PMC free article] [PubMed]
Schaffer FL, Ehresmann DW, Fretz MK, Soergel MI. A protein, VPg, covalently linked to 36S calicivirus RNA. J Gen Virol. 1980;47(1):215–20. [PubMed]
Sosnovtsev S, Green KY. RNA transcripts derived from a cloned full-length copy of the feline calicivirus genome do not require VpG for infectivity. Virology. 1995;210(2):383–90. [PubMed]
Sosnovtsev SV, Belliot G, Chang KO, Onwudiwe O, Green KY. Feline calicivirus VP2 is essential for the production of infectious virions. J Virol. 2005;79(7):4012–24. [PMC free article] [PubMed]
Sosnovtsev SV, Garfield M, Green KY. Processing map and essential cleavage sites of the nonstructural polyprotein encoded by ORF1 of the feline calicivirus genome. J Virol. 2002;76(14):7060–72. [PMC free article] [PubMed]
Sosnovtsev SV, Green KY. Identification and genomic mapping of the ORF3 and VPg proteins in feline calicivirus virions. Virology. 2000;277(1):193–203. [PubMed]
Sosnovtsev SV, Prikhod'ko EA, Belliot G, Cohen JI, Green KY. Feline calicivirus replication induces apoptosis in cultured cells. Virus Res. 2003;94(1):1–10. [PubMed]
Sosnovtsev SV, Sosnovtseva SA, Green KY. Cleavage of the feline calicivirus capsid precursor is mediated by a virus-encoded proteinase. J Virol. 1998;72(4):3051–9. [PMC free article] [PubMed]
Sosnovtseva SA, Sosnovtsev SV, Green KY. Mapping of the feline calicivirus proteinase responsible for autocatalytic processing of the nonstructural polyprotein and identification of a stable proteinase-polymerase precursor protein. J Virol. 1999;73(8):6626–33. [PMC free article] [PubMed]
Stellwagen AE, Craig NL. Avoiding self: two Tn7-encoded proteins mediate target immunity in Tn7 transposition. Embo J. 1997a;16(22):6823–34. [PubMed]
Stellwagen AE, Craig NL. Gain-of-function mutations in TnsC, an ATP-dependent transposition protein that activates the bacterial transposon Tn7. Genetics. 1997b;145(3):573–85. [PubMed]
Studdert MJ, O'Shea JD. Ultrastructural studies of the development of feline calicivirus in a feline embryo cell line. Arch Virol. 1975;48(4):317–25. [PubMed]
Teterina NL, Levenson EA, Ehrenfeld E. Viable Polioviruses Encoding 2A Proteins with Fluorescent Protein Tags. J Virol 2009 [PMC free article] [PubMed]
Thomas JM, Klimstra WB, Ryman KD, Heidner HW. Sindbis virus vectors designed to express a foreign protein as a cleavable component of the viral structural polyprotein. J Virol. 2003;77(10):5598–606. [PMC free article] [PubMed]
Thumfart JO, Meyers G. Feline calicivirus: recovery of wild-type and recombinant viruses after transfection of cRNA or cDNA constructs. J Virol. 2002;76(12):6398–407. [PMC free article] [PubMed]
Tohya Y, Shinchi H, Matsuura Y, Maeda K, Ishiguro S, Mochizuki M, Sugimura T. Analysis of the N-terminal polypeptide of the capsid precursor protein and the ORF3 product of feline calicivirus. J Vet Med Sci. 1999;61(9):1043–7. [PubMed]
Trujillo AA, McCaustland KA, Zheng DP, Hadley LA, Vaughn G, Adams SM, Ando T, Glass RI, Monroe SS. Use of TaqMan real-time reverse transcription-PCR for rapid detection, quantification, and typing of norovirus. J Clin Microbiol. 2006;44(4):1405–12. [PMC free article] [PubMed]
Vidal R, Roessler P, Solari V, Vollaire J, Jiang X, Matson DO, Mamani N, Prado V, O'Ryan ML. Novel recombinant norovirus causing outbreaks of gastroenteritis in Santiago, Chile. J Clin Microbiol. 2006;44(6):2271–5. [PMC free article] [PubMed]
Ward VK, McCormick CJ, Clarke IN, Salim O, Wobus CE, Thackray LB, Virgin HWt, Lambden PR. Recovery of infectious murine norovirus using pol II-driven expression of full-length cDNA. Proc Natl Acad Sci U S A. 2007;104(26):11050–5. [PubMed]
Waters A, Coughlan S, Hall WW. Characterisation of a novel recombination event in the norovirus polymerase gene. Virology. 2007;363(1):11–4. [PubMed]
Wobus CE, Karst SM, Thackray LB, Chang KO, Sosnovtsev SV, Belliot G, Krug A, Mackenzie JM, Green KY, Virgin HW. Replication of Norovirus in cell culture reveals a tropism for dendritic cells and macrophages. PLoS Biol. 2004;2(12):e432. [PMC free article] [PubMed]
Wolk B, Buchele B, Moradpour D, Rice CM. A dynamic view of hepatitis C virus replication complexes. J Virol. 2008;82(21):10519–31. [PMC free article] [PubMed]
Zhang X, Nuss DL. A host dicer is required for defective viral RNA production and recombinant virus vector RNA instability for a positive sense RNA virus. Proc Natl Acad Sci U S A. 2008;105(43):16749–54. [PubMed]