PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Oncogene. Author manuscript; available in PMC 2010 October 8.
Published in final edited form as:
PMCID: PMC2851846
NIHMSID: NIHMS165692

The HTLV-1 Tax Protein Cooperates with Phosphorylated CREB, TORC2, and p300 to Activate CRE-Dependent Cyclin D1 Transcription

Abstract

Adult T-cell leukemia/lymphoma is a fatal malignancy etiologically linked to infection with the human T-cell leukemia virus (HTLV-1). The virally-encoded oncoprotein Tax activates transcription of HTLV-1 and cellular genes by cooperating with cellular transcription factors. Cyclin D1 is a pivotal regulator of cell cycle progression, and increased expression strongly correlates with malignant transformation. Here, we characterize the mechanism of Tax transactivation of cyclin D1. We find that cyclin D1 transcript levels are elevated in HTLV-1 infected cells and that Tax physically associates with the cyclin D1 gene in vivo. Tax binds the cyclin D1 promoter-proximal cyclic AMP response element (CRE) in the presence of phosphorylated CREB (pCREB) in vitro, and together the Tax/pCREB complex recruits the cellular coactivator p300 to the promoter via this unconventional Tax-responsive element. We further show that Transducer of Regulated CREB 2 (TORC2) cooperates with Tax to further enhance p300 recruitment to the cyclin D1 promoter in vitro, consistent with enhanced cyclin D1 expression in the presence of Tax and TORC2. Together, our findings support a model in which Tax-induced accumulation of cyclin D1 shortens the G1 phase of the cell cycle, promotes mitotic replication of the virus, and drives selection and expansion of malignant T-cells.

Keywords: CRE, cell cycle, transducer of regulated CREB, CREB-regulated transcription co-activator, CRTC

Introduction

The human T-cell leukemia virus type 1 (HTLV-1)-encoded oncoprotein, Tax, promotes malignant transformation through disruption of diverse host-cell growth control pathways, resulting in aberrant cell division. Tax adversely influences cellular homeostasis through numerous mechanisms, including the physical interaction with cell cycle regulators and transcriptional activation of cell cycle control genes, that ultimately lead to enhanced cell division and uncontrolled proliferation (Afonso et al., 2007; Jin, 1998; Lemoine and Marriott, 2001; Matsuoka and Jeang, 2007). Of significance, Tax has been shown to activate the cell cycle regulatory genes that encode cyclin D1 and D2 (Huang et al., 2001; Mori et al., 2002). In particular, Tax was shown to stimulate cyclin D1 expression through deregulation of the NF-κB pathway (Mori et al., 2002). Cyclin D1 regulates G1 to S phase progression through formation of active complexes that phosphorylate and inactivate the retinoblastoma (RB) protein. As such, cyclin D1 deregulation is strongly correlated with the development and progression of many cancers. For example, a recent study demonstrated that enforced overexpression of cyclin D1 directly facilitates malignant transformation by promoting genomic instability via centrosome amplification, mitotic spindle abnormalities and aneuploidy (Nelsen et al., 2005).

The oncogenic properties of Tax are primarily exerted through deregulation of two major cellular transcription factor pathways: ATF/CREB and NF-κB. Tax deregulation via NF-κB represents the most prevalent means by which Tax inappropriately alters gene expression levels in the cell. It is well established that Tax activates NF-κB target genes via the sustained release of p50 and p65 from their inhibitors, with subsequent relocation of the transcription factors into the nucleus (Sun and Yamaoka, 2005). Therefore, Tax activation of the NF-κB pathway is indirect, as Tax does not physically associate with the transcription factors bound at their target genes. In contrast, Tax activation through the cellular transcription factor CREB (and possibly other ATF/CREB family members) has only been well characterized at the HTLV-1 promoter. In this case, Tax promotes strong activation of viral transcription through the formation of a promoter-bound complex containing Tax, the Ser133-phosphorylated form of CREB (pCREB) and the cellular coactivators CBP/p300. Within the HTLV-1 promoter, three conserved 21-bp repeat enhancer elements called viral CREs (vCREs) are required for Tax/pCREB complex formation. CREB binds to the central octanucleotide CRE, and Tax binding is stabilized through protein-protein interactions with CREB and protein-DNA interactions with the minor groove of the GC-rich flanks immediately adjacent to the CRE.

The Transducer of Regulated CREB (TORC) proteins have been identified as CREB co-activators that are also targeted by Tax (Bittinger et al., 2004; Conkright et al., 2003; Iourgenko et al., 2003; Koga et al., 2004; Screaton et al., 2004; Siu et al., 2006). This conserved family of proteins includes three members, called TORC1, 2, and 3. TORC1 is predominately expressed in the brain, while TORC2 and TORC3 are highly expressed in B and T cells (Conkright et al., 2003). TORCs associate with CREB and enhance CREB target gene expression (Conkright et al., 2003; Iourgenko et al., 2003). Recently, TORC proteins have been shown to directly interact with Tax and augment Tax activation of HTLV-1 transcription (Koga et al., 2004; Siu et al., 2006). Together, these studies suggest that interactions between Tax, pCREB and TORC proteins cooperate in the strong activation of HTLV-1 transcription.

It is of interest that the cyclin D1 gene is regulated by several transcription factors including NF-κB and pCREB (Castellone et al., 2009; Fox et al., 2008; Guttridge et al., 1999; Hinz et al., 1999; Lee et al., 1999), and that cyclin D1 is upregulated by Tax (Mori et al., 2002). In this study, we sought to elucidate the mechanism by which Tax activates cyclin D1 gene expression. We show that cyclin D1 transcript levels are elevated in HTLV-1 infected/transformed cell lines, and that cyclin D1 transcription is activated by Tax through both the NF-κB and CREB pathways. Unexpectedly, chromatin immunoprecipitation assays (ChIP) reveal that Tax physically interacts with the cyclin D1 promoter region in vivo. Characterization of transcription factor binding to the cyclin D1 promoter in vitro demonstrates that the promoter-proximal CRE, together with pCREB, are required for Tax binding. These data were unexpected, as the cyclin D1 CRE is not flanked by the conserved GC-rich sequences required for Tax/pCREB binding at the vCREs in the HTLV-1 promoter. We find that Tax, in complex with pCREB, significantly increases the recruitment of the cellular coactivator p300 to the cyclin D1 promoter. Moreover, TORC2 also binds the pCREB/cyclin D1 CRE complex, and further increases p300 recruitment in a Tax-dependent manner. This enhanced coactivator binding is likely directly responsible for Tax-dependent activation of cyclin D1 transcription. Together, these findings deepen our understanding of the molecular mechanisms by which Tax activates transcription of cellular genes. Furthermore, our studies suggest that a significant number of CRE-containing cellular genes may be potential targets of deregulation by Tax in the HTLV-1 infected cell. Tax deregulation of the cyclin D1 gene may be of particular significance in HTLV-1-associated disease, as chronically elevated cyclin D1 protein levels may drive cell cycle progression and the potential for malignant transformation.

