PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of biolreprodLink to Publisher's site
 
Biol Reprod. 2009 August; 81(2): 243–249.
Published online 2009 April 8. doi:  10.1095/biolreprod.109.076216
PMCID: PMC2849828

Rapid Effect of GNRH1 on Follicle-Stimulating Hormone Beta Gene Expression in LbetaT2 Mouse Pituitary Cells Requires the Progesterone Receptor1

Abstract

Gonadotropin-releasing hormone (GNRH) activates the progesterone receptor (PGR) in pituitary cells and accentuates gonadotropin expression. We show that GNRH1 increases Fshb mRNA levels in LbetaT2 mouse pituitary cells within 8 h and is three times more effective than GNRH2. By contrast, GNRH1 and GNRH2 do not affect Lhb gene expression in these cells. Within the same time frame, small interfering RNA (siRNA) knockdown of the PGR in LbetaT2 cells reduced GNRH1 activation of a PGR response element (PRE)-driven luciferase reporter gene and Fshb mRNA levels by >50%. Chromatin immunoprecipitation (ChIP) assays also demonstrated that PGR loading on the PRE within the Fshb gene promoter in LbetaT2 cells occurred within 8 h after GNRH1 treatment and was lost by 24 h. While the GNRH1-induced upregulation of the PRE reporter gene and Fshb mRNA levels was attenuated by cotreatment with protein kinase A (H-89) and protein kinase C (GF109203X) inhibitors, only GF109203X inhibited PGR phosphorylation at Ser249 in LbetaT2 cells. Immunoprecipitation assays also showed a progressive increase in the interaction between the PGR and its coactivator NCOA3 that peaked at 8 h coincident with the increase in Fshb mRNA after GNRH1 treatment. The siRNA-mediated knockdown of NCOA3 in LbetaT2 cells also reduced Fshb mRNA levels after GNRH1 treatment and loading of NCOA3 on the Fshb promoter PRE in a ChIP assay. We conclude that the rapid effect of GNRH1 on Fshb expression in LbetaT2 cells is mediated by PGR phosphorylation and loading at the PRE within the Fshb promoter together with NCOA3.

Keywords: ChIP, coactivators, follicle-stimulating hormone, gene regulation, gonadotropin-releasing hormone, gonadotropins, ligand-independent activation, mechanisms of hormone action, progesterone receptor, protein kinase C

INTRODUCTION

Intracellular progesterone receptors (PGRs) are ligand-inducible transcription factors that mediate the majority of progesterone effects on neuroendocrine functions [1]. There are two PGR isoforms, PGR A and PGR B [2], which possess a conserved multifunctional carboxyl-terminal ligand-binding domain that is also involved in ligand-dependent transactivation and receptor dimerization. The two PGR isoforms have different amino-terminal regions that possess unique constitutive activation functions [3]. Most important, the PGR undergoes conformational modifications upon ligand binding and interacts with coactivators, including members of the steroid receptor coactivator family [4], to efficiently orchestrate the responses of progesterone-regulated genes [57].

Activation of PGR and other nuclear hormone receptors was initially considered to be entirely ligand dependent [8]. However, many steroid receptors, including the PGR, are activated in the absence of their ligands by alterations in phosphorylation status [911]. For instance, the PGR can be activated by signaling pathways, including cAMP, phorbol esters, dopamine, epidermal growth factor, and phosphatase inhibitors [12, 13]. Gonadotropin-releasing hormone (GNRH) activates protein kinase A (PKA) and protein kinase C (PKC), and this influences the effects of PGR on gonadotropin gene expression in mouse pituitary cell lines [14, 15].

Hypothalamic GNRH stimulates pituitary gonadotropins to induce the synthesis of the common gonadotropin α subunit (CGA), as well as the follicle-stimulating hormone (FSH) β- and luteinizing hormone (LH) β-specific subunits [16]. Gonadotropins function mainly on the ovaries to regulate folliculogenesis, ovulation, and steroidogenesis. Steroid hormones, including estradiol and progesterone, exert both positive and negative feedback on the hypothalamic-pituitary system and have an important role in the GNRH self-priming effect [1719], which is defined by enhanced gonadotropin secretion from pituitary gonadotropins in response to a second stimulation by GNRH [20]. This response appears to depend on the capacity of estrogens to induce PGR expression in gonadotropins [20] and is completely absent in PGR knockout mice [21]. Therefore, it has been suggested that the gonadotropin GNRH receptor prompts a signaling pathway that activates the PGR in a ligand-independent manner [22] and that this mediates the GNRH self-priming effect.

