PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Immunol. Author manuscript; available in PMC 2010 July 1.
Published in final edited form as:
PMCID: PMC2851540
NIHMSID: NIHMS160815

TGF-β promotes Th17 cell development through inhibition of SOCS3

Abstract

TGF-β, together with IL-6 and IL-21, promotes Th17 cell development. IL-6 and IL-21 induce activation of STAT3, which is crucial for Th17 cell differentiation, as well as the expression of SOCS3, a major negative feedback regulator of STAT3-activating cytokines that negatively regulates Th17 cells. However, it is still largely unclear how TGF-β regulates Th17 cell development, and which TGF-β signaling pathway is involved in Th17 cell development. In this report, we demonstrate that TGF-β inhibits IL-6- and IL-21-induced SOCS3 expression, thus enhancing as well as prolonging STAT3 activation in naïve CD4+CD25 T cells. TGF-β inhibits IL-6-induced SOCS3 promoter activity in T cells. Also, SOCS3 siRNA knockdown partially compensates for the action of TGF-β on Th17 cell development. In mice with a dominant-negative form of TGF-β receptor II (TGF-β RII DN) and impaired TGF-β signaling, IL-6-induced CD4+ T cell expression of SOCS3 is higher, whereas STAT3 activation is lower compared to wild type B6 CD4+ T cells. Addition of a TGF-β RI kinase inhibitor that blocks Smad-dependent TGF-β signaling greatly, but not completely, abrogates the effect of TGF-β on Th17 cell differentiation. Our data indicate that inhibition of SOCS3 and thus enhancement of STAT3 activation is at least one of the mechanisms of TGF-β promotion of Th17 cell development.

Introduction

Th17 cells have been identified as a lineage distinct from Th1 and Th2 cells, and are required for induction of several autoimmune diseases, including collagen-induced arthritis, experimental autoimmune encephalitis (EAE), and inflammatory bowel disease (IBD), and also for the ability to clear bacterial infections of the intestine and the airways (16). Th17 cells produce IL-17 (IL-17A), IL-17F, IL-21, and IL-22, all of which regulate inflammatory responses by different cells. There has been an intensive interest in defining how these pathogenic T cells develop and the factors that regulate their function. Similar to Th1 and Th2 cells, Th17 cells require specific cytokines and transcription factors for their development. It has been shown that IL-6 and TGF-β initiate Th17 cell differentiation by conditioning naïve T cells to become receptive to additional cytokine signals required for differentiation towards the Th17 cell lineage through induction of IL-21, which acts in a positive feedback loop to induce more IL-21 expression. IL-21, in turn, activates IL-23R expression in the presence of TGF-β. IL-23, like IL-6 and IL-21, can then synergize with TGF-β-initiated signals to induce IL-17 and other Th17 lineage cytokines to complete the development of Th17 cells. IL-6, IL-21, and IL-23 all can activate STAT3, and such activation of STAT3 is crucial for their effects on Th17 cell differentiation (712). Over-expression of a constitutively active STAT3 in T cells promotes Th17 cell differentiation, whereas STAT3 deficiency impairs Th17 cell differentiation both in vitro and in vivo (9, 13). STAT3 regulates Th17 cell-specific transcription factors RORγt and RORα expression, key transcription factors for Th17 cell differentiation (14). Conversely, IFNγ, IL-2, IL-4, and IL-27 negatively regulate Th17 cell development (2, 3, 1517).

Although Th17 cell differentiation requires TGF-β at every stage, it is still largely unknown how TGF-β acts on Th17 cell differentiation, and which TGF-β signaling pathway is involved in Th17 cell development. In recent reports, it has been shown that TGF-β induces both Foxp3 and RORγt expression, and Foxp3 inhibits RORγt function (18, 19). IL-6 or IL-21 itself also induces low level of RORγt expression, and TGF-β greatly enhances such RORγt expression (20). IL-6 not only induces STAT3 activation in T cells, it also stimulates Suppressor Of Cytokine Signaling (SOCS)3 expression, a major negative feedback regulator of STAT3-activating cytokines (21, 22). SOCS3 negatively regulates Th17 cell development, in that SOCS3 deficiency in T cells results in higher levels of Th17 cells both in vitro and in vivo (23). In contrast, over-expression of SOCS3 in T cells results in reduced STAT3 phosphorylation, much less Th17 cell development, and significantly delayed EAE onset (24). In this report, we investigated whether TGF-β promotes Th17 cells through inhibition of SOCS3 and thus enhancement of STAT3 activation. We report here that TGF-β inhibited IL-6- and IL-21-induced SOCS3 through inhibition of SOCS3 promoter activity, thus enhancing as well as prolonging STAT3 activation in naïve CD4+CD25 T cells. In mice with a dominant-negative form of TGF-β receptor II (TGFβ RII DN) and impaired TGF-β signaling, IL-6-induced CD4+ T cell expression of SOCS3 was higher, whereas STAT3 activation was lower, compared to wild type B6 CD4+ T cells. Consistent with these results, there were less Th17 cells in the intestinal lamina propria of TGFβRII DN mice compared to wild type mice. Addition of a TGF-βRI kinase inhibitor that blocks Smad-dependent TGF-β signaling inhibited the effect of TGF-β on Th17 cell differentiation.