Materials and Methods

Expression and purification of recombinant proteins

Bacterially expressed Tax-His6 (Zhao and Giam, 1991), CREB327 (Lopez et al., 2007), and GST-KIX (CBP aa 588–683) (Giebler et al., 1997) were purified to >98% homogeneity as previously described. CREB was phosphorylated using the catalytic subunit of protein kinase A, as previously described (Giebler et al., 1997). The His6-TORC2 expression plasmid was generated by PCR amplification of pcDNA3.1-V5-TORC2 (Siu et al., 2006) and cloned into the NdeI and HindIII restriction sites of pET3b (Novagen). His6-TORC2 was bacterially expressed and purified by Ni-NTA chromatography. Full-length His6-p300 was expressed from recombinant baculovirus in Sf9 cells and purified as previously described (Geiger et al., 2008; Kraus et al., 1999).

Antibodies

Antibodies against His (H-15), CREB-1 (C-21), p-CREB-1 (Ser-133), CBP (A-22), p300 (N-15), and RNA Pol II (H-224) were purchased from Santa Cruz, Santa Cruz, CA, USA. TORC2 was detected using the anti-His antibody. A Tax monoclonal antibody (hybridoma 168B17-46-92) was obtained from the NIH AIDS Research and Reference Reagent Program. Alexa Fluor IR700 and IR800 goat anti-mouse and goat anti-rabbit secondary antibodies were purchased from Molecular Probes-Invitrogen.

RNA Isolation and RT PCR

Cytoplasmic mRNA was isolated and reverse transcribed (Superscript II, Invitrogen) then used to amplify a cyclin D1 cDNA fragment using upstream primer 5′-GACCATCCCCCTGACGGCCGAG-3′ and downstream primer 5′-CGCACGTCGGTGGGTGTGC-3′. As an internal control, a thymidine kinase (TK) cDNA fragment was amplified using upstream primer 5′-GAGTACTCGGGTTCGTGAAC-3′ and downstream primer 5′-GGTCATGTGTGCAGAAGCTG-3′.

Transient Transfection Assays

Jurkat cells were grown to a density of 106 cells/ml and transfected with a constant amount of DNA (1 ug) using Lipofectamine reagent(Invitrogen, Carlsbad, CA, USA). After 24 hrs, the cells were harvested and lysed, and luciferaseactivity was measured using a dual-luciferase reporter assaysystem (Promega). Reporter plasmids containing the cyclin D1 promoter have been previously described (Albanese et al., 1995; Westerheide et al., 2001). Firefly luciferase activity was normalized to Renilla activity (pRL-TK, Promega, Madison, WI, USA). The expression plasmid for TORC2 (pcDNA3.1-V5-TORC2) has been previously described (Siu et al., 2006). The expression plasmids for Tax (pSG-Tax) (Rousset et al., 1996), and Tax mutants M22 (pSG-M22) and M47 (pSG-M47) have been previously described (Smith and Greene, 1990). The transient transfection assays were performed in triplicate and repeated in three independent experiments.

Chromatin Immunoprecipitation Assays

ChIP assays, real-time PCR, and data analysis were performed as previously described (Lemasson et al., 2002; Lemasson et al., 2004). The primers used to detect the cyclin D1 promoter (−83 to +42 from the initiation start site) are as follows: upstream primer 5′-CTGCCGGGCTTTGATCTTTGCTTA-3′ and downstream primer 5′-ACTCTGCTGCTCGCTGCTACT-3′. The amount of immunoprecipitated cyclin D1 promoter DNA relative to that present in the total input was calculated as previously described (Frank et al., 2001; Lemasson et al., 2004). The correlation coefficient was 0.993 and PCR efficiency was in the range of 90–110%.

Immobilized Template Assays

The immobilized cyclin D1 promoter fragments were preincubated for 20 min at 30°C in the presence of Tax and CREB (or pCREB). Recombinant p300 and/or TORC2 were added for an additional 30 min. Protein amounts are indicated in each figure legend, and binding reactions were carried out as previously described (Geiger et al., 2008). Where indicated, CEM nuclear extract (300 ug) was incubated for 1 h at 4°C following preincubation with the above recombinant purified proteins.

The biotinylated double-stranded oligonucleotides were coupled to streptavidin DynabeadsR (Invitrogen) according to the manufacturer’s instruction. The top strand of the 5′ biotinylated cyclin D1 promoter sequences of the oligonucleotides are as follows. CD1 wt: 5′-Bio/GGAATTCCTTTGATCTTTGCTTAACAACAGTAACGTCACACGGACTACAGGGGAGTTTTG TTGAAGTT-3′; CD1 mut1: 5′-Bio/GGAATTCCTTTGATCTTTGCTTAACAACAGCACGGACTACAGTTGAAGTTGCAAAGTCCT GGAGCCTC-3′; CD1 mut2: 5′-Bio/GGAATTCCTTTGATCTTTGCTTAACAACAGCACGGACTACAGGGGAGTTTTGTTGAAGTT GCAAAGTC-3′; CD1 mut3: 5′-Bio/GGAATTCCTTTGATCTTTGCTTAACAACAGTAACGTCACACGGACTACAGTTGAAGTTGC AAAGTCCT-3′.

