PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC 2010 April 5.
Published in final edited form as:
PMCID: PMC2849269
NIHMSID: NIHMS181985

APP anterograde transport requires Rab3A GTPase activity for assembly of the transport vesicle

Abstract

The amyloid precursor protein (APP) may be sequentially cleaved by β- and γ-secretases leading to accumulation of Aβ peptides in brains of Alzheimer’s Disease patients. Cleavage by α-secretase prevents Aβ generation. APP is anterogradely transported by conventional kinesin in a distinct transport vesicle, but both the biochemical composition of such a vesicle as well as the specific kinesin-1 motor responsible for transport are poorly defined. Here, we demonstrate by time-lapse analysis and immunoisolations that APP is a cargo of a vesicle containing the kinesin heavy chain isoform kinesin-1C, the small GTPase Rab3A and a specific subset of presynaptic protein components. Moreover, we report that assembly of kinesin-1C and APP in this vesicle type requires Rab3A GTPase activity. Finally, we show cleavage of APP in the analyzed transport vesicles by α-secretase activity, likely mediated by ADAM10. Together, these data indicate for the first time that maturation of transport vesicles, including coupling of conventional kinesin, requires Rab GTPase activity.

Keywords: Alzheimer’s disease, Amyloid Precursor Protein, axonal transport, Rab3A GTPase activity, protein sorting, vesicle assembly

INTRODUCTION

The amyloid precursor protein (APP) is a type I transmembrane protein undergoing processing through sequential cleavage by either α-secretase, including ADAM10 or ADAM17 (ADAM: a disintegrin and metalloproteinase), or β-secretase BACE1 (β-site APP cleaving enzyme 1) and a proteolytic complex termed γ-secretase (Selkoe, 2001; Reinhard et al., 2005). Aβ peptides, which accumulate in brain of Alzheimer’s Disease (AD) patients, are produced by the sequential activities of BACE1 and γ-secretase. Initial studies speculated that APP is rapidly transported in a membranous axonal organelle that also contains BACE1 and γ-secretase, and that these proteases promoted APP proteolysis within transport vesicles during transit along the axon (Kamal et al., 2001). In contrast, others reported that Presenilin1 and BACE1 have transport kinetics distinct from those of APP (Lazarov et al., 2005; Goldsbury et al., 2006).

Anterograde transport of APP is clearly mediated by conventional kinesin (kinesin, kinesin-1) (Koo et al., 1990; Ferreira et al., 1992; Amaratunga et al., 1993; Simons et al., 1995; Tienari et al., 1996) with velocities of up to 10 μm per second (Kaether et al., 2000; Stamer et al., 2002; Goldsbury et al., 2006) in a vesicle type morphologically distinct from that of synaptophysin-containing vesicles (Kaether et al., 2000). However, the precise mode of connection of conventional kinesin with APP-containing transport vesicles remains controversial and various models have been proposed. Based on immunoprecipitation experiments (Kamal et al., 2000), and fast axonal transport (FAT) studies in squid axoplasm (Satpute-Krishnan et al., 2006), a direct interaction of the APP C-terminus with kinesin light chains (KLCs) was proposed (Kamal 2000, 2001). Matsuda and coworkers later reported that the interaction between APP and KLCs might be mediated by c-Jun N-terminal kinase (JNK)-Interacting Protein 1b (JIP1b) (Inomata et al., 2003). However, more recent data showed that knockdown of JIP1b did not affect the localization of APP at the distal end of neurites (Kins et al., 2006) and that KLCs do not interact directly with the cytoplasmic tail of APP (Lazarov et al., 2005), arguing against an essential role of the APP C-terminus and JIP1b in APP anterograde transport. Moreover, heterologously expressed APP lacking the C-terminal intracellular domain continued to be anterogradely transported along the axon, indicating that there was no requirement of the APP C-terminus for FAT (Tienari et al., 1996; Torroja et al., 1999; Back et al., 2007; Rusu et al., 2007). Together, these data argue that APP does not interact directly with conventional kinesin.

Here, we now unequivocally show using biochemical approaches and live cell imaging that the APP C-terminus is not essential for anterograde FAT of APP. Moreover, our data indicate that Rab3A GTPase activity is required for assembly of kinesin-1C, APP, and ADAM10 in a common FAT vesicle.