Materials and Methods

Mice

C57BL/6 mice were obtained from the Jackson Laboratory (Bar Harbor, ME). C57BL/6 TGF-β RII DN transgenic mice were bred in the Animal Facility at the University of Alabama at Birmingham. All experiments were reviewed and approved by the Institutional Animal Care and Use Committee of the University of Alabama at Birmingham.

Antibody and reagents

Recombinant murine IL-6, TGF-β1, and IL-21 were from R&D Systems (Minneapolis, MN). Antibodies against phospho-STAT3Tyr705 and phospho-STAT3Ser727 were from Cell Signaling Technology (Beverly, MA). Antibodies against STAT3 and actin were from Santa Cruz Biotechnology (Santa Cruz, CA). The Smad inhibitor SB505124 was from Calbiochem® Biochemicals (San Diego, CA).

Isolation of CD4+ T cells and CD4+CD25 T cells

CD4+ T cells were isolated using anti-mouse CD4-magnetic beads (BD Biosiences, San Diego, CA). Briefly, spleen and MLN cells were washed twice and incubated with anti-CD4-beads at 4°C for 30 min, and then separated by magnetic field. When checked by flow cytometry, >95% of the cells were CD4+ T cells. CD4+CD25 T cells were isolated using the CD4+CD25 T cell isolation kit from Miltenyi Biotec (Gladbach, Germany) based on the instructions provided by the manufacturer.

RNA Isolation, Riboprobes, Ribonuclease Protection Assay (RPA) and RT-PCR

Total cellular RNA was isolated from unstimulated, IL-6, IL-21, IL-6 plus TGF-β1 or IL-21 plus TGF-β1 treated CD4+ T cells. Riboprobes for murine SOCS3 and GAPDH were hybridized with 5 μg of total RNA, and analyzed by 5% denaturing (8 M urea) polyacrylamide gel electrophoresis. SOCS3 and GAPDH mRNA expression was also analyzed by RT-PCR (25). 1 μg of RNA was used to reverse transcribe mRNA into cDNA using MMLV and GAPDH reverse transcriptase and subjected to PCR with primers specific for mouse SOCS3 and GAPDH for 30 cycles of amplification. Primer sequences were as follows: SOCS3 (sense): 5′-GTTGAGCGTCAAGACCCAGT-3; SOCS-3 (antisense): 5′-CACGTTGGAGGAGAGAGGTG-3′, GAPDH (sense): 5′-AACTTTGGCATTGTGGAAGG-3′; and GAPDH (antisense): 5′-CCCTGTTGCTGTAGCCGTAT-3′.

Immunoblotting

Protein (20 μg) in cell lysates were separated on 8% SDS-PAGE and probed with phospho-STAT3 antibodies as described previously (25). Membranes were stripped and reprobed for total STAT3 and actin.

Flow cytometry

As described previously (4), cells were stimulated for 5 h with PMA (50 ng/ml) and ionomycin (750 ng/ml), with monensin added for the last 3 h of culture. After surface staining with CD4 antibody, the cells were fixed and permeabilized using Cytofix/cytoperm solution (BD Pharmingen). Staining was performed for IL-17, IFNγ, IL-10, or IL-2 using PE-or APC conjugated antibodies (BD Pharmingen), and the cells were quantitated using a FACStar flow cytometer (Becton Dickinson, Mountain View, CA). A FITC-, APC-, or PE-labeled mAb of the same isotype but irrelevant specificity was used as a negative control in all experiments.

Analysis of RORγt mRNA expression

Expression of RORγt on T cells was detected using real-time PCR with the primers 5′-CCGCTGAGAGGGCTTCAC-3′, and 5′-TGCAGGAGTAGGCCACATTACA-3′ at a final concentration of 800 nM and a FAM labeled internal probe 5′-AAGGGCTTCTTCCGCCGCAGCCAGCAG-TAMRA-3′ at a final concentration of 150 nM. As an endogenous reference, b-2 microglobulin was simultaneously measured using primers 5′CCTGCAGAGTTAAGCATGCCAG3′ and 5′TGCTTGATCACATGTCTCGATCC3′ (final concentration 30 nM) and a Texas Red labeled internal probe 5′TGGCCGAGCCCAAGACCGTCTAC3′ (final concentration 50 nM). All primers and probes were obtained from Integrated DNA Technologies, Inc. Multiplex reactions were performed using Platinum Quantitative PCR SuperMix-UDG (Invitrogen) and amplified with the cycling parameters 50°C for 2 minutes, 95°C for 2 minutes and 40 cycles of 95°C for 15 seconds and 60°C for 1 minute on a Bio-Rad iCycler.

RNA Interference

RNA interference of SOCS3 was done as previously described (26). DharmaFECT 1 siRNA transfection reagent, SMARTpool small interfering RNAs (siRNAs) specific for murine SOCS-3 and CONTROL nontargeting siRNA were purchased from Dharmacon (Lafayette, CO). Naïve CD4+ T cells (1 × 106 cells/well in twelve-well plates) were transfected with 100 nM of control or SOCS3 siRNAs using the DharmaFECT 1 reagent and Mouse T Cell Nucleofector Kit (Amaxa, Gaithersburg, MD). Twenty-four h after transfection, T cells were stimulated with IL-6, TGF-β, or both. RORγt expression was measured 48 h later by real-time PCR. IL-17 and Foxp3 were determined 5 days later by flow cytometry.