Electrophoretic Mobility Shift Assay (EMSA)

The indicated amounts of purified CREB, Tax, and/or GST-KIX were incubated with either a 32P-end-labeled HTLV-1 vCRE or cyclin D1 CRE probe. Reactions were performed and analyzed as previously described (Kim et al., 2007). The top strand sequence of the oligonucleotide probes are as follows: HTLV-1 vCRE: 5′-TTTCAGGCGTTGACGACAACCCCTCA-3′; cyclin D1 CRE: 5′-TTGACAACAGTAACGTCACACGGACG-3′. The octanucleotide CREs are underlined.

To calculate the apparent binding affinity of Tax for the cyclin D1 CRE (in the presence of pCREB and KIX), we quantified the band intensities of the quaternary complex (Tax/pCREB/KIX/CRE) relative to the ternary complex (pCREB/KIX/CRE) over a range of Tax concentrations. The relative Kd, defined as the concentration of Tax at which 50% of the quaternary complex formed, was quantitatively determined by plotting the fraction of Tax-containing quaternary complex versus the total concentration of Tax protein (nM) in each reaction. Reactions with the vCRE probe were performed in parallel to assess the relative binding affinities of the complexes for the respective CREs.

Image Processing

The ImageQuant program (GE, Pittsburg, PA, USA) was used to quantify band intensities. Images were processed in Adobe Photoshop, with minor adjustments made to brightness/contrast as needed (gamma was kept at 1). No bands were obscured or altered. Images were annotated in PowerPoint.

Results and Discussion

Cyclin D1 transcript levels are elevated in HTLV-1-infected T-cell lines

To evaluate cyclin D1 RNA levels in HTLV-1 infected cells, we performed reverse transcriptase-polymerase chain reaction (RT-PCR). We measured cyclin D1 transcript levels in HTLV-1 infected (SLB-1 and C8166) and uninfected (Jurkat and CEM) human T-cell lines. Figure 1a shows elevated cyclin D1 transcript levels in HTLV-1 infected cells, relative to the uninfected cells, consistent with a previous study that reported enhanced cyclin D1 transcription following Tax expression (Mori et al., 2002). These data are not surprising in light of the numerous putative Tax-responsive elements in the cyclin D1 promoter, including NF-κB sites and a promoter proximal CRE (see Fig. 1b).

Figure 1
The human cyclin D1 gene is transcriptionally activated by Tax. (a) Cyclin D1 transcript levels are elevated in HTLV-1 infected T-cell lines. Cyclin D1 RNA from uninfected (Jurkat, CEM) and HTLV-1 infected (SLB-1, C81 [C816645]) cells was amplified by ...

Tax activates cyclin D1 transcription through the proximal promoter

To determine which promoter elements mediate Tax transactivation of the cyclin D1 gene, we performed transient transfection assays using a collection of cyclin D1 promoter deletion constructs driving luciferase expression (Albanese et al., 1995; Westerheide et al., 2001) (Fig. 1b). Jurkat T-cells were cotransfected with each of the deletion constructs in the absence or presence of an expression plasmid for Tax. Figure 1c shows that deletion of the upstream cyclin D1 promoter to 66 (66/Luc), relative to the start site, retained Tax responsiveness. This promoter proximal region carries a single NF-κB binding site and a single CREB-binding CRE. Although the mechanism of Tax activation through the NF-κB pathway is well established, Tax activation through cellular CREs has not been explored.

To establish which of these two pathways is utilized by Tax in the activation of cyclin D1, we performed transient transfection assays using several cyclin D1 (−66) promoter/reporter constructs bearing point mutations in the -κB and CRE elements. For reasons that remain unclear, however, the mutants gave highly inconclusive results (data not shown). We therefore performed transient transfection assays using the well-characterized Tax mutants, M22 and M47, which functionally differentiate these two pathways. M22 Tax is primarily defective for activation through NF-κB, whereas M47 Tax is defective for activation of HTLV-1 via the vCREs (Smith and Greene, 1990). As shown in figure 1d, Tax M22 was fully defective for activation of the cyclin D1 −66 reporter plasmid, whereas the Tax M47 mutant was down by approximately half. However, it is important to note that while M22 Tax is >95% defective for NF-κB, it is also 45% defective in the CREB pathway (Smith and Greene, 1990). Based on these observations, it is difficult to quantitatively establish the contribution of each pathway in mediating Tax activation through the transfected cyclin D1 proximal promoter. However, we can easily deduce that both pathways are utilized by Tax to activate cyclin D1 expression in vivo. This conclusion is further supported by our observation that co-transfection of both Tax mutants restores Tax transactivation (Fig. 1d).

Tax associates with the cyclin D1 promoter in HTLV-1 infected cells

Tax activation of NF-κB occurs via phosphorylation and degradation of IκB in the cytoplasm, leading to nuclear translocation of the transcriptionally competent NF-κB proteins (Sun and Ballard, 1999; Sun and Yamaoka, 2005). Although a previous report suggested that Tax physically binds to specific NF-κB proteins at promoter elements (Suzuki et al., 1994), subsequent studies widely support a mechanism in which Tax functions exclusively in the cytoplasm to release the NF-κB proteins, and does not physically accompany the proteins to the promoters of NF-κB-activated cellular genes. Tax activation through CREB (and other ATF/CREB family members) has been well characterized on the HTLV-1 promoter, where Tax strongly activates viral transcription through physical association with CRE-bound CREB and the adjacent minor groove GC-rich DNA (Kimzey and Dynan, 1998; Lenzmeier et al., 1998; Lundblad et al., 1998). In vitro studies indicate that cellular CREs, which lack the requisite GC-rich flanking sequences, have significantly reduced capacity for Tax binding (see [Geiger et al., 2008; Lenzmeier et al., 1998; Lundblad et al., 1998]). Consistent with this, there have been relatively few reports of Tax upregulation of cellular genes through CRE sequences (de la Fuente et al., 2006; Hiraiwa et al., 2003; Huang et al., 2001; Iwai et al., 2001; Tanaka et al., 1996; Terme et al., 2008). However, two recent studies reported Tax association with specific CRE-containing cellular gene promoters using the chromatin immunoprecipitation assay (ChIP) (de la Fuente et al., 2006; Wang et al., 2008), suggesting that Tax may physically associate with cellular CRE sequences. In addition, Tax expression further deregulates CREB-dependent cellular transcription via induction of a kinase that leads to constitutively elevated levels of serine 133 phosphorylated CREB (pCREB) (Kim et al., 2007; Trevisan et al., 2004; Trevisan et al., 2006). Together, these data provide evidence for both direct (promoter-binding) and indirect (enhanced CREB phosphorylation) mechanisms of Tax transactivation through cellular CREs.