MATERIAL AND METHODS

cDNA cloning and plasmids

GFP, human APP695 cDNA or APP695 lacking its C-terminus (APPΔCT; aa 1–649) fused to GFP, RFP or a HA-tag were cloned by PCR based mutagenesis into pCDNA3.1 (Invitrogen, Karlsruhe, Germany). pEGFP-synaptophysin, pECFP-synaptophysin were kind gifts from C. Kaether, Jena, Germany, T. Dresbach, Heidelberg, Germany and pcDNA-Rab3A/B/C/D wildtype and mutant Q81L constructs were a kind gift from M. Zerial, Dresden, Germany. pCMV-myc-Rab3GAP p130, pCMV-myc-Rab3GAP p150 were constructed as described before (Nagano et al., 1998). For generation of shRNA constructs synthetic sense and antisense shRNA-oligos were annealed and then cloned into pKD (Dharmacon) by Sma1/EcoR1. The following oligos were used: Human Rab3GAP p130 -sh-sense oligo: GGAACTACTTCAACAGATATCAAGAGATATCTGTTGAAGTAGTTCCTTTTTGGGA ACTACTTCAACAGATATCAAGAGATATCTGTTGAAGTAGTTCCTTTTTG; Human Rab3GAP p130 -sh-antisense oligo: AATTCAAAAAGGAACTACTTCAACAGATATCTCTTGATATCTGTTGAAGTAGTTCCAATTCAAAAAGGAACTACTTCAACAGATATCTCTTGATATCTGTTGAAGTAGTTCC; Human Rab3GAP p150 -sh-sense oligo: ATATGTCTGTCTCCATGTATCAAGAGATACATGGAGACAGACATATTTTTTGATAT GTCTGTCTCCATGTATCAAGAGATACATGGAGACAGACATATTTTTTG. Human Rab3GAP p150 -sh-antisense oligo: AATTCAAAAAATATGTCTGTCTCCATGTATCTCTTGATACATGGAGACAGACATAT AATTCAAAAAATATGTCTGTCTCCATGTATCTCTTGATACATGGAGACAGACATAT. The used siRNA against mouse Rab3GAP p130 was purchased from Invitrogen (Karlsruhe, Germany).

Antibodies

Primary antibodies directed against APP C-Terminus (CT20) (Calbiochem, Darmstadt, Germany), APP N-Terminus (22C11) (Weidemann et al., 1989; Hilbich et al., 1993), ADAM10 (Calbiochem), ADAM17 (Calbiochem), BACE1 (Calbiochem), bassoon (Synaptic Systems, Göttingen, Germany), GAP43 (Sigma, Deisenhofen, Germany), GFP (Sigma), Grp78 (StressGen, Stressgen: Victoria, USA), HA-epitope (Roche), KDEL (StressGen), kinesin-1 (H2) (Pfister et al., 1989), kinesin-1A (PA1-642, Affinity Bioreagents, Golden, USA), kinesin-1B (UIC81 serum (Deboer et al., 2008)), Munc13-1 (Synaptic Systems), Munc18 (Synaptic Systems), myc-epitope (Sigma), N-Cadherin (Santa Cruz Biotechnology, Heidelberg, Germany), Nicastrin (Chemicon, Schwalbach/Ts., Germany), Piccolo (Synaptic Systems), PS1 (Santa Cruz Biotechnology), Rab3 (Synaptic Systems), Rab3GAP p130 and Rab3GAP p150 (Sakane et al., 2006), RIM2 (Synaptic Systems), SNAP-25 (Synaptic Systems), synapsin-I (BioTrend Biotrend: Köln, Germany), synaptophysin (Sigma), syntaxin-1B (Sigma), Trk (Sigma). Secondary anti-mouse or anti-rabbit antibodies used for immunocytochemical or Western blot analyses were conjugated to Alexa Fluor 488, 594 (H+L) (Molecular Probes, Karlsruhe, Germany), or HRP (Promega, Mannheim, Germany), respectively.