Transient Transfection of SOCS-3 Promoter-Reporter and Luciferase Assays

A 1619-bp (−1492 to +127 bp) murine SOCS-3 promoter-reporter was used as described previously (26). CD4+ T cells were cultured with anti-CD3/CD28, and 48 hrs later, the cells were washed and seeded in 12-well plates (1.5 × 106 cells/well) and transfected with the murine SOCS-3 promoter using the Mouse T Cell Nucleofector Kit. Transfected cells were treated with medium, IL-6, TGF-β1 or IL-6 plus TGF-β1 for 12 h, and luciferase activity of each sample was normalized to the total protein concentration in each well. Luciferase activity from the untreated sample was arbitrarily set at 1 for calculation of fold induction.

Statistical analysis

All experiments were repeated a minimum of three times. For comparisons between samples, levels of significance were determined by Student’s t test distribution. P values of ≤0.05 were considered to be statistically significant.

Results

TGF-β inhibits IL-6-induced SOCS3 expression and enhances STAT3 activation

Th1 and Th2 cytokines, IL-2, IL-4, and IFN-γ negatively regulate Th17 cell differentiation (2, 3, 17). TGF-β down-regulates T-bet and GATA3 function, and inhibits Th1 and Th2 differentiation and the production of IFN-γ and IL-4. TGF-β can also inhibit IL-2 production (27). Thus, the effects of TGF-β on promotion of Th17 cell differentiation may be secondary to inhibition of cytokines that block Th17 cell development. We first determined whether this was the case. CD4+ T cells from B6 mice were cultured with anti-CD3 and anti-CD28 alone, or with the addition of anti-IL-2, anti-IFNγ, and anti-IL-4 mAbs in the absence or presence of IL-6, or both IL-6 and TGF-β. Seven days later, IL-17 production by T cells was determined by flow cytometry after restimulation with PMA/ionomycin. Addition of anti-IL-2, anti-IFN-γ, and anti-IL-4 inhibited the production of those cytokines almost completely, but did not result in much IL-17 expression. Addition of IL-6 induced small amounts of Th17 cells. Addition of both IL-6 and TGFβ induced substantial Th17 cells (Figure 1A), indicating that IL-6 alone induced weak Th17 cell differentiation, TGF-β was required for substantial Th17 cell development, and blockade of Th1 and Th2 cytokines did not compensate the function of TGF-β in the induction of Th17 cell differentiation.

Figure 1Figure 1
Effect of IL-6 and TGF-β1 on Th17 cell development, expression of SOCS3 and RORγt, and activation of STAT3 in CD4+ T Cells

IL-6 and IL-21 induce STAT3 activation that in turn regulates the transcription factors RORγt and RORα in the presence of TGF-β, and thus Th17 cell differentiation (9, 11). Interestingly, although IL-6 or IL-21 can each activate STAT3 and induce low level of RORγt expression (20), neither is sufficient for Th17 cell differentiation without the action of TGF-β. One explanation is that the level of activated STAT-3 by IL-6 or IL-21 is not high enough to reach the threshold to activate the Th17 cell differentiation program, and that the action of TGF-β is to enhance STAT3 activation to reach that threshold. IL-6 stimulates STAT3 activation as well as SOCS3 expression in multiple types of cells, including T cells. SOCS3 inhibits STAT3 activation and thus represents a classic feedback inhibitor of cytokine signaling (21, 22). It has been shown that SOCS3 negatively regulates the Th17 cell pathway by inhibition of STAT3, in that mice with SOCS3 deficiency in hematopoietic and endothelial cells develop a severe joint inflammation due to enhanced responsiveness to IL-6 with a high level of IL-17 production, a hallmark cytokine of Th17 cells (28). In mice with SOCS3-deficient T cells, IL-6 and IL-23-dependent STAT3 phosphorylation is enhanced as well as prolonged, and such enhanced signaling is associated with an increase in Th17 cell development both in vitro and in vivo (23). Over-expression of SOCS3 in T cells results in reduced STAT3 phosphorylation in response to IL-6 stimulation, less Th17 cell development, and significantly delayed EAE onset (24). We postulated that TGF-β might inhibit SOCS3 expression induced by IL-6 and IL-21, thus enhancing STAT3 activation and Th17 cell development.