Since the Tax-responsive cyclin D1 proximal promoter carries a CRE, we investigated whether Tax binds at the cyclin D1 promoter in vivo using the chromatin immunoprecipitation assay. We measured Tax binding at the endogenous cyclin D1 promoter in HTLV-1 infected, Tax-expressing SLB-1 T-cells and in uninfected Jurkat T-cells as a negative control. We detected elevated Tax binding at the cyclin D1 promoter only in the SLB-1 cells (Fig. 2). Consistent with this observation and the presence of elevated cyclin D1 transcript levels in these HTLV-1 infected, Tax-expressing cells (see Fig. 1a), we also detected enhanced association of the cellular coactivator CBP and RNA polymerase II at the cyclin D1 promoter. These results reveal that Tax physically associates with the endogenous cyclin D1 promoter and implicate the promoter-proximal CRE as the target site for Tax association. Together, these data support a model in which Tax binding to the CRE facilitates recruitment of CBP/p300 and RNA polymerase II, commensurate with enhanced transcription of the cyclin D1 gene.

Figure 2
Chromatin immunoprecipitation assays reveal that Tax is associated with the cyclin D1 promoter in HTLV-1 infected cells

Tax binds to the cyclin D1 proximal promoter in vitro

To decipher the molecular basis for the physical interaction between Tax and the cyclin D1 promoter, we performed in vitro immobilized template assays. Cyclin D1 proximal promoter constructs carrying either the natural sequence (wt) or a deletion of both the CRE and κB sites (ΔCRE/ΔκB) were immobilized on streptavidin-coated magnetic Dynabeads via incorporation of a biotin group on the upstream end of each template, as previously described (Geiger et al., 2008) (see Fig. 3a). The immobilized templates were incubated with nuclear extract derived from CEM cells (an HTLV-1-negative human T-cell line) in the absence or presence of highly purified Tax protein. The templates were extensively washed and promoter-bound proteins were separated by SDS-PAGE and analyzed by western blot. Figure 3B shows that CREB, present in the nuclear extract, bound to the wild-type cyclin D1 promoter, but not to the mutant ΔCRE/ΔκB promoter. Notably, we also detected the binding of Tax to the wild-type cyclin D1 promoter, but not to the mutant ΔCRE/ΔκB promoter (Fig. 3b, lane 5). These findings corroborate the in vivo ChIP assay and further show that Tax specifically associates with the functionally relevant promoter proximal region of cyclin D1.

Figure 3
The CRE is required for Tax binding at the cyclin D1 promoter in vitro

The CRE is required for Tax binding at the cyclin D1 promoter

We next sought to identify the individual contribution of the CRE and κB sites in mediating Tax association with the cyclin D1 promoter. We designed two additional cyclin D1 promoter constructs carrying targeted deletions of the individual CRE or κB recognition elements. As before, these immobilized templates were incubated with nuclear extract and highly purified Tax. Deletion of the κB site (ΔκB) had no effect on Tax binding, however, deletion of the CRE (ΔCRE) abolished association of Tax with the cyclin D1 promoter (Fig. 3c, lanes 4, 5). Finally, we did not detect Tax binding to the cyclin D1 promoter template in the absence of nuclear extract (data not shown), indicating that the physical association of Tax with the cyclin D1 promoter requires the presence of CREB (or a CREB-like factor) bound at the CRE.

Tax and pCREB together recruit p300 to the cyclin D1 promoter

We next turned our attention to the role of CREB and the cellular coactivators CBP/p300 in facilitating Tax binding to the cyclin D1 promoter. Previous studies examining the binding of Tax at the vCREs in the HTLV-1 promoter established that the Tax/pCREB complex is required for CBP/p300 recruitment, and that this recruitment is essential for strong Tax transactivation (Geiger et al., 2008; Georges et al., 2003; Kim et al., 2007; Kwok et al., 1996; Lemasson et al., 2006; Lu et al., 2002; Ramirez and Nyborg, 2007; Sharma and Nyborg, 2008). Moreover, recent studies demonstrated that the KIX domain of CBP/p300 significantly stabilizes (>60-fold) the association between Tax, pCREB and the DNA (Kim et al., 2007; Ramirez and Nyborg, 2007).

With these observations in mind, we further investigated Tax binding to the cyclin D1 promoter using the immobilized template assay and highly purified CREB, Ser133-phosphorylated CREB (pCREB), and full-length p300. We did not detect Tax binding with DNA-bound CREB or pCREB in the absence of p300 (data not shown), suggesting that Tax has a lower binding affinity for the cyclin D1 CRE than for the vCRE. This observation further supports our model in which Tax and p300 exert mutually stabilizing influences in the assembly of transcriptionally-competent promoter-bound complexes (see below, and [Geiger et al., 2008; Kim et al., 2007]). Based on these results, we proceeded to characterize Tax/CREB complex formation on the cyclin D1 promoter in the presence of full-length p300. We found that Tax binding required the presence of pCREB, as the unphosphorylated form of CREB was insufficient for detectable complex formation (Fig. 4, compare lanes 3 and 5). Together the promoter-bound Tax/pCREB complex supported the association of p300 with the cyclin D1 promoter (Fig. 4, lane 5). Similar results were obtained with purified, full-length CBP (data not shown). It is noteworthy that in the absence of Tax, pCREB alone did not support the binding of full-length p300 (Fig. 4, lane 4), consistent with our previous study (see [Geiger et al., 2008]). This observation is in sharp contrast to numerous publications that have modeled CBP/p300 binding to pCREB based on studies with the isolated KIX domain, and not the full-length coactivators. The significance of Tax-mediated p300 recruitment to the cyclin D1 promoter cannot be overstated, as p300 binding directly correlates with transcriptional output in vitro (Geiger et al., 2008), and is a hallmark of transcriptionally competent genes in vivo (Heintzman et al., 2007; Visel et al., 2009). Finally, we analyzed, in parallel, Tax, pCREB and p300 binding to the HTLV-1 vCRE (Fig. 4, lane 6). As expected, Tax and p300 binding was greater on the HTLV-1 vCRE than on the cyclin D1 CRE, correlating well with the degree of Tax-mediated transcriptional output from the respective promoters (>100-fold vs. 6–12 fold). While Tax only moderately activates the cyclin D1 gene, the 6–12 fold stimulation observed is significant for a critical cell-cycle regulator and proto-oncogene that must be stringently regulated.