We have previously demonstrated that GNRH1 enhances PGR phosphorylation at Ser249 and the subsequent recruitment of its coactivator NCOA3 and that this is essential for the GNRH-mediated activation of PGR-responsive genes in mouse αT3–1 pituitary cells and the Cga subunit gene in particular [15]. Because αT3–1 cells do not express gonadotropin β subunit genes and are considered developmentally immature [23], we have used LβT2 mouse pituitary cells, which express both gonadotropin β genes and the Cga gene, to further explore the role of PGR in mediating the rapid induction of gonadotropin β subunit gene expression by GNRH.

MATERIALS AND METHODS

Materials

The GNRH1 agonist (D-Trp6)-GnRH, PKA inhibitor (H-89), estradiol, and progesterone were purchased from Sigma-Aldrich Canada Ltd. (Oakville, ON, Canada). The GNRH2 analogue D-Arg(6)-Azagly(10)-NH2 was purchased from Bachem Americas, Inc. (Torrance, CA). The PKC inhibitor GF109203X was purchased from EMD Biosciences, Inc. (Madison, WI).

Cells and Cell Culture

The mouse gonadotropin-derived LβT2 cell line was provided by Dr. P.L. Mellon (Department of Reproductive Medicine, University of California, San Diego, CA) and maintained in Dulbecco modified Eagle medium (DMEM) (Invitrogen Inc., Burlington, ON, Canada) supplemented with 10% fetal bovine serum (FBS; Hyclone Laboratories Inc., Logan, UT) at 37°C in a humidified atmosphere of 5% CO2 in air. The cells were passaged when they reached 90% confluence using a trypsin-edetic acid (EDTA) solution (0.05% trypsin and 0.5 mM EDTA).

Plasmids and Small Interfering RNAs

A PRE luciferase reporter plasmid containing two copies of a consensus PGR response element (PRE) upstream of the thymidine kinase promoter was provided by Dr. D.P. McDonnell (Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, NC). The small interfering RNAs (siRNAs) for NCOA3 [24] and PGR were obtained from Qiagen Inc. (Mississauga, ON, Canada) together with a nonspecific siRNA as a negative control.

Transient Transfection Assay

Transient transfections of the PRE luciferase reporter gene or siRNAs were performed using FuGENE 6 (Roche Diagnostics, Quebec, QC, Canada) following the manufacturer's procedure. Briefly, 4 × 105 cells were seeded into six-well tissue culture plates for 2 days before transfection in 2 ml of phenol red-free DMEM (Invitrogen Inc.) containing 10% charcoal-dextran-treated FBS, which was used as the standard culture medium in all experiments. One microgram of the PRE luciferase reporter plasmid and 0.5 μg of Rous sarcoma virus (RSV)-lacZ were transiently transfected in LβT2 cells for 24 h, followed by 48-h incubation in culture medium containing estradiol (0.2 nM) before treatments with GNRH (GNRH1 or GNRH2) or progesterone. Cellular lysates were collected with 150 μl of reporter lysis buffer (Promega, Madison, WI) and assayed for luciferase activity using the Luciferase Assay System (Promega). The β-galactosidase Enzyme Assay System (Promega) was used to measure β-galactosidase expression from the RSV-lacZ plasmid, and promoter activities were expressed as luciferase activity or β-galactosidase activity.

Immunoprecipitation and Western Blot Analysis

Briefly, cell lysates were incubated with PGR A/B antibody (10 μg/ml, catalog No. sc-538; Santa Cruz Biotechnology Inc., Santa Cruz, CA) or PGR B antibody (10 μg/ml, catalog No. sc-811; Santa Cruz Biotechnology Inc.) individually, followed by application of the antibody capture reagent provided in a immunoprecipitation kit (Upstate Biotechnology Inc., Danvers, MA) and incubation at 4°C overnight as recommended by the kit manufacturer. The immunoprecipitated proteins were then subjected to electrophoresis on an 8% SDS-PAGE gel and electrotransferred to a nitrocellulose membrane (Biorad Laboratories, Hercules, CA). The membrane was incubated with specific primary antibodies (NCOA3 [catalog No. sc-5305] and β-actin [catalog No. sc-1615]; Santa Cruz Biotechnology Inc.) at 4°C overnight. After washing, antigen-bound primary antibodies were detected by incubation with horseradish peroxidase-conjugated secondary antibody for 1 h and visualized using the ECL system (GE Healthcare Bioscience, Piscataway, NJ).