B6 CD4+ T cells were cultured with anti-CD3 and anti-CD28 in the presence of IL-6 alone, TGF-β alone or IL-6 plus TGF-β. As shown in Figure 1B, IL-6 stimulated naïve CD4+ T cell SOCS3 expression at each time point from 0.5 to 2 h, while TGF-β alone did not induce SOCS3 expression. Interestingly, treatment with TGF-β inhibited IL-6-induced SOCS3 expression. To determine how TGF-β inhibited IL-6-induced SOCS3 expression, we performed an analysis of potential transcription factor binding sites with the Genomatix MatInspector system. A Smad binding site (−177 to −185) was identified within the SOCS3 promoter. To determine the effect of TGF-β on SOCS3 promoter activity, CD4+ T cells were transfected with a 1619-bp (−1492 to +127 bp) murine SOCS-3 promoter-reporter as previously described (26), and treated with IL-6, TGF-β, or both IL-6 and TGF-β. As shown in Figure 1C, TGF-β inhibited IL-6-induced SOCS3 promoter activity. To determine whether TGF-β inhibition of IL-6-induced SOCS3 expression would result in enhanced STAT3 activation, STAT3 phosphorylation at both Tyr and Ser sites was measured at a series of time points from 15 min to 8 h. IL-6 stimulated STAT3 activation in naïve CD4+ T cells by 15 min, which peaked at 1 h and then declined at 2 h. Treatment with TGF-β did not affect IL-6-induced STAT3 activation at the earlier time point (15 min), but enhanced STAT-3 activation at 0.5 h and at each subsequent time point (Figure 1D). Notably, TGF-β not only enhanced, but also prolonged IL-6-induced STAT-3 activation, in that IL-6 stimulated-STAT3 activation waned at 2 h and almost disappeared at 4 h. In contrast, STAT3 activation was still strong at 4 h when naïve CD4+ T cells were treated with both IL-6 and TGF-β. TGF-β has been shown to promote Treg cell expansion. To determine whether the effect of TGF-β on STAT3 activation could be due to reduced numbers of effector T cells, CD4+CD25 T cells were cultured with anti-CD3 and anti-CD28 in the presence of IL-6, TGF-β, or IL-6 plus TGF-β, and SOCS3 expression and STAT3 activation was determined at different time points from 0.5 to 4 h. IL-6 induced both SOCS3 expression and STAT3 activation, whereas TGF-β inhibited SOCS3 expression and enhanced STAT3 activation (data not shown), similar to that of unseparated CD4+ T cells. We then examined whether this TGF-β-stimulated, prolonged STAT3 activation could enhance RORγt expression of naive CD4+ T cells. TGF-β induced RORγt expression in naive CD4+CD25 T cells, which was enhanced when cultured with both IL-6 and TGF-β. IL-6 alone induced little RORγt (Figure 1E).

It has been shown recently that TGF-β plays an important role in both Foxp3 and RORγt induction, while IL-6/STAT3 suppresses Foxp3 induction and enhances RORγt expression (18, 19). To further determine the role of TGFβ inhibition of IL-6-induced SOCS3 on Foxp3 and RORγt expression in naïve CD4+ T cells, CD4+CD25 T cells were stimulated with increasing doses of TGFβ in the absence or presence of IL-6, and SOCS3, Foxp3 and RORγt expression and IL-17 production were determined. As shown in Figure 2A, TGFβ alone did not induce SOCS3 expression at all doses, however, TGFβ inhibited IL-6-induced SOCS3 expression in a dose-dependent manner. TGFβ did not affect IL-6 induced SOCS3 expression at 0.01 ng/ml, modestly inhibited SOCS3 at 0.1 ng/ml, and then enhanced inhibition of SOCS3 with higher concentration of TGFβ (1–10 ng/ml). TGFβ alone induced low levels of IL-17 production and RORγt expression, and high levels of Foxp3 expression (Figures 2B–D). Interestingly, TGFβ induction of IL-17 production and RORγt expression was inversely correlated with the TGFβ dose, in that TGFβ induced more IL-17 and RORγt at low doses (0.1 ng/ml), and less IL-17 and RORγt at higher doses. However, TGFβ induction of Foxp3 was dose-dependent, in that Foxp3 expression increased with the increasing concentration of TGFβ. In contrast, in the presence of IL-6, TGFβ induced IL-17 production and RORγt expression in a dose-dependent manner, which correlated with the TGFβ dose-dependent inhibitory effect on SOCS3 expression. IL-6 inhibited Foxp3 induction by TGFβ at all doses. These data indicate that TGFβ inhibition of SOCS3 expression contributes to the effects of IL-6 on IL-17 production and RORγt expression, but has no direct effect on TGFβ induction of Foxp3 expression. Collectively, these results demonstrate that TGFβ inhibits IL-6-induced SOCS3 expression and thus promotes STAT3 activation, RORγt expression and Th17 cell differentiation of naïve T cells.

Figure 2
Dose response of TGFβ on expression of SOCS3, RORγt, Foxp3, and Th17 cell development in naïve CD4+ T Cells

SOCS3 knockdown in naïve CD4+CD25 T cells partially compensates for the action of TGF-β on RORγt expression and Th17 cell development

To determine the role of TGF-β inhibition of IL-6-induced SOCS3 expression on Th17 cell development, SOCS3 expression in CD4+CD25 T cells was knocked down by small interfering RNAs (siRNAs) specific for murine SOCS-3. Nontargeting siRNA was used as control. Transfection of CD4+CD25 T cells with SOCS3 siRNA, but not control siRNA, greatly inhibited IL-6-induced SOCS3 expression (Figure 3A). Transfected CD4+CD25 T cells were cultured with anti-CD3/CD28 mAbs in the presence of IL-6, TGFβ, or IL-6 and TGFβ. SOCS3 knockdown enhanced RORγt expression in CD4+CD25 T cells (Figure 3B) and Th17 development (Figure 3C) in response to IL-6. SOCS3 knockdown also enhanced RORγt expression and Th17 development if both IL-6 and TGFβ were present, suggesting that TGF-β inhibition of SOCS3 expression partially contributes to RORγt expression and Th17 development. However, TGF-β was still required for maximal Th17 cell development, even in the absence of SOCS3.