Live cell time lapse microscopy and kymograph analysis

Fluorescence microscopy of living cells transiently expressing fluorescent fusion proteins (16–18h after transfection) was performed on a Nikon TE2000-E equipped with a 60x Planapo VC NA 1.45 or a Zeiss Axiovert 200M Inverted Microscope equipped with a 100x Zeiss NA 1.45. Images were recorded with a Hamamatsu Orca AG camera using NIS-Elemens software 3.2 (Nikon) or MetaMorph Imaging System (Universal Imaging Co.). Dual channel time lapse (CFP/GFP, RFP) was performed with fast excitation and emission filter wheels (Lambda 10-2, Sutter Instruments). Cells were kept at 37°C with a stage top-heating chamber (Tokai Hit, Japan). For kymograph analyses, images were captured every 200 ms for maximal 2 min. Manual and automatic tracking, velocity analyses and kymographs were generated by the use of the multiple kymograph function of the ImageJ software (National Institutes of Health) or MetaMorph Imaging System (Universal Imaging Co.). The slope of the traces is a direct measure for the velocity of the vesicles (v= cotan(α), where α is the angle relative to the x-axis). Single tracks with an angle 0<α<90° were defined as anterograde, and tracks with a slope 90°<α<180° as retrograde transport vesicles. Tracks with slopes=90° (parallel to the time axis) were determined as stationary vesicles. The standard error of the mean (SEM) was calculated and a two-tailed t-test was used for statistical significance determination.

Cell culture

SH-SY5Y cells (ATCC number: CRL-2266) were cultivated in 50% MEM, 50% Nutrient Mixture F-12, HAM, 1% MEM non-essential amino acids, 1% L-glutamine, 1% penicillin/streptomycin and 15% FCS. Mouse primary neurons were isolated and cultured as described before (Kuan et al., 2006). Mouse neuroblastoma N2a cells were cultivated in MEM, 1% MEM non-essential amino acids, 1% L-glutamine, 1% penicillin/streptomycin, 1% sodium-pyruvate and 10% FCS. For time-lapse microscopy and immunocytochemical analysis SH-SY5Y cells and primary neurons were grown on poly-L-lysine (Sigma) treated coverslips (Marienfeld, Lauda-Königshofen, Germany). SH-SY5Y cells and mixed cortical primary neurons (DIV1 or DIV7) from mouse embryos (E14) were transfected using Lipofectamine Plus (Invitrogen) or Lipofectamine 2000 (Invitrogen), respectively, as described by the manufacturer.

Subcellular fractionation of brain membrane vesicles

Wildtype mice (129Sv X C57BL6 Fx; 129OLA X C57BL/6 Fx; C57BL/6) and APP knockout mice (129OLA X C57BL/6 Fx) (Li et al., 1996b) were used for the isolation of membrane and vesicle preparations, as described previously (Deboer et al., 2008). Mouse brains were homogenized in about 4 volumes of ice-cold HOM buffer (300 mM sucrose, 10 mM HEPES pH 7,4, 5 mM EDTA, 1:25 Protease Inhibitor) with a glass Teflon homogenizer and centrifuged for 5 min at 1200xg, 5000xg, 10.000xg (for brain homogenate) and at 100.000xg for 30 min (Sorvall S45A rotor). The membranes were under loaded on a linear gradient (5–23% iodixanol in HOM buffer) (OptiPrep) and centrifuged at 150.000xg for 90 min. 15 equal fractions were collected and analyzed; or pooled light vesicle fractions (1–5) used for further immunoisolation experiments.

Immunoisolation and immunoprecipitation

Antibodies directed against APP (CT20) and kinesin-1 (H2) were crosslinked to anti-mouse or anti-rabbit IgG M-280 magnetic beads (Dynal/Invitrogen) using Dimethyl pimelinediimidate dihydrochloride (DMP) (Fluka, Neu-Ulm, Germany) or Dithiobis succinimidyl propionate (DSP) (Pierce, Bonn, Germany) according to manufacturer’s instructions.

Brain homogenates or iodixanol gradient- purified membrane fractions were incubated with CT20-coupled magnetic beads for 4–12 h at 4 °C. After extensive washing, the immunoisolates were either treated with 1% (v/v) Nonidet P40 (NP40) (Fluka) or Chlamidopropyl dimethylammonio-1-propane-sulfonate (CHAPS) (Sigma) in PBS at 4°C for 30 min or directly heated (5 min, 95°C) in loading buffer. The supernatants of detergent-treated samples were discarded. The beads were denatured in loading buffer (Kuan et al., 2006), and subjected to Western blot analyses.

For sequential immunoisolations, brain membrane fractions were incubated with CT20-coupled magnetic beads as described above. After washing, the beads were treated with PBS containing 250 mM DTT over night at 4°C. Eluted membranes were diluted (6 fold) in PBS and then incubated with H2-coupled magnetic beads for 4 h at 4°C. Finally, APP/kinesin-1 double immunoisolated membranes were processed for Western blot analyses.