Real-Time RT-PCR

Total RNA (2.5 μg) was reverse transcribed into cDNA using a first-strand cDNA synthesis kit (GE Healthcare Bioscience). The primers used for real-time RT-PCR were designed using Primer Express Software version 2.0 (Applied Biosystems, Foster City, CA). The following oligonucleotide primer pairs were used: Fshb mRNA sense, 5′-CCCAGCTCGGCCCAATA and antisense, 5′- GCAATCTTACGGTCTCGTATACCA; Lhb sense, 5′-GGCCGCAGAGAATGAGTTCT and antisense, 5′-CTCGGACCATGCTAGGACAGTAG; and Gapdh sense, 5′-CATGGCCTTCCGTGTTCCTA and antisense, 5′-GCGGCACGTCAGATCCA. Real-time PCR was performed using the ABI prism 7000 Sequence 10 Detection System (Applied Biosystems). The reactions were set up with 16.5 μl of SYBRR Green PCR Master Mix (Applied Biosystems). Negative controls containing water instead of sample cDNA were used in each assay. Relative quantification of the mRNA levels for Fshb and Lhb in LβT2 cells was performed using the comparative threshold method with Gapdh as an endogenous control and with the formula 2−ΔΔCt as recommended in the Applied Biosystems applications manual.

Chromatin Immunoprecipitation (ChIP)

All reagents, buffers, and supplies were included in a chromatin immunoprecipitation (ChIP)-IT kit (Active Motif, Inc., Carlsbad, CA). Briefly, the cells were cross-linked with 1% formaldehyde for 10 min at room temperature. After washing and treatment with glycine Stop-Fix solution, the cells were resuspended in lysis buffer and incubated for 30 min on ice. The cells were homogenized, and nuclei were resuspended in shearing buffer and subjected to preoptimized ultrasonic disruption conditions to yield 100- to 500-base pair (bp) DNA fragments. The chromatin was precleared with protein G beads and incubated (overnight at 4°C) with 1 μg of the following antibodies: negative control mouse IgG (Active Motif, Inc.) and PGR A/B antibody. Protein G beads were then added to the antibody or chromatin incubation mixtures and incubated for 1.5 h at 4°C. After extensive washing, immunoprecipitated DNA or protein complex was removed from the beads by elution buffer. To reverse cross-links and remove RNA, 5 M NaCl and RNase were added to the samples and incubated at 65°C for 4 h. The samples were then treated with proteinase K for 2 h at 42°C, and the DNA was purified using gel exclusion columns. The purified DNA was subjected to PCR amplification (one cycle of 94°C for 3 min, 40 cycles of 94°C for 20 sec, 64°C for 30 sec, and 72°C for 30 sec) of the PRE region within the mouse Fshb promoter using specific forward 5′-AGCCCATAGGAACAAGATGC and reverse 5′-GAACATTGCTTTGGCTCCAT primers. As an input control, 10% of each chromatin preparation was used. The PCR products were resolved by electrophoresis in a 2.5% agarose gel and visualized by ethidium bromide staining.

Statistical Analysis

Reporter gene assays and real time RT-PCR data are shown as the mean ± SEM of three independent experiments. Data were analyzed by one-way ANOVA using the computer software PRISM (GraphPad Software Inc., San Diego, CA). Data were considered significantly different at P < 0.05.

RESULTS

GNRH Enhances Fshb but Not Lhb Gene Transcription in LβT2 Cells

We and others have previously found that estradiol induces PGR expression and has synergistic effects with progesterone on PGR-mediated transcription in many cell lines, including those of pituitary origin [2, 15]. In our experiments, we cultured LβT2 cells in the presence of 0.2 nM estradiol before treatment with GNRH1or GNRH2 (10−7 M).

Using real-time PCR to monitor the effect of GNRH1 on Fshb and Lhb mRNA levels, we found that GNRH1 increased Fshb mRNA accumulation in a time-dependent manner between 4 h and 8 h (Fig. 1A) but that Fshb mRNA levels returned to pretreatment levels 24 h after the treatment. By contrast, Lhb mRNA levels are not influenced by GNRH1 at any time point (Fig. 1A). The nature of this transient increase in Fshb mRNA levels by GNRH1 contrasts with a parallel experiment in which we observed a progressive increase in the activity of a PRE-driven luciferase reporter gene between 8 h and 24 h after GNRH1 treatment (data not shown).

FIG. 1.
GNRH1 increased the Fshb mRNA level but not the Lhb mRNA level in LβT2 cells. A) After 2 days' incubation with culture medium in the presence of 0.2 nM estradiol, LβT2 cells were treated with 10−7 M GNRH1 over a 24-h time course, ...

The influence of GNRH1 on Fshb mRNA levels in LβT2 cells at 8 h was also 3-fold greater than that observed after treatment with the same concentration (10−7M) of GNRH2 (Fig. 1B). It is also important to note that under these conditions the coadministration of progesterone with either GNRH1 or GNRH2 did not result in any additive effect on Fshb mRNA levels (Fig. 1B) or the activity of a PRE-driven luciferase reporter gene (Fig. 1C).