Figure 3
Effect of SOCS3 knockdown on RORγt and Th17 cell development

To determine the role of TGF-β inhibition of SOCS3 on Foxp3 and RORγt expression induced by TGF-β, SOCS3 expression in CD4+CD25 T cells was knocked down by siRNA specific for murine SOCS-3 as described above. Nontargeting siRNA was used as control. As shown previously, TGF-β induced both RORγt and Foxp3 (Figures 3B and 3D). IL-6 inhibited TGF-β induction of Foxp3 (Figure 3D). SOCS3 knockdown did not affect TGF-β induction of Foxp3 and RORγt, but enhanced IL-6 inhibition of Foxp3 expression (Figures 3B and 3D). Collectively, these data indicate that TGF-β inhibition of SOCS3 mainly enhances the function of IL-6/STAT3 pathway on inhibition of Foxp3 expression.

Higher expression of SOCS3 and lower STAT3 activation in TGFβ RII DN T cells compared to wild type T cells

To further examine the possibility that TGF-β inhibits SOCS3 expression and thus enhances STAT3 activation, we determined SOCS3 expression and STAT3 activation in CD4+ T cells from TGFβRII dominant negative transgenic (TGFβRII DN) mice, whose TGF-β signaling is greatly impaired (29). Because the intestinal lamina propria is the only site identified so far to have a population of naturally occurring Th17 cells (8), we first compared Th17 cell development in the intestinal lamina propria of wild type (WT) and TGFβRII DN mice. Th17 cells were reduced in the intestinal lamina propria in TGFβRII DN mice compared to that of WT mice (Figure 4A). To determine the effect of TGF-β on IL-6-induced SOCS3 expression and STAT3 activation, CD4+ T cells from WT and TGFβRII DN mice were stimulated with IL-6 and TGFβ alone or together, and SOCS3 expression and STAT3 activation were assessed. As shown in Figures 4C and D, IL-6 induced a higher level of SOCS3 expression in TGFβRII DN CD4+ T cells compared to that of WT CD4+ T cells, suggesting that endogenous TGF-β in wild type CD4+ T cells could inhibit SOCS-3 expression. TGF-β no longer enhanced STAT-3 activation induced by IL-6 in TGF-βRII DN CD4+ T cells (Figure 4D). There was also a lower level of RORγt expression and Th17 cell differentiation in IL-6 plus TGF-β-stimulated CD4+ T cells from TGFβRII DN mice (Figure 4B).

Figure 4
Less Th17 cells in lamina propria of TGFβRII DN mice and lower RORγt expression of TGFβRII DN CD4+ T cells stimulated with IL-6 and TGF-β

TGF-βRI kinase inhibitor blocks effect of TGF-β on Th17 cell differentiation

The active form of TGF-β initially engages a receptor comprised of TGFβ RI and TGFβ RII. Binding results in activation of downstream signal transduction by either a Smad-dependent or Smad-independent pathways (27). The Smad-dependent pathway involves phosphorylation of Smad2 and Smad3, which translocate into the nucleus in complex with Smad4. The Smad-independent pathway involves activation of other mediators such as the mitogen-activated protein kinases (MAPKs) ERK, Jun N-terminal kinase (JNK), and Rho family members. We next determined which pathway mediates the effect of TGF-β on SOCS3 expression, STAT3 activation, and Th17 cell differentiation. CD4+ T cells were cultured under Th17 polarization conditions with IL-6 and TGF-β in the absence or presence of an inhibitor of TGFβ RI, SB505124. This small-molecule inhibitor selectively and concentration dependently inhibits TGF-β-induced Smad activation through ALK-4, -5, and -7 (30). As shown in Figure 5A, addition of SB505124 greatly inhibited CD4+ T cell IL-17 production (~80%), but increased IFN-γ and IL-2 production. Addition of SB505124 had no effect on IL-10 production. TGF-β not only promotes Th17 cell development but also promotes regulatory T cells by induction of Foxp3 (31). When SB505124 was added at the dose of 1 μM to CD4+ T cells cultured with TGF-β, Foxp3 expression induced by TGF-β was completely abrogated (Figure 5B), suggesting that this dose of SB505124 completely blocks Smad-dependent TGF-β signaling pathway. However, addition of SB505124 at the same dose in Th17 culture conditions inhibited only ~ 80% of IL-17 production (Figure 5A). These data raise the possibility that TGF-β induction of Foxp3 expression and Treg cell differentiation is Smad-dependent, whereas although TGF-β promotion of Th17 cell development is mediated predominantly by the Smad-dependent pathway, a Smad-independent pathway could also be involved, although to a lesser extent. Addition of SB505124 blocked TGF-β inhibition of IL-6-induced SOCS3 expression (Figure 5C), and resulted in a lower level of STAT3 activation (Figure 5D).