Figure 4
Tax and pCREB together recruit p300 to the cyclin D1 promoter

Characterization of Tax binding to the isolated cyclin D1 CRE

Tax association with the HTLV-1 vCREs involves multiple stabilizing interactions that include: Tax binding to GC-rich minor groove sequences adjacent to the octanucleotide core CRE; Tax interaction with CREB; and the synergistic interactions between both Tax and pCREB with the KIX domain of CBP/p300 (Ramirez and Nyborg, 2007). Therefore, the unprecedented nature of Tax binding to a cellular CRE that lacks the adjacent GC-rich DNA sequences prompted us to more carefully investigate the binding of Tax to this sequence. As shown in figure 4, binding of Tax to the cyclin D1 promoter required the presence of both pCREB and p300. Based on these observations, we performed electrophoretic mobility shift assays (EMSAs) with the cyclin D1 CRE probe and purified Tax, pCREB, and the KIX domain of CBP/p300 (full-length CBP/p300 are not amenable to EMSA due to their large size). As a positive control, we analyzed Tax binding to the HTLV-1 vCRE probe in parallel. As expected based on the data presented in figure 4, we did not detect a Tax-dependent “supershift” of the pCREB/cyclin D1 CRE complex in the absence of KIX, suggesting that Tax did not enter into this complex (Fig. 5a, compare cyclin D1 CRE lanes 12 and 14 with vCRE lanes 2 and 4). However, inclusion of KIX in the binding reactions enabled Tax incorporation into the larger quaternary complex (Tax/pCREB/KIX/CRE), as visualized by the supershifted band. To estimate the relative binding affinity of Tax for the respective CREs, we titrated Tax into binding reactions containing a constant amount of pCREB and KIX, and the Tax-dependent conversion into quaternary complex was measured on both the cyclin D1 CRE and vCRE. Figure 5a shows that higher amounts of Tax were required to produce the quaternary complex on the cyclin D1 CRE, relative to the vCRE, and that the complex formed on the cyclin D1 CRE appeared to be slightly less stable during electrophoresis (Fig. 5a, compare lanes 5–10 with 15–20).

Figure 5
Tax forms a stable complex with pCREB and KIX on the cyclin D1 CRE

We next plotted the concentration of Tax against the percent conversion into the quaternary complex, and determined the apparent binding affinity based on the midpoint of the binding transition into the quaternary complex (Fig. 5b). The apparent binding affinity of Tax for the cyclin D1 CRE/pCREB/KIX complex was 14-fold lower than that for the vCRE/pCREB/KIX complex (34 nM ± 5 and 2.4 ± 0.1 nM, respectively). This 14-fold reduction in the relative binding affinity of Tax for the cyclin D1 CRE is likely due to the absence of GC-rich sequences flanking this cellular CRE. However, the binding data demonstrates that pCREB and KIX (or p300, Fig. 4) partially compensates for the absence of these conserved sequences, as both proteins significantly contribute to the overall stability of Tax on the cellular CRE DNA. These findings, coupled with the functional data shown in figure 1, clearly demonstrate that the cyclin D1 CRE is an authentic and biologically significant Tax-response element that is responsible, in part, for enhanced expression of the cyclin D1 gene.

Tax and TORC2 cooperate in cyclin D1gene activation and CRE-dependent p300 recruitment

To further characterize the molecular basis for Tax transactivation of the cyclin D1 gene, we investigated whether the TORC proteins, CREB coactivators, also participate in this process. Tax has previously been reported to directly interact with TORC-1, -2, and -3, and transient expression assays have shown that this class of proteins synergize with Tax at the vCREs to activate HTLV-1 transcription (Koga et al., 2004; Siu et al., 2006). Based on these observations, we hypothesized that these proteins facilitate Tax activation of the cyclin D1 gene through the promoter-proximal CRE. To test this hypothesis, we performed transient transfection assays using Tax and TORC expression plasmids and the cyclin D1 (−66/Luc) reporter plasmid. We initially screened all three TORC expression plasmids and found that each protein stimulated cyclin D1 expression and moderately facilitated Tax transactivation (data not shown). Specifically, transfection of TORC2 stimulated cyclin D1 approximately 6-fold, and co-transfection of Tax and TORC2 stimulated cyclin D1 approximately 20-fold (Fig. 6a). These findings indicate that Tax and TORC2 cooperate to activate expression of the cyclin D1 gene. This result is consistent with the previously reported activation of a generic cellular CRE reporter plasmid by Tax and TORC3 (Koga et al., 2004). However, the molecular basis for the observed functional cooperativity between Tax and the TORC proteins is unknown.

Figure 6
Tax and TORC2 cooperate to activate cyclin D1 via enhanced recruitment of p300

To biochemically characterize TORC2 binding at the cyclin D1 promoter, we cloned and expressed the full-length protein, and analyzed its interactions with Tax, pCREB, and p300 (Fig. 6b, c). TORC2 bound the cyclin D1 promoter in the presence of both CREB and pCREB (data not shown), but did not support p300 recruitment (Fig. 6b, lane 3). However, TORC2, in the presence of Tax, enhanced Tax-dependent p300 binding to the promoter template (Fig. 6b, compare lanes 2 and 4). The enhanced binding stability of p300 in the presence of Tax, pCREB, and TORC2 likely derives from the extensive intermolecular protein-protein interactions that take place within this elaborate DNA-bound complex. As such, the increased recruitment of p300 provided by TORC2 binding provides a molecular explanation for the functional synergy observed in vivo (Fig. 6a).