GNRH1-Induced Fshb Gene Transcription Requires the PGR

In the next set of experiments, we used an siRNA approach to assess the role of PGR in GNRH1-modulated gonadotropin β subunit gene expression in LβT2 cells (Fig. 2). When the PGR levels in these cells were knocked down using siRNA (Fig. 2A), an ~65% reduction in GNRH1-stimulated PRE-driven luciferase activity was observed (Fig. 2B) together with a similar reduction in Fshb mRNA levels (Fig. 2C). This effect is specific in terms of the Fshb response because the knockdown of PGR levels had no effect on Lhb mRNA levels (Fig. 2D). In addition, the siRNA treatment did not alter the protein levels of GNRH1 receptor (Fig. 2A), suggesting that the downregulated Fshb is not due to a decrease in GNRH action at the level of its receptor and that downstream signaling events involving the PGR are required for the GNRH1 effect on Fshb expression.

FIG. 2.
GNRH1 modulated the PRE luciferase reporter gene- and Fshb-required activation of the PGR. LβT2 cells were transfected with PRE luciferase reporter gene together with 150 nM control siRNA (si-ctrl) or siRNA for PGR (si-PGR). A) The efficiency ...

To further ascertain whether the PGR-dependent effect of GNRH1 on Fshb mRNA levels occurs at the transcriptional level, we used a ChIP assay (Fig. 3). This showed a progressive loading of the PGR onto a region of the endogenous Fshb promoter that contains a PRE [25]. Most important, this occurred within the same time frame (Fig. 3) as the upregulation of Fshb mRNA levels (4 h to 8 h) in LβT2 cells (Fig. 1B).

FIG. 3.
GNRH1 induced the recruitment of the PGR on the PRE region in the Fshb promoter. ChIP analysis was performed as described in Materials and Methods. LβT2 cells were treated with 10−7 M GNRH1 for 1, 4, 8, or 24 h or were untreated (Ctrl). ...

Activation of the PGR and Its Effects on Fshb Expression Involves PKC

Because the PGR can be phosphorylated upon activation of PKA and PKC signaling pathways [15], we first demonstrated that GNRH1 treatment induced the phosphorylation of PGR at Ser249 in LβT2 cells (Fig. 4A) as previously shown in αT3–1 cells [15]. We then cotreated LβT2 cells with GNRH1 and 10−5 M PKA (H-89) or 10−6 M PKC (GF109203X) inhibitors (Fig. 4, B and C), and this showed that inhibition of GNRH-triggered downstream signaling cascades reduced the activation of a PRE-driven luciferase reporter gene in LβT2 cells by at least 50% (Fig. 4B). However, in the same cells, the inhibitory effect of GF109203X exceeded that of H-89 on the GNRH1-stimulated accumulation of Fshb transcripts (Fig. 4C). Therefore, we examined whether these PKA and PKC inhibitors influenced the phosphorylation of the PGR at Ser249 in LβT2 cells and found that only the inhibition of PKC acted in this way (Fig. 4D). Thus, while GNRH1-mediated phosphorylation events that influence Fshb expression in LβT2 cells involve both PKA and PKC pathways, only the PKC pathway acts via the PGR phosphorylation at Ser249.

FIG. 4.
PKC and PKA inhibitors reduced GNRH1-activated PRE luciferase reporter gene and Fshb mRNA levels, while PGR phosphorylation at Ser249 is inhibited only by a PKC inhibitor in LβT2 cells. A) After 2 days' incubation with culture medium in the presence ...

GNRH1 Modulates the Interaction of PGR A with NCOA3

After treatment of LβT2 cells with GNRH1, nuclear proteins were immunoprecipitated with specific antibodies against PGR (anti-PGR A/B) or PGR B (anti-PGR B, which detects the unique N-terminal region of PGR B) to monitor the interaction of PGR subtypes with its coregulator NCOA3 (Fig. 5A). GNRH1 augmented the interaction between NCOA3 and PGR A/B but not between NCOA3 and PGR B (Fig. 5A), and this suggests that NCOA3 interacts preferentially with the PGR A isoform. Most important, the interaction of NCOA3 with the PGR increased from 1 h to 8 h. Thus, the temporal interaction between nuclear PGR and NCOA3 coincides with maximum upregulation of Fshb mRNA at 8 h and its subsequent return to basal levels at 24 h after GNRH1 treatment. When we used an siRNA to knock down NCOA3 levels in LβT2 cells, this attenuated the effect of GNRH1 on Fshb mRNA levels (Fig. 5B). In addition, a ChIP assay showed a progressive loading of NCOA3 onto the PRE region within the Fshb promoter in LβT2 cells, which peaks 8 h after GNRH1 treatment (Fig. 5C). These data all support the concept that an interaction between PGR A and NCOA3 is required for the rapid effects of GNRH1 on Fshb expression in LβT2 cells.