For α-secretase inhibition experiments, a membrane permeable zinc-specific chelator (N,N,N′,N′-Tetrakis-(2-pyridylmethyl)-Ethylenediamine (TPEN)) (Sigma) was added at a concentration of 10 μM directly after mouse brain homogenization for the entire purification procedure (Fonte et al., 2001).

Immunocytochemistry

SH-SY5Y cells and mixed cortical primary neurons were grown on poly-L-lysine (Sigma)-coated coverslips (Marienfeld) in 24-well plates (Falcon, Heidelberg, Germany) and fixed with 4% paraformaldehyde (Sigma) for 30 min, permeabilized for 10 min in PBS with 0,1% NP40 and blocked in PBS with 5 % (v/v) goat serum (Sigma) for 1 h. After incubation with primary and secondary antibodies the coverslips were embedded in Mowiol (Sigma) and analyzed by fluorescence microscopy (60x objective, FITC or Cy5 filters) as described in detail before (Kuan et al., 2006).

RESULTS

Anterograde fast axonal transport of APP is independent of its intracellular domain

Immunocytochemical and immunohistological analyses of APP lacking the C-terminus (APPΔC) in primary neurons and Drosophila motor neurons revealed that APP undergoes anterograde FAT in the absence of its C-terminus (Tienari et al., 1996; Torroja et al., 1999; Back et al., 2007; Rusu et al., 2007). However, these experiments did not examine whether APP anterograde FAT rates might be altered by deletion of the APP C-Terminus nor did they evaluate whether APP and APPΔCT are co-transported in the same type of vesicles. To address these issues, we performed live microscopy studies of GFP fusion proteins with APP (APP-GFP) and APP lacking the C-terminus (APPΔCT-GFP) in primary neurons. Mixed cortical neurons (DIV7) were transfected with cDNAs encoding either APP-GFP or APPΔCT-GFP and analyzed by time-lapse microscopy 18 hours post-transfection. Velocity analysis revealed that APP-GFP is transported with a maximal velocity of approximately 7–10 μm/s (Fig. 1), consistent with previous studies (Kaether et al., 2000; Goldsbury et al., 2006). Detailed analyses of APP-GFP and APPΔCT-GFP transport rates (Fig. 1D) revealed that APPΔCT-GFP movement was indistinguishable from full length APP-GFP, arguing that the APP carboxy terminus is not required for packaging of APP in the anterograde transport vesicles or docking of conventional kinesin. To determine whether APP and APPΔCT are transported in the same type of vesicles, we co-transfected primary neurons with APP-RFP and APPΔCT-GFP. The two fluorescent proteins were visualized sequentially with a time interval of 200 ms (exposure time and time for changing the filter). We observed that anterograde movements of both fusion proteins were highly correlated. After tracking anterogradely transported vesicles, velocity kinetics were determined. This analysis revealed identical trafficking characteristics for APP-RFP and APPΔCT-GFP (Supplementary Fig. 1B), indicating that they were co-transported in the same type of vesicle. Consistent with previous studies (Kaether et al., 2000), we found that synaptophysin-CFP was transported in a different type of transport vesicle from APP-RFP and APPΔCT-GFP (data not shown), indicating that heterologously expressed APP fusion proteins are targeted to a specific type of transport vesicles. Recently, we reported that APP forms homotypic cis-dimers (Soba et al., 2005). To exclude the possibility that APPΔCT-GFP might be co-transported by associating to endogenous APP, we used primary neurons from APP knockout mice transfected with APPΔCT-GFP for time-lapse analysis. These studies showed that the FAT machinery transports APPΔCT-GFP even in the absence of endogenous APP (Supplementary Fig. 1A). Similar results were obtained from APP/APLP1/APLP2 triple-knockout mouse embryonic fibroblasts (data not shown). Taken together, these data suggest that the APP C-terminus is not required for FAT of APP.