Figure 5
The effect of TGFβ RI kinase inhibitor, SB505124, on Th17 and Treg differentiation, STAT3 activation, and SOCS3 mRNA expression in CD4+ T cells

TGF-β inhibits IL-21-induced SOCS3 expression and enhances STAT3 activation

The combination of IL-21 and TGF-β is able to differentiate naive T cells into Th17 cells in the absence of IL-6 (1012). Although IL-21 has been shown to activate STAT3, a key signaling event for Th17 cell differentiation, it is still unclear whether it also induces SOCS3 as does IL-6. B6 CD4+ T cells were cultured with anti-CD3 and anti-CD28 plus IL-21 in the absence or presence of TGF-β, and SOCS3 expression and STAT-3 activation were measured. Similar to CD4+ T cells stimulated with IL-6, IL-21 also stimulated SOCS3 expression, and treatment with TGF-β greatly inhibited such SOCS3 expression (Figure 6A). Interestingly, similar to IL-6, IL-21-stimulated STAT3 activation started at 15 min, peaked at 0.5–1 h, and then subsided gradually (Figure 6B). Treatment with TGF-β not only enhanced, but also prolonged, IL-21 induced STAT3 activation. This finding suggests that TGF-β inhibition of SOCS3 and promotion of STAT3 activation is not specific for IL-6 signaling, but presents a common pathway for TGF-β modulation of Th17 cell differentiation.

Figure 6
IL-21- and TGF-β-induced SOCS3 expression and STAT3 activation in CD4+ T cells

Discussion

Our data demonstrate that TGF-β promotes as well as prolongs STAT-3 activation induced by IL-6 and IL-21 through inhibition of SOCS3 expression. The inhibition of SOCS3 by TGF-β releases the negative regulation of STAT3 activation by SOCS3, and result in enhanced STAT3 activation and Th17 cell differentiation. This cross-talk between TGF-β and the downstream signaling molecules of IL-6 and IL-21 plays a crucial role for Th17 cell development, and could be at least one of the mechanisms by which TGF-β affects Th17 cell differentiation. A recent report by Yoshimura’s group showed that Th17 cell differentiation was impaired in SOCS1-deficient mice, probably due to STAT3 suppression by enhanced SOCS3 expression through hyper-STAT1 activation (24). Interestingly, TGF-β-mediated Smad transcriptional activity was severely impaired in these SOCS1-deficient T cells, and in this case, TGF-β signaling no longer inhibited SOCS3 expression, and thus resulted in a high level of SOCS3 expression and decreased STAT3 activation and defective Th17 cell development. IFNγ and IL-4 have been shown to inhibit the Th17 pathway, however, the mechanisms involved are still unknown. In contrast to TGF-β, which inhibits SOCS3 expression, IFNγ and IL-4 are able to induce SOCS3 expression (32). However, IL-4-induced STAT6 activation was not affected in SOCS3-deficient T cells, indicating it is not likely that SOCS3 directly regulates IL-4 signaling. Instead, IFNγ and IL-4 induction of SOCS3 expression could contribute to their inhibitory effect on Th17 cell differentiation.

It has been shown recently that TGF-β plays an important role in both Foxp3 and RORγt induction, while IL-6/STAT3 suppresses Foxp3 induction (18, 19). Interestingly, knockdown of SOCS3 expression in CD4+CD25 T cells by siRNA did not affect TGF-β induction of Foxp3 and RORγt, but enhanced the ability of IL-6 to induce RORγt and Th17 development, while suppressing Foxp3, suggesting that TGF-β inhibition of SOCS3 mainly enhances the IL-6/STAT3 pathway. SOCS3 knockdown can partially compensate for the role of TGF-β, however, TGF-β is still required for maximum Th17 cell development even in the absence of SOCS3.

Both Smad-dependent and Smad-independent pathways have been implicated in the function of TGF-β (27). It is still unclear which pathway is used for Th17 cell development. When CD4+ T cells were cultured in the Th17 polarization condition with IL-6 and TGF-β in the presence of SB 505124, the inhibitor of TGFβ RI kinase which specifically inhibits Smad-dependent pathway, the TGF-β-driven Th17 cell pathway was greatly blocked, in that addition of SB 505124 blocked TGF-β-induced inhibition of SOCS3 expression and enhancement of STAT3 activation, as well as Th17 cell differentiation. Of note, when SB505124 was added at the dose of 1 μM into CD4+ T cells cultured with TGF-β, Foxp3 expression induced by TGF-β was completely abrogated, suggesting that SB505124 at the dose of 1 μM could complete block Smad-dependent TGF-β signaling pathway. However, addition of SB 505124 at the same dose in Th17 culture condition inhibited about 80% of IL-17 production. These data raise the possibility that TGF-β induction of Foxp3 expression and Treg cell differentiation is Smad-dependent, whereas although TGF-β promotion of Th17 cell development is mediated predominantly by the Smad-dependent pathway, a Smad-independent pathway could also be involved, although to a lesser extent. The SB505124 inhibition of Th17 cell development from our study suggests that this TGF-β inhibitor could work as well on various autoimmune diseases that are mediated by Th17 cells.