FIG. 5.
GNRH1 induced the interaction of PGR A and NCOA3 to regulate Fshb mRNA levels in LβT2 cells. A) LβT2 cells were treated with 10−7 M GNRH1 for different time periods (1, 4, 8, or 24 h) or were untreated (C). Cell lysates were immunoprecipitated ...

DISCUSSION

The development of immortalized pituitary cell lines (αT3–1 cells and LβT2 cells) by the targeted expression of Simian vacuolating virus 40 (SV40) large T antigen in gonadotropins of transgenic mice has greatly increased our understanding of GNRH signaling [26, 27]. We previously used αT3–1 cells to demonstrate that the self-priming of Cga gene expression by GNRH is mediated via the type I GNRH receptor and found that this involves phosphorylation of the PGR [15]. Because αT3–1 cells express Cga but not Fshb or Lhb genes and are considered immature [28], we herein used LβT2 cells, which express all three gonadotropin subunit genes, as well as the type I GNRH receptor gene. In this context, LβT2 cells may be more representative of mature pituitary gonadotropins than αT3–1 cells [23], as well as more physiologically relevant for in vitro studies aimed at dissecting the signaling pathways involved in GNRH action and gonadotropin production.

It has been documented that the PGR is involved in the GNRH self-priming effect in vivo and in vitro and that this occurs even in the absence of progesterone [22]. Although estradiol treatment of primary rat and mouse pituitary cells leads to an increase in the PGR levels and thereby contributes to the GNRH self-priming effect [2], that study also indicated that estradiol pretreatment does not increase PGR levels in LβT2 cells. It was also reported that GNRH1 fails to increase Lhb gene expression in LβT2 cells [2], and we confirmed this. However, we herein found that GNRH1 treatment of LβT2 cells leads to a rapid but transient increase in Fshb mRNA level. Remarkably, this transient induction of the Fshb expression contrasts with the effect of GNRH1 on a PRE-driven luciferase reporter gene, which is characterized by a progressive activation between 8 h and 24 h (data not shown), at a time when the effect on Fshb is already lost. This likely reflects differences in the organization of the endogenous Fshb promoter in the context of chromatin compared with the naked PRE-driven luciferase reporter gene construct.

The importance of PGR-regulated Fshb gene transcription has been demonstrated in PGR knockout mice, which have significantly lower serum FSH levels compared with their wild-type counterparts [29]. To verify that PGR activation is involved in this process, we knocked down PGR protein levels with siRNA, and this resulted in an ~65% reduction of GNRH1-induced Fshb mRNA levels. Furthermore, when we tested recruitment of PGR on the Fshb promoter, the PGR rapidly associated with a region containing a well-characterized PRE within the Fshb promoter [30]. Others have demonstrated that this PRE is essential for the response of rat Fshb promoter to progesterone stimulation [30]. A simple bioinformatics scan also indicates that this is the only PRE sequence within the first 1000 bp of the mouse Fshb promoter (data not shown). As previously observed in αT3–1 cells [15], GNRH1 treatment of LβT2 cells induced PGR phosphorylation, which was shown to be required for an induction of both a PRE-driven luciferase reporter gene and an increase in Fshb mRNA levels: this evidence supports the concept that PGR phosphorylation is required for GNRH1-induced Fshb expression.

We have also previously shown that when the PGR is phosphorylated after GNRH1 treatment its interaction with NCOA3 is increased [15], and our present experiments demonstrate that this occurs within the same time frame as the increase in PGR loading at the PRE region of the Fshb promoter and the increase in Fshb mRNA levels. Thus, it would appear that an interaction between the phosphorylated PGR and NCOA3 is necessary for the rapid ligand-independent effect of GNRH1 on Fshb transcription. Increasing evidence suggests that altered expression of PGR isoforms may lead to different physiological responses in the pituitary and other cell types [3135]. For instance, we and others have demonstrated that PGR A and PGR B interact differentially with their coregulators and have different transcriptional activities when expressed separately [3638]. In αT3–1 cells, overexpression of PGR B leads to a profound inhibition of progesterone-induced GNRH receptor promoter activity, while overexpression of PGR B in human choriocarcinoma JEG-3 cells actually enhances GNRH receptor promoter activity after progesterone treatment [39]. Others have also demonstrated that progesterone enhances the activity of the breast cancer-resistant protein in PGR B-overexpressing breast cancer cells, while overexpression of PGR A in the same cells does not function in this way [40]. In addition, it has been reported that isoform-specific PGR-null mice respond differentially to progesterone- or dopamine-facilitated sexual receptive behavior [41] and that PGR A influences both the hormone-dependent and hormone-independent facilitation of sexual receptive behavior [42]. In our experiments, the use of specific antibodies indicated that PGR A preferentially binds to its coactivator NCOA3 and is the PGR isoform that is primarily responsible for the rapid effect of GNRH1 on Fshb expression in LβT2 cells.