Figure 1
APP can be transported by the fast axonal transport machinery in the absence of its intracellular C-terminus

APP is a cargo of a kinesin-1C associated transport vesicle

Previous studies indicated that APP containing vesicles are transported by conventional kinesin. The holoenzyme of conventional kinesin exists as a tetramer consisting of two kinesin light chain (KLCs) and two kinesin heavy chain (kinesin-1, KHC, KIF5s) subunits (Deboer et al., 2008). Following the agreed nomenclature for kinesins, the term “conventional kinesin” herein refers to the tetrameric motor protein complex (heavy and light chains), whereas “kinesin-1” refers exclusively to the heavy chain subunits (Lawrence et al., 2004; Deboer et al., 2008). To identify specific kinesin-1 isoform(s) linked to APP-containing vesicles and characterize the APP cargo vesicle, we performed immunoisolations from crude mouse brain membrane fractions, using magnetic beads loaded with an antibody directed against the C-terminus of APP (CT-20-coupled beads). APP-immunoisolates were analyzed by immunoblotting using antibodies that specifically recognize different kinesin-1 gene products kinesin-1A, kinesin-1B, and kinesin-1C (formerly KIF5A, KIF5B, and KIF5C, respectively (Lawrence et al., 2004)) (Deboer et al., 2008) (Fig. 2A). No immunoreactivity was detected with an antibody against kinesin-1B (specific antibodies used are described in the Material and Methods section) and barely detectable amounts of kinesin-1A were present in the APP immunoisolates. The anti-kinesin-1 antibody (H2) reacts strongly with both kinesin-1A and kinesin-1C (Deboer et al., 2008). However, the H2 immunoreactive band in the APP immunoisolates migrated at a significant lower molecular weight than kinesin-1A, and could therefore be clearly identified as kinesin-1C (Deboer et al., 2008). Thus, conventional kinesin associated with APP-containing membranes is mainly composed of kinesin-1C. Specificity of the kinesin-1C immunoreactivity in APP immunoisolates was verified using brain homogenates from APP knockout mice (Fig. 2A). In the absence of endogenous APP we did not observe nonspecific binding of any kinesin-1 isoform to immunoisolates obtained with the CT20-loaded magnetic beads (Fig. 2A).

Figure 2
APP is a cargo of an axonal transport vesicle containing presynaptic components and is associated with kinesin-1C

APP can be associated with a variety of membrane structures, including Golgi, endoplasmic reticulum (ER) and transport vesicles (Kins et al., 2006). To enrich for membrane fractions containing axonal transport vesicles, we separated the brain extracts in a linear Iodixanol gradient (5–23 %). We thus obtained low-density membrane material enriched with presynaptic marker proteins such as GAP43, synapsin-IA/B, and synaptophysin (Supplementary Fig. 2) These membranes were mostly separated from ER or cis-Golgi membrane fractions, as evidenced by low levels of typical ER and cis-Golgi markers (anti-Grp78 and anti-KDEL). Significantly, APP-immunoisolates obtained from membrane fractions 1–5 from these gradients from wild type mouse brains also contained kinesin-1C (Fig. 2B). As before (Fig. 2A), immunoisolates prepared from APP knockout mouse brain contained no kinesin-1 immunoreactivity and served as negative controls (Fig. 2B). Treatment of the APP-immunoisolated membranes with mild detergents (i.e. 1% NP40 or 15 mM CHAPS) caused a loss of kinesin-1C from APP-immunoisolates (Fig. 2B). In contrast, treatment of immunoisolates with low concentration (1.5 mM) of CHAPS below the critical micellar concentration (Kratohvil, 1984; Partearroyo et al., 1988) did not cause a dissociation of kinesin-1C from APP beads (Fig. 2B). Crosslinking of APP immunoisolates with Dimethyl pimelinediimidate dihydrochloride (DMP) before treatment with detergent did not maintain the APP/kinesin interaction (data not shown). Combined with the live cell analyses of transport of APP lacking the C-terminus, these data suggest that conventional kinesin containing kinesin-1C heavy chains associates with APP transport vesicles in a manner independent of the APP C-terminus.

Characterization of APP transport vesicles

To characterize APP-containing membrane compartments in more detail, we performed two sequential immunoisolations with CT-20 and H2-loaded magnetic beads. APP-containing membrane compartments were prepared as described before using beads linked with a disulfide crosslinker to CT20 antibodies. CT-20 immunoisolates were treated with DTT to elute APP-containing membranes. These membranes were then subjected to a second round of immunoisolation using H2-loaded magnetic beads, allowing for the enrichment of membranes containing both APP and kinesin-1C (i.e., transport vesicles).