Acknowledgments

This work was supported by research grants from NIH grants NS45290, and NS45290, PO1 DK071176, and DK60132, DK079918, NMSS grants RG-3892, PP-1475, and Digestive Diseases Research Development Center (grant DK064400).

Abbreviations used

SOCS3
Suppressor Of Cytokine Signaling 3
TGF-β RII DN
dominant-negative form of TGF-β receptor II
STAT3
signal transducer and activator of transcription 3
TGFβ
transforming growth factorβ
IL
interleukin

References

1. Cua DJ, Sherlock J, Chen Y, Murphy CA, Joyce B, Seymour B, Lucian L, To W, Kwan S, Churakova T, Zurawski S, Wiekowski M, Lira SA, Gorman D, Kastelein RA, Sedgwick JD. Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain. Nature. 2003;421:744–748. [PubMed]
2. Harrington LE, Hatton RD, Mangan PR, Turner H, Murphy TL, Murphy KM, Weaver CT. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol. 2005;6:1123–1132. [PubMed]
3. Park H, Li Z, Yang XO, Chang SH, Nurieva R, Wang YH, Wang Y, Hood L, Zhu Z, Tian Q, Dong C. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol. 2005;6:1133–1141. [PMC free article] [PubMed]
4. Elson CO, Cong Y, Weaver CT, Schoeb TR, McClanahan TK, Fick RB, Kastelein RA. Monoclonal anti-interleukin 23 reverses active colitis in a T cell-mediated model in mice. Gastroenterology. 2007;132:2359–2370. [PubMed]
5. Zheng Y, Valdez PA, Danilenko DM, Hu Y, Sa SM, Gong Q, Abbas AR, Modrusan Z, Ghilardi N, de Sauvage FJ, Ouyang W. Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat Med. 2008;14:282–289. [PubMed]
6. Aujla SJ, Chan YR, Zheng M, Fei M, Askew DJ, Pociask DA, Reinhart TA, McAllister F, Edeal J, Gaus K, Husain S, Kreindler JL, Dubin PJ, Pilewski JM, Myerburg MM, Mason CA, Iwakura Y, Kolls JK. IL-22 mediates mucosal host defense against Gram-negative bacterial pneumonia. Nat Med. 2008;14:275–281. [PMC free article] [PubMed]
7. Mangan PR, Harrington LE, O’Quinn DB, Helms WS, Bullard DC, Elson CO, Hatton RD, Wahl SM, Schoeb TR, Weaver CT. Transforming growth factor-beta induces development of the T(H)17 lineage. Nature. 2006;441:231–234. [PubMed]
8. Ivanov, McKenzie BS, Zhou L, Tadokoro CE, Lepelley A, Lafaille JJ, Cua DJ, Littman DR. The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell. 2006;126:1121–1133. [PubMed]
9. Yang XO, Panopoulos AD, Nurieva R, Chang SH, Wang D, Watowich SS, Dong C. STAT3 regulates cytokine-mediated generation of inflammatory helper T cells. J Biol Chem. 2007;282:9358–9363. [PubMed]
10. Nurieva R, Yang XO, Martinez G, Zhang Y, Panopoulos AD, Ma L, Schluns K, Tian Q, Watowich SS, Jetten AM, Dong C. Essential autocrine regulation by IL-21 in the generation of inflammatory T cells. Nature. 2007;448:480–483. [PubMed]
11. Zhou L, Ivanov, Spolski R, Min R, Shenderov K, Egawa T, Levy DE, Leonard WJ, Littman DR. IL-6 programs T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways. Nat Immunol. 2007;8:967–974. [PubMed]
12. Korn T, Bettelli E, Gao W, Awasthi A, Jager A, Strom TB, Oukka M, Kuchroo VK. IL-21 initiates an alternative pathway to induce proinflammatory T(H)17 cells. Nature. 2007;448:484–487. [PMC free article] [PubMed]
13. Harris TJ, Grosso JF, Yen HR, Xin H, Kortylewski M, Albesiano E, Hipkiss EL, Getnet D, Goldberg MV, Maris CH, Housseau F, Yu H, Pardoll DM, Drake CG. Cutting edge: An in vivo requirement for STAT3 signaling in TH17 development and TH17-dependent autoimmunity. J Immunol. 2007;179:4313–4317. [PubMed]
14. Yang XO, Pappu BP, Nurieva R, Akimzhanov A, Kang HS, Chung Y, Ma L, Shah B, Panopoulos AD, Schluns KS, Watowich SS, Tian Q, Jetten AM, Dong C. T helper 17 lineage differentiation is programmed by orphan nuclear receptors ROR alpha and ROR gamma. Immunity. 2008;28:29–39. [PMC free article] [PubMed]
15. Batten M, Li J, Yi S, Kljavin NM, Danilenko DM, Lucas S, Lee J, de Sauvage FJ, Ghilardi N. Interleukin 27 limits autoimmune encephalomyelitis by suppressing the development of interleukin 17-producing T cells. Nat Immunol. 2006;7:929–936. [PubMed]