The gonadotropins LH and FSH are coordinately and differentially regulated throughout the menstrual cycle. At the end of the luteal phase, circulating estradiol and progesterone levels decline markedly, resulting in a loss of negative feedback signals that leads to an increase in GNRH1 pulse frequency. A transient increase in plasma FSH levels occurs at the luteal-follicular phase transition point [43], but the basis for this remains unclear. One explanation is that activin acts synergistically with GNRH1 to promote Fshb gene expression [44, 45], while partially inhibiting the transcription of the Lhb gene [44] in LβT2 cells. There is also evidence that progesterone inhibits both basal and GNRH1-stimulated Lhb expression in the same pituitary cells [46], but that study did not examine the effect of progesterone of Fshb expression. In addition to synergistic action with activin [44], our results indicate that GNRH1 phosphorylates the PGR in a ligand-independent manner and promotes the accumulation of Fshb mRNA in LβT2 cells. We suggest that this contributes to the differential regulation of gondotropin gene expression during the luteal-follicular phase transition, which leads to the selection and maturation of dominant follicles.

Footnotes

1Supported by an operating grant from the Canadian Institutes of Health Research (to P.C.K.L.). P.C.K.L. is recipient of a Child & Family Research Distinguished Scholar Award. G.L.H. is a Tier I Canada Research Chair in Reproductive Health. S.L.P. was the recipient of graduate studentship awards from The Interdisciplinary Women's Reproductive Health Research Training Program.