Double APP/kinesin-1-immunoisolated membrane preparations were subjected to Western blot analysis, using various antibodies directed against a wide range of pre- and postsynaptic protein components. Only a subset of presynaptic proteins were detected in these APP/kinesin-1C double immunoisolates, including SNARE complex components, like VAMP2, SNAP25, syntaxin-1b, and synapsin-I, as well as components of the active zone, such as Rab3, RIM2, Munc13-1 and Rab3GAP p130 and p150 (Fig. 2C). Other presynaptic components previously described as putative cargoes of APP transport vesicles, including GAP43 and TrkA (Kamal et al., 2001), were not found in our membrane immunoisolates. Synaptophysin, a presynaptic protein previously shown to be transported in a different class of membranous organelles than APP (Kaether et al., 2000), was also absent. Neither postsynaptic proteins, like the NMDA (N-methyl-D-aspartic acid) or AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) receptor (data not shown), nor presynaptic cytomatrix proteins (Dresbach et al., 2001), such as bassoon and piccolo were detected in APP/kinesin-1C double immunoisolates (Fig. 2C). To control for specificity of the double immunoisolates, we used membrane preperations from APP knockout mouse brain in the first APP-immunoisolation step. Specificity of the kinesin-1 immunoisolation was verified by using non-immune mouse immunoglobulins (Fig. 2C).

Immunoisolation experiments here show that APP/kinesin-1 co-immunoisolated membrane fractions contain a subset of presynaptic protein contents that included syntaxin, synapsin-I, Rab3 and several Rab3A associated proteins, but did not include synaptophysin or typical protein components of the active zone, such as bassoon or piccolo. Together, these data strongly suggest that APP and other presynaptic membrane protein represent cargoes present in a biochemically distinct presynaptic membranous organelle, which in turns associates primarily with kinesin-1C.

APP localization at growth cones depends on Rab3A GTPase activity

Interestingly, some of the components identified in APP transport vesicles (i.e., Rab3GAP p130, Rab3GAP p150) are known to interact with and to stimulate the GTPase activity of Rab3 family members (Rab3A, B, C, D) (Fukui et al., 1997; Sakane et al., 2006). APP typically accumulates at growth cones of cell protrusions (Ferreira et al., 1993; Morfini et al., 1997; Sabo et al., 2003). Inhibition of anterograde APP transport should affect the normal accumulation of APP at the distal end of neurites, as described previously (Ferreira et al., 1992; Morfini et al., 1997). We co-transfected neuroblastoma cells (SH-SY5Y) with APP-GFP and specific Rab3 isoforms (Rab3A, B, C, or D), then examined accumulation of APP-GPF at the growth cones of neurites. Rab3 constructs used in these experiments included wild type forms or GTPase-deficient mutants carrying a Q81L amino acid replacement (Johannes et al., 1994) (kind gifts from Marino Zerial, Dresden, Germany) (Fig. 3B). Significantly, only co-expression of the Rab3A GTPase deficient mutant caused a reduction of APP localized to the neurite ends, suggesting a deficit in the anterograde transport of APP. None of the other wild type or mutant Rab3 isoforms altered APP distributions in SH-SY5Y cells (Fig. 3). These findings suggest that Rab3A GTPase activity is required for fast APP anterograde transport.