We next asked whether the cyclin D1 CRE was required for the formation of the TORC2-containing complex on the cyclin D1 proximal promoter. We compared, in parallel, the binding of these proteins to the wild-type and ΔCRE cyclin D1 promoter templates. Figure 6c shows that the formation of the pCREB/Tax/TORC2/p300 complex on the cyclin D1 promoter is CRE-dependent, as deletion of the CRE prevented complex formation. From these data, we conclude that the CRE serves as the foundation for the assembly of this large (>500 kDa) multiprotein complex on the cyclin D1 promoter.

The data presented herein establish cyclin D1 as a target of Tax transactivation in vivo, and provide a molecular basis for the functional actions of Tax. The significance of our findings resides in the molecular dissection of a novel mechanism of Tax binding to a cellular promoter, coupled with the functional outcome of these interactions. First, these data clearly establish the cyclin D1 CRE as the foundation for the assembly of a large, multi-component nucleoprotein complex that facilitates Tax transactivation of this important gene (Fig. 7). The CRE serves as the direct binding site for pCREB, which alone is insufficient for coactivator recruitment (Fig. 4 and and6;6; also see [Geiger et al., 2008]). Tax incorporation into the CRE-bound pCREB complex promotes p300 recruitment, consistent with the increase in cyclin D1 expression observed in the presence of Tax. The CREB coactivator TORC2 also enters into the pCREB/Tax/CRE complex, and serves to further enhance Tax-dependent p300 recruitment to the cyclin D1 promoter. Again, we find a direct correlation between coactivator binding in vitro and transcriptional output in vivo, as co-transfection of Tax and TORC2 produce a 20-fold increase in cyclin D1 expression.

Figure 7
Model depicting the Tax-containing transcription factor complex on the cyclin D1 CRE

Together, these findings establish a role for the promoter-proximal CRE in mediating Tax transactivation of cyclin D1. However, the relative contribution of the CRE and the adjacent κB site in conferring Tax responsiveness to the cyclin D1 gene is difficult to quantitatively discern. Although the Tax mutant M22 is well established for disabling NF-κB activation, it has a significant impact on both the NF-κB and CREB pathways (Smith and Greene, 1990). Therefore, the marked results obtained with Tax M22 on cyclin D1 reporter gene activation are likely due to defects in Tax transactivation through both the NF-κB and CREB pathways. Our observation that co-transfection of both Tax mutants restores Tax transactivation (likely due to Tax dimerization) further supports our conclusion that both pathways contribute significantly to Tax activation of cyclin D1. Finally, it is notable that the full cyclin D1 promoter carries multiple putative Tax-responsive elements that further contribute to Tax transactivation of the endogenous gene (see Fig. 1b).

These studies illuminate a novel pathway of Tax deregulation of cellular gene expression that may have important implications for HTLV-1 biology and pathogenesis. Cyclin D1 overexpression has been shown to decreases the duration of the G1 phase of the cell cycle (Tashiro et al., 2007), which would enhance viral replication via accelerated mitosis of infected cells. Additionally, this Tax-induced increase in cyclin D1 accumulation likely perturbs cellular homeostasis, creating an environment that favors the creation, selection, and proliferation of malignant T-cells.

Acknowledgments

We thank Drs. R. Pestell (Thomas Jefferson University, Philadelphia, PA) and A Baldwin (University of North Carolina) for the cyclin D1 luciferase constructs, and D.Y. Jin (University of Hong Kong) for the TORC expression plasmids. We also thank Sarah Horstmann for help with TORC2 cloning and expression and Holli Giebler for critical reading of the manuscript. This work was supported by a grant from the National Institutes of Health (CA055035).

Footnotes

Conflict of interest

The authors declare no conflict of interest.