REFERENCES

  • Levine JE, Chappell PE, Schneider JS, Sleiter NC, Szabo M. Progesterone receptors as neuroendocrine integrators. Front Neuroendocrinol 2001; 22: 69–106.106 [PubMed]
  • Turgeon JL, Waring DW. Differential expression and regulation of progesterone receptor isoforms in rat and mouse pituitary cells and LbetaT2 gonadotropes. J Endocrinol 2006; 190: 837–846.846 [PubMed]
  • Leonhardt SA, Edwards DP. Mechanism of action of progesterone antagonists. Exp Biol Med (Maywood) 2002; 227: 969–980.980 [PubMed]
  • Smith CL, O'Malley BW. Coregulator function: a key to understanding tissue specificity of selective receptor modulators. Endocr Rev 2004; 25: 45–71.71 [PubMed]
  • McDonnell DP, Shahbaz MM, Vegeto E, Goldman ME. The human progesterone receptor A-form functions as a transcriptional modulator of mineralocorticoid receptor transcriptional activity. J Steroid Biochem Mol Biol 1994; 48: 425–432.432 [PubMed]
  • Han SJ, DeMayo FJ, Xu J, Tsai SY, Tsai MJ, O'Malley BW. Steroid receptor coactivator (SRC)-1 and SRC-3 differentially modulate tissue-specific activation functions of the progesterone receptor. Mol Endocrinol 2006; 20: 45–55.55 [PubMed]
  • Mukherjee A, Amato P, Allred DC, DeMayo FJ, Lydon JP. Steroid receptor coactivator 2 is required for female fertility and mammary morphogenesis: insights from the mouse, relevance to the human. Nucl Recept Signal 2007; 5: e011 [PMC free article] [PubMed]
  • Matkovits T, Christakos S. Ligand occupancy is not required for vitamin D receptor and retinoid receptor-mediated transcriptional activation. Mol Endocrinol 1995; 9: 232–242.242 [PubMed]
  • Power RF, Mani SK, Codina J, Conneely OM, O'Malley BW. Dopaminergic and ligand-independent activation of steroid hormone receptors. Science 1991; 254: 1636–1639.1639 [PubMed]
  • Mani SK, Allen JM, Clark JH, Blaustein JD, O'Malley BW. Convergent pathways for steroid hormone- and neurotransmitter-induced rat sexual behavior. Science 1994; 265: 1246–1249.1249 [PubMed]
  • Weigel NL, Moore NL. Steroid receptor phosphorylation: a key modulator of multiple receptor functions. Mol Endocrinol 2007; 21: 2311–2319.2319 [PubMed]
  • Pierson-Mullany LK, Lange CA. Phosphorylation of progesterone receptor serine 400 mediates ligand-independent transcriptional activity in response to activation of cyclin-dependent protein kinase 2. Mol Cell Biol 2004; 24: 10542–10557.10557 [PMC free article] [PubMed]
  • Zhang Y, Beck CA, Poletti A, Clement JP, Prendergast P, Yip TT, Hutchens TW, Edwards DP, Weigel NL. Phosphorylation of human progesterone receptor by cyclin-dependent kinase 2 on three sites that are authentic basal phosphorylation sites in vivo. Mol Endocrinol 1997; 11: 823–832.832 [PubMed]
  • Garrido-Gracia JC, Bellido C, Aguilar R, Sanchez-Criado JE. Protein kinase C cross-talk with gonadotrope progesterone receptor is involved in GnRH-induced LH secretion. J Physiol Biochem 2006; 62: 35–42.42 [PubMed]
  • An BS, Selva DM, Hammond GL, Rivero-Muller A, Rahman N, Leung PC. Steroid receptor coactivator-3 is required for progesterone receptor trans-activation of target genes in response to gonadotropin-releasing hormone treatment of pituitary cells. J Biol Chem 2006; 281: 20817–20824.20824 [PubMed]
  • Chabbert-Buffeta N, Skinner DC, Caraty A, Bouchard P. Neuroendocrine effects of progesterone. Steroids 2000; 65: 613–620.620 [PubMed]
  • Lasley BL, Wang CF, Yen SS. The effects of estrogen and progesterone on the functional capacity of the gonadotrophs. J Clin Endocrinol Metab 1975; 41: 820–826.826 [PubMed]
  • Turgeon JL, Waring DW. Modification of luteinizing hormone secretion by activators of Ca2+/phospholipid-dependent protein kinase. Endocrinology 1986; 118: 2053–2058.2058 [PubMed]
  • Waring DW, Turgeon JL. A pathway for luteinizing hormone releasing-hormone self-potentiation: cross-talk with the progesterone receptor. Endocrinology 1992; 130: 3275–3282.3282 [PubMed]
  • Fink G. The self-priming effect of LHRH: a unique servomechanism and possible cellular model for memory. Front Neuroendocrinol 1995; 16: 183–190.190 [PubMed]
  • Chappell PE, Schneider JS, Kim P, Xu M, Lydon JP, O'Malley BW, Levine JE. Absence of gonadotropin surges and gonadotropin-releasing hormone self-priming in ovariectomized (OVX), estrogen (E2)-treated, progesterone receptor knockout (PRKO) mice. Endocrinology 1999; 140: 3653–3658.3658 [PubMed]
  • Turgeon JL, Waring DW. Activation of the progesterone receptor by the gonadotropin-releasing hormone self-priming signaling pathway. Mol Endocrinol 1994; 8: 860–869.869 [PubMed]
  • Liu F, Austin DA, Mellon PL, Olefsky JM, Webster NJ. GnRH activates ERK1/2 leading to the induction of c-fos and LHbeta protein expression in LbetaT2 cells. Mol Endocrinol 2002; 16: 419–434.434 [PubMed]
  • Liu Z, Auboeuf D, Wong J, Chen JD, Tsai SY, Tsai MJ, O'Malley BW. Coactivator/corepressor ratios modulate PR-mediated transcription by the selective receptor modulator RU486. Proc Natl Acad Sci U S A 2002; 99: 7940–7944.7944 [PubMed]