16. Amadi-Obi A, Yu CR, Liu X, Mahdi RM, Clarke GL, Nussenblatt RB, Gery I, Lee YS, Egwuagu CE. TH17 cells contribute to uveitis and scleritis and are expanded by IL-2 and inhibited by IL-27/STAT1. Nat Med. 2007;13:711–718. [PubMed]
17. Laurence A, Tato CM, Davidson TS, Kanno Y, Chen Z, Yao Z, Blank RB, Meylan F, Siegel R, Hennighausen L, Shevach EM, O’Shea J. Interleukin-2 signaling via STAT5 constrains T helper 17 cell generation. Immunity. 2007;26:371–381. [PubMed]
18. Zhou L, Lopes JE, Chong MM, Ivanov, Min R, Victora GD, Shen Y, Du J, Rubtsov YP, Rudensky AY, Ziegler SF, Littman DR. TGF-beta-induced Foxp3 inhibits T(H)17 cell differentiation by antagonizing RORgammat function. Nature. 2008;453:236–240. [PMC free article] [PubMed]
19. Ichiyama K, Yoshida H, Wakabayashi Y, Chinen T, Saeki K, Nakaya M, Takaesu G, Hori S, Yoshimura A, Kobayashi T. Foxp3 inhibits RORgammat-mediated IL-17A mRNA transcription through direct interaction with RORgammat. J Biol Chem. 2008;283:17003–17008. [PubMed]
20. Suto A, Kashiwakuma D, Kagami S, Hirose K, Watanabe N, Yokote K, Saito Y, Nakayama T, Grusby MJ, Iwamoto I, Nakajima H. Development and characterization of IL-21-producing CD4+ T cells. J Exp Med. 2008;205:1369–1379. [PMC free article] [PubMed]
21. Lang R, Pauleau AL, Parganas E, Takahashi Y, Mages J, Ihle JN, Rutschman R, Murray PJ. SOCS3 regulates the plasticity of gp130 signaling. Nat Immunol. 2003;4:546–550. [PubMed]
22. Croker BA, Krebs DL, Zhang JG, Wormald S, Willson TA, Stanley EG, Robb L, Greenhalgh CJ, Forster I, Clausen BE, Nicola NA, Metcalf D, Hilton DJ, Roberts AW, Alexander WS. SOCS3 negatively regulates IL-6 signaling in vivo. Nat Immunol. 2003;4:540–545. [PubMed]
23. Chen Z, Laurence A, Kanno Y, Pacher-Zavisin M, Zhu BM, Tato C, Yoshimura A, Hennighausen L, O’Shea JJ. Selective regulatory function of Socs3 in the formation of IL-17-secreting T cells. Proc Natl Acad Sci U S A. 2006;103:8137–8142. [PubMed]
24. Tanaka K, Ichiyama K, Hashimoto M, Yoshida H, Takimoto T, Takaesu G, Torisu T, Hanada T, Yasukawa H, Fukuyama S, Inoue H, Nakanishi Y, Kobayashi T, Yoshimura A. Loss of suppressor of cytokine signaling 1 in helper T cells leads to defective Th17 differentiation by enhancing antagonistic effects of IFN-gamma on STAT3 and Smads. J Immunol. 2008;180:3746–3756. [PubMed]
25. Qin H, Roberts KL, Niyongere SA, Cong Y, Elson CO, Benveniste EN. Molecular mechanism of lipopolysaccharide-induced SOCS-3 gene expression in macrophages and microglia. J Immunol. 2007;179:5966–5976. [PubMed]
26. Qin H, Niyongere SA, Lee SJ, Baker BJ, Benveniste EN. Expression and functional significance of SOCS-1 and SOCS-3 in astrocytes. J Immunol. 2008;181:3167–3176. [PMC free article] [PubMed]
27. Li MO, Wan YY, Sanjabi S, Robertson AK, Flavell RA. Transforming growth factor-beta regulation of immune responses. Annu Rev Immunol. 2006;24:99–146. [PubMed]
28. Wong PK, Egan PJ, Croker BA, O’Donnell K, Sims NA, Drake S, Kiu H, McManus EJ, Alexander WS, Roberts AW, Wicks IP. SOCS-3 negatively regulates innate and adaptive immune mechanisms in acute IL-1-dependent inflammatory arthritis. J Clin Invest. 2006;116:1571–1581. [PubMed]
29. Joseph H, Gorska AE, Sohn P, Moses HL, Serra R. Overexpression of a kinase-deficient transforming growth factor-beta type II receptor in mouse mammary stroma results in increased epithelial branching. Mol Biol Cell. 1999;10:1221–1234. [PMC free article] [PubMed]
30. DaCosta Byfield S, Major C, Laping NJ, Roberts AB. SB-505124 is a selective inhibitor of transforming growth factor-beta type I receptors ALK4, ALK5, and ALK7. Mol Pharmacol. 2004;65:744–752. [PubMed]
31. Chen W, Jin W, Hardegen N, Lei KJ, Li L, Marinos N, McGrady G, Wahl SM. Conversion of peripheral CD4+CD25− naive T cells to CD4+CD25+ regulatory T cells by TGF-beta induction of transcription factor Foxp3. J Exp Med. 2003;198:1875–1886. [PMC free article] [PubMed]
32. Yoshimura A, Naka T, Kubo M. SOCS proteins, cytokine signalling and immune regulation. Nat Rev Immunol. 2007;7:454–465. [PubMed]