References

  • Afonso PV, Zamborlini A, Saib A, Mahieux R. Centrosome and retroviruses: the dangerous liaisons. Retrovirology. 2007;4:27. [PMC free article] [PubMed]
  • Albanese C, Johnson J, Watanabe G, Eklund N, Vu D, Arnold A, et al. Transforming p21ras mutants and c-Ets-2 activate the cyclin D1 promoter through distinguishable regions. J Biol Chem. 1995;270:23589–97. [PubMed]
  • Bittinger MA, McWhinnie E, Meltzer J, Iourgenko V, Latario B, Liu X, et al. Activation of cAMP response element-mediated gene expression by regulated nuclear transport of TORC proteins. Curr Biol. 2004;14:2156–61. [PubMed]
  • Castellone MD, De Falco V, Rao DM, Bellelli R, Muthu M, Basolo F, et al. The beta-catenin axis integrates multiple signals downstream from RET/papillary thyroid carcinoma leading to cell proliferation. Cancer Res. 2009;69:1867–76. [PMC free article] [PubMed]
  • Conkright MD, Canettieri G, Screaton R, Guzman E, Miraglia L, Hogenesch JB, et al. TORCs: transducers of regulated CREB activity. Mol Cell. 2003;12:413–23. [PubMed]
  • de la Fuente C, Gupta MV, Klase Z, Strouss K, Cahan P, McCaffery T, et al. Involvement of HTLV-I Tax and CREB in aneuploidy: a bioinformatics approach. Retrovirology. 2006;3:43. [PMC free article] [PubMed]
  • Fox KE, Colton LA, Erickson PF, Friedman JE, Cha HC, Keller P, et al. Regulation of cyclin D1 and Wnt10b gene expression by cAMP-responsive element-binding protein during early adipogenesis involves differential promoter methylation. J Biol Chem. 2008;283:35096–105. [PMC free article] [PubMed]
  • Frank SR, Schroeder M, Fernandez P, Taubert S, Amati B. Binding of c-Myc to chromatin mediates mitogen-induced acetylation of histone H4 and gene activation. Genes Dev. 2001;15:2069–2082. [PubMed]
  • Geiger TR, Sharma N, Kim YM, Nyborg JK. The human T-cell leukemia virus type 1 tax protein confers CBP/p300 recruitment and transcriptional activation properties to phosphorylated CREB. Mol Cell Biol. 2008;28:1383–92. [PMC free article] [PubMed]
  • Georges SA, Giebler HA, Cole PA, Luger K, Laybourn PJ, Nyborg JK. Tax recruitment of CBP/p300, via the KIX domain, reveals a potent requirement for acetyltransferase activity that is chromatin dependent and histone tail independent. Mol Cell Biol. 2003;23:3392–404. [PMC free article] [PubMed]
  • Giebler HA, Loring JE, van Orden K, Colgin MA, Garrus JE, Escudero KW, et al. Anchoring of CREB binding protein to the human T-cell leukemia virus type 1 promoter: a molecular mechanism of Tax transactivation. Mol Cell Biol. 1997;17:5156–64. [PMC free article] [PubMed]
  • Guttridge DC, Albanese C, Reuther JY, Pestell RG, Baldwin AS., Jr NF-kappaB controls cell growth and differentiation through transcriptional regulation of cyclin D1. Mol Cell Biol. 1999;19:5785–99. [PMC free article] [PubMed]
  • Heintzman ND, Stuart RK, Hon G, Fu Y, Ching CW, Hawkins RD, et al. Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nat Genet. 2007;39:311–8. [PubMed]
  • Hinz M, Krappmann D, Eichten A, Heder A, Scheidereit C, Strauss M. NF-kappaB function in growth control: regulation of cyclin D1 expression and G0/G1-to-S-phase transition. Mol Cell Biol. 1999;19:2690–8. [PMC free article] [PubMed]
  • Hiraiwa N, Yabuta T, Yoritomi K, Hiraiwa M, Tanaka Y, Suzuki T, et al. Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element. Blood. 2003;101:3615–21. [PubMed]
  • Huang Y, Ohtani K, Iwanaga R, Matsumura Y, Nakamura M. Direct trans-activation of the human cyclin D2 gene by the oncogene product Tax of human T-cell leukemia virus type I. Oncogene. 2001;20:1094–102. [PubMed]
  • Iourgenko V, Zhang W, Mickanin C, Daly I, Jiang C, Hexham JM, et al. Identification of a family of cAMP response element-binding protein coactivators by genome-scale functional analysis in mammalian cells. Proc Natl Acad Sci U S A. 2003;100:12147–52. [PubMed]
  • Iwai K, Mori N, Oie M, Yamamoto N, Fujii M. Human T-cell leukemia virus type 1 tax protein activates transcription through AP-1 site by inducing DNA binding activity in T cells. Virology. 2001;279:38–46. [PubMed]
  • Jin DY, Spencer F, Jeang KT. Human T cell leukemia virus type 1 oncoprotein Tax targets the human mitotic checkpoint protein MAD1. Cell. 1998;93:81–91. [PubMed]
  • Kim YM, Ramirez JA, Mick JE, Giebler HA, Yan JP, Nyborg JK. Molecular characterization of the Tax-containing HTLV-1 enhancer complex reveals a prominent role for CREB phosphorylation in Tax transactivation. J Biol Chem. 2007;282:18750–7. [PubMed]
  • Kimzey AL, Dynan WS. Specific regions of contact between human T-cell leukemia virus type I Tax protein and DNA identified by photocross-linking. J Biol Chem. 1998;273:13768–13775. [PubMed]
  • Koga H, Ohshima T, Shimotohno K. Enhanced activation of tax-dependent transcription of human T-cell leukemia virus type I (HTLV-I) long terminal repeat by TORC3. J Biol Chem. 2004;279:52978–83. [PubMed]
  • Kraus WL, Manning ET, Kadonaga JT. Biochemical analysis of distinct activation functions in p300 that enhance transcription initiation with chromatin templates. Mol Cell Biol. 1999;19:8123–35. [PMC free article] [PubMed]
  • Kwok RP, Laurance ME, Lundblad JR, Goldman PS, Shih H, Connor LM, et al. Control of cAMP-regulated enhancers by the viral transactivator Tax through CREB and the co-activator CBP. Nature. 1996;380:642–6. [PubMed]
  • Lee RJ, Albanese C, Stenger RJ, Watanabe G, Inghirami G, Haines GK, 3rd, et al. pp60(v-src) induction of cyclin D1 requires collaborative interactions between the extracellular signal-regulated kinase, p38, and Jun kinase pathways. A role for cAMP response element-binding protein and activating transcription factor-2 in pp60(v-src) signaling in breast cancer cells. J Biol Chem. 1999;274:7341–50. [PubMed]
  • Lemasson I, Polakowski N, Laybourn PJ, Nyborg JK. Transcription factor binding and histone modifications on the integrated proviral promoter in HTLV-I-infected T-cells. J Biol Chem. 2002;277:49459–49465. [PubMed]