  • O'Conner JL, Wade MF, Prendergast P, Edwards DP, Boonyaratanakornkit V, Mahesh VB. A 361 base pair region of the rat FSH-beta promoter contains multiple progesterone receptor-binding sequences and confers progesterone responsiveness. Mol Cell Endocrinol 1997; 136: 67–78.78 [PubMed]
  • Mellon PL, Windle JJ, Weiner RI. Immortalization of neuroendocrine cells by targeted oncogenesis. Recent Prog Horm Res 1991; 47: 69–96.96 [PubMed]
  • Turgeon JL, Kimura Y, Waring DW, Mellon PL. Steroid and pulsatile gonadotropin-releasing hormone (GnRH) regulation of luteinizing hormone and GnRH receptor in a novel gonadotrope cell line. Mol Endocrinol 1996; 10: 439–450.450 [PubMed]
  • Alarid ET, Windle JJ, Whyte DB, Mellon PL. Immortalization of pituitary cells at discrete stages of development by directed oncogenesis in transgenic mice. Development 1996; 122: 3319–3329.3329 [PubMed]
  • Schneider JS, Burgess C, Sleiter NC, DonCarlos LL, Lydon JP, O'Malley B, Levine JE. Enhanced sexual behaviors and androgen receptor immunoreactivity in the male progesterone receptor knockout mouse. Endocrinology 2005; 146: 4340–4348.4348 [PubMed]
  • Melamed P, Kadir MN, Wijeweera A, Seah S. Transcription of gonadotropin beta subunit genes involves cross-talk between the transcription factors and co-regulators that mediate actions of the regulatory hormones. Mol Cell Endocrinol 2006; 252: 167–183.183 [PubMed]
  • Mote PA, Balleine RL, McGowan EM, Clarke CL. Heterogeneity of progesterone receptors A and B expression in human endometrial glands and stroma. Hum Reprod 2000; 15(suppl 3):48–56.56 [PubMed]
  • Mote PA, Bartow S, Tran N, Clarke CL. Loss of co-ordinate expression of progesterone receptors A and B is an early event in breast carcinogenesis. Breast Cancer Res Treat 2002; 72: 163–172.172 [PubMed]
  • Mesiano S, Chan EC, Fitter JT, Kwek K, Yeo G, Smith R. Progesterone withdrawal and estrogen activation in human parturition are coordinated by progesterone receptor A expression in the myometrium. J Clin Endocrinol Metab 2002; 87: 2924–2930.2930 [PubMed]
  • Vienonen A, Syvala H, Miettinen S, Tuohimaa P, Ylikomi T. Expression of progesterone receptor isoforms A and B is differentially regulated by estrogen in different breast cancer cell lines. J Steroid Biochem Mol Biol 2002; 80: 307–313.313 [PubMed]
  • Graham JD, Yager ML, Hill HD, Byth K, O'Neill GM, Clarke CL. Altered progesterone receptor isoform expression remodels progestin responsiveness of breast cancer cells. Mol Endocrinol 2005; 19: 2713–2735.2735 [PubMed]
  • Mulac-Jericevic B, Conneely OM. Reproductive tissue selective actions of progesterone receptors. Reproduction 2004; 128: 139–146.146 [PubMed]
  • Richer JK, Jacobsen BM, Manning NG, Abel MG, Wolf DM, Horwitz KB. Differential gene regulation by the two progesterone receptor isoforms in human breast cancer cells. J Biol Chem 2002; 277: 5209–5218.5218 [PubMed]
  • An BS, Choi JH, Choi KC, Leung PC. Differential role of progesterone receptor isoforms in the transcriptional regulation of human gonadotropin-releasing hormone I (GnRH I) receptor, GnRH I, and GnRH II. J Clin Endocrinol Metab 2005; 90: 1106–1113.1113 [PubMed]
  • Cheng KW, Cheng CK, Leung PC. Differential role of PR-A and -B isoforms in transcription regulation of human GnRH receptor gene. Mol Endocrinol 2001; 15: 2078–2092.2092 [PubMed]
  • Wang H, Lee EW, Zhou L, Leung PC, Ross DD, Unadkat JD, Mao Q. Progesterone receptor (PR) isoforms PRA and PRB differentially regulate expression of the breast cancer resistance protein in human placental choriocarcinoma BeWo cells. Mol Pharmacol 2008; 73: 845–854.854 [PubMed]
  • Mulac-Jericevic B, Lydon JP, DeMayo FJ, Conneely OM. Defective mammary gland morphogenesis in mice lacking the progesterone receptor B isoform. Proc Natl Acad Sci U S A 2003; 100: 9744–9749.9749 [PubMed]
  • Mani SK, Reyna AM, Chen JZ, Mulac-Jericevic B, Conneely OM. Differential response of progesterone receptor isoforms in hormone-dependent and -independent facilitation of female sexual receptivity. Mol Endocrinol 2006; 20: 1322–1332.1332 [PubMed]
  • Marshall JC, Dalkin AC, Haisenleder DJ, Paul SJ, Ortolano GA, Kelch RP. Gonadotropin-releasing hormone pulses: regulators of gonadotropin synthesis and ovulatory cycles. Recent Prog Horm Res 1991; 47: 155–199.199 [PubMed]
  • Wang Y, Fortin J, Lamba P, Bonomi M, Persani L, Roberson MS, Bernard DJ. Activator protein-1 and smad proteins synergistically regulate human follicle-stimulating hormone beta-promoter activity. Endocrinology 2008; 149: 5577–5591.5591 [PubMed]
  • Thackray VG, Mellon PL. Synergistic induction of follicle-stimulating hormone beta-subunit gene expression by gonadal steroid hormone receptors and Smad proteins. Endocrinology 2008; 149: 1091–1102.1102 [PubMed]
  • Thackray VG, Hunnicutt JL, Memon AK, Ghochani Y, Mellon PL. Progesterone inhibits basal and gonadotropin-releasing hormone induction of luteinizing hormone beta-subunit gene expression. Endocrinology 2009; 150: 2395–2403.2403 [PubMed]

Articles from Biology of Reproduction are provided here courtesy of Oxford University Press