  • Lemasson I, Polakowski NJ, Laybourn PJ, Nyborg JK. Transcription regulatory complexes bind the human T-cell leukemia virus 5′ and 3′ long terminal repeats to control gene expression. Mol Cell Biol. 2004;24:6117–26. [PMC free article] [PubMed]
  • Lemasson I, Polakowski NJ, Laybourn PJ, Nyborg JK. Tax-dependent displacement of nucleosomes during transcriptional activation of human T-cell leukemia virus type 1. J Biol Chem. 2006;281:13075–82. [PubMed]
  • Lemoine FJ, Marriott SJ. Accelerated G(1) phase progression induced by the human T cell leukemia virus type I (HTLV-I) Tax oncoprotein. J Biol Chem. 2001;276:31851–7. [PubMed]
  • Lenzmeier BA, Giebler HA, Nyborg JK. Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter. Mol Cell Biol. 1998;18:721–731. [PMC free article] [PubMed]
  • Lopez DI, Mick JE, Nyborg JK. Purification of CREB to apparent homogeneity: Removal of truncation products and contaminating nucleic acid. Protein Expr Purif 2007 [PMC free article] [PubMed]
  • Lu H, Pise-Masison CA, Fletcher TM, Schiltz RL, Nagaich AK, Radonovich M, et al. Acetylation of nucleosomal histones by p300 facilitates transcription from tax-responsive human T-cell leukemia virus type 1 chromatin template. Mol Cell Biol. 2002;22:4450–4462. [PMC free article] [PubMed]
  • Lundblad JR, Kwok RP, Laurance ME, Huang MS, Richards JP, Brennan RG, et al. The human T-cell leukemia virus-1 transcriptional activator Tax enhances cAMP-responsive element-binding protein (CREB) binding activity through interactions with the DNA minor groove. J Biol Chem. 1998;273:19251–19259. [PubMed]
  • Matsuoka M, Jeang KT. Human T-cell leukaemia virus type 1 (HTLV-1) infectivity and cellular transformation. Nat Rev Cancer. 2007;7:270–80. [PubMed]
  • Mori N, Fujii M, Hinz M, Nakayama K, Yamada Y, Ikeda S, et al. Activation of cyclin D1 and D2 promoters by human T-cell leukemia virus type I tax protein is associated with IL-2-independent growth of T cells. Int J Cancer. 2002;99:378–85. [PubMed]
  • Nelsen CJ, Kuriyama R, Hirsch B, Negron VC, Lingle WL, Goggin MM, et al. Short term cyclin D1 overexpression induces centrosome amplification, mitotic spindle abnormalities, and aneuploidy. J Biol Chem. 2005;280:768–76. [PubMed]
  • Ramirez JA, Nyborg JK. Molecular characterization of HTLV-1 tax interaction with the KIX domain of CBP/p300. J Mol Biol. 2007;372:958–69. [PMC free article] [PubMed]
  • Rousset R, Desbois C, Bantignies F, Jalinot P. Effects on NF-kappa B1/p105 processing of the interaction between the HTLV-1 transactivator Tax and the proteasome. Nature. 1996;381:328–31. [PubMed]
  • Screaton RA, Conkright MD, Katoh Y, Best JL, Canettieri G, Jeffries S, et al. The CREB coactivator TORC2 functions as a calcium- and cAMP-sensitive coincidence detector. Cell. 2004;119:61–74. [PubMed]
  • Sharma N, Nyborg JK. The coactivators CBP/p300 and the histone chaperone NAP1 promote transcription-independent nucleosome eviction at the HTLV-1 promoter. Proc Natl Acad Sci U S A. 2008;105:7959–63. [PubMed]
  • Siu YT, Chin KT, Siu KL, Yee Wai Choy E, Jeang KT, Jin DY. TORC1 and TORC2 coactivators are required for tax activation of the human T-cell leukemia virus type 1 long terminal repeats. J Virol. 2006;80:7052–9. [PMC free article] [PubMed]
  • Smith MR, Greene WC. Identification of HTLV-I tax trans-activator mutants exhibiting novel transcriptional phenotypes. Genes Dev. 1990;4:1875–1885. [PubMed]
  • Sun SC, Ballard DW. Persistent activation of NF-kappaB by the tax transforming protein of HTLV-1: hijacking cellular IkappaB kinases. Oncogene. 1999;18:6948–6958. [PubMed]
  • Sun SC, Yamaoka S. Activation of NF-kappaB by HTLV-I and implications for cell transformation. Oncogene. 2005;24:5952–64. [PubMed]
  • Suzuki T, Hirai H, Yoshida M. Tax protein of HTLV-1 interacts with the Rel homology domain of NF-kappa B p65 and c-Rel proteins bound to the NF-kappa B binding site and activates transcription. Oncogene. 1994;9:3099–3105. [PubMed]
  • Tanaka Y, Hayashi M, Takagi S, Yoshie O. Differential transactivation of the intercellular adhesion molecule 1 gene promoter by Tax1 and Tax2 of human T-cell leukemia viruses. J Virol. 1996;70:8508–17. [PMC free article] [PubMed]
  • Tashiro E, Tsuchiya A, Imoto M. Functions of cyclin D1 as an oncogene and regulation of cyclin D1 expression. Cancer Sci. 2007;98:629–35. [PubMed]
  • Terme JM, Wencker M, Favre-Bonvin A, Bex F, Gazzolo L, Duc Dodon M, et al. Cross talk between expression of the human T-cell leukemia virus type 1 Tax transactivator and the oncogenic bHLH transcription factor TAL1. J Virol. 2008;82:7913–22. [PMC free article] [PubMed]
  • Trevisan R, Daprai L, Acquasaliente L, Ciminale V, Chieco-Bianchi L, Saggioro D. Relevance of CREB phosphorylation in the anti-apoptotic function of human T-lymphotropic virus type 1 tax protein in serum-deprived murine fibroblasts. Exp Cell Res. 2004;299:57–67. [PubMed]
  • Trevisan R, Daprai L, Paloschi L, Vajente N, Chieco-Bianchi L, Saggioro D. Antiapoptotic effect of human T-cell leukemia virus type 1 tax protein correlates with its creb transcriptional activity. Exp Cell Res. 2006;312:1390–400. [PubMed]
  • Visel A, Blow MJ, Li Z, Zhang T, Akiyama JA, Holt A, et al. ChIP-seq accurately predicts tissue-specific activity of enhancers. Nature. 2009;457:854–8. [PMC free article] [PubMed]
  • Wang D, Guo MX, Hu HM, Zhao ZZ, Qiu HL, Shao HJ, et al. Human T-cell leukemia virus type 1 oncoprotein tax represses ZNF268 expression through the cAMP-responsive element-binding protein/activating transcription factor pathway. J Biol Chem. 2008;283:16299–308. [PMC free article] [PubMed]
  • Westerheide SD, Mayo MW, Anest V, Hanson JL, Baldwin AS., Jr The putative oncoprotein Bcl-3 induces cyclin D1 to stimulate G(1) transition. Mol Cell Biol. 2001;21:8428–36. [PMC free article] [PubMed]
  • Zhao LJ, Giam CZ. Interaction of the human T-cell lymphotrophic virus type I (HTLV-I) transcriptional activator Tax with cellular factors that bind specifically to the 21-base-pair repeats in the HTLV-I enhancer. Proc Natl Acad Sci U S A. 1991;88:11445–9. [PubMed]