Figure 3
Rab3 subtype specific influence on APP localization

Rab3A GTPase activity is essential for fast anterograde transport of APP

As an independent test of the hypothesis that Rab3A GTPase activity is required for APP anterograde transport, we knocked down Rab3GAP p130 and Rab3GAP p150 in SH-SY5Y cells using shRNA constructs. Western blot analysis showed a 40–60% reduction in Rab3GAP p130 levels (Fig. 4B). Because the transfection efficiency with the vector-based shRNA constructs was 50–60%, the knockdown efficiency per transfected cell was estimated to be approximately 70–80%. Rab3GAP knockdown cells expressing APP-GFP exhibited accumulation of APP in the cell soma and APP-GFP failed to accumulate in neurite ends (Fig. 4A). In contrast, mock-transfected cells exhibited the typical APP-GFP accumulations at neurite ends (Fig. 4A). Notably, overexpression of Rab3GAPs p130 and p150 together with APP led to a more pronounced accumulation of APP at the growing tips (Suppl. Fig. 3). To characterize the role of Rab3A GTPase activity in anterograde transport of APP further, we transfected SH-SY5Y cells with either the Rab3A Q81L mutant construct or shRNA constructs directed against Rab3GAP p130 and p150. Cells were analyzed by time-lapse microscopy (5 frames/s) 18 h after APP-GFP cDNA transfection. APP-GFP expressing cells co-transfected with empty vector (Fig. 4C, white column) or wild type Rab3A co-expressing cells served as controls (data not shown). To evaluate changes in APP transport rates, we calculated the relative frequencies of stationary (≤0.2 μm/s), retrogradely (>0.2 μm/s), and anterogradely (>0.2 μm/s) transported APP-GFP containing vesicles in 12 or more individual co-transfected cells for each construct tested. In neurites of control vector-transfected cells we found in distal regions 41% (SEM ±7%) of stationary APP-GFP, 30% (SEM ±5%) retrogradely transported and 29% (SEM ±2%) anterogradely transported APP-GFP vesicles (Fig. 4C). The relative frequencies of anterograde transport vesicles were significantly reduced after inhibition of Rab3A GTPase activity with the Rab3A Q81L mutant (14%), or silencing of Rab3GAP p130 (12%), or Rab3GAP p150 (16%), (t-test; p<0.001) (Fig. 4C), but frequencies of retrogradely transported and stationary membrane compartments were not significantly altered (Fig. 4C). This data indicates that Rab3A GTPase activity modulated fast anterograde transport of APP. To make sure that inhibition of Rab3A GTPase does not cause a general block of anterograde FAT, we evaluated FAT of synaptophysin-containing vesicles, which is carried in a different cargo vesicle than APP (Kaether et al., 2000) (Fig. 4C). Neither mutant Rab3A Q81L, nor silencing of Rab3GAP p130 or p150 affected the relative frequencies of synaptophysin-GFP vesicles found in anterograde or retrograde FAT, suggesting that inhibition of Rab3A GTPase specifically affects the anterograde FAT of APP-containing vesicles. Together, these findings suggest that Rab3A GTPase activity is required for anterograde FAT of APP.

Figure 4
Rab3 GTPase activity is essential for APP fast anterograde transport

We also investigated the effects of Rab3GAP p130 knockdown on APP localization using primary cultured neurons. We treated stage1 primary neurons with Rab3GAP p130 siRNA and analyzed the localization of endogenous APP (Fig. 5B). Treatment with Rab3GAP p130 siRNA caused a reduction of Rab3GAP p130 levels to 65% (Fig. 5A). As observed in SH-SY5Y cells, a clear reduction of APP accumulation at the tips of neurites was detectable in primary neurons treated with the Rab3GAP p130 siRNA construct, compared to control transfected cells (Fig. 5B and C). For quantification we measured the intensity of GFP-APP in the cell body and the tip of neurites of single cells treated with control or Rab3GAP p130 siRNA (n=27 for each) (Fig. 5C). Consistent with data obtained from SH-SY5Y cells, the ratio of GFP-APP intensity at tips/cell bodies was reduced by approximately 40% in Rab3GAP p130 siRNA-treated cells, compared to control treated cells. Silencing of Rab3GAP p130 caused a reduction of APP intensity at the tips and an accumulation of APP in the cell bodies, suggesting that Rab3A GTPase activity is also required for anterograde FAT of APP in primary neurons.

Figure 5
Inhibition of Rab3 GTPase activity reduces the levels of APP at the tips of neurites

The activities of Rab3GAP p130 and p150 are required for the attachment of conventional kinesin to APP-containing vesicles

Given that Rab3 GTPase activity is required for the anterograde FAT of APP, we speculated that conversion of Rab3A from GTP to GDP bound states might be crucial for the correct assembly of APP transport vesicles. To test this possibility, we used isolated membranes from Rab3GAP p130 knockout mice, which display reduced levels of Rab3A activity (Sakane et al., 2006). Significantly, the amounts of kinesin-1, Rab3, and the Rab3 associated proteins RIM2, and Munc13-1 were dramatically decreased in APP immunoisolates derived from Rab3GAP p130 KO brains, compared to immunoisolates derived from wild type mouse brain (Fig. 6). In regard of the activity dependent association of Rab3A with membranes, this appears consistent with the reduction in Rab3A activity reported in brains of p130−/− knock out mice (Sakane et al., 2006). Together, these data indicate that Rab3A GTPase activity is required for the correct assembly of APP into anterograde transport vesicles, including the packaging of membrane proteins, such as Rab3A, and the association of the motor protein conventional kinesin.

Figure 6
Loss of kinesin-1 from APP transport vesicles in Rab3GAP p130 knockout mice

APP and ADAM10 are cargoes of a common transport vesicle

In this study, we identified several novel putative cargo proteins present in APP-containing transport vesicles. The question of whether the APP-processing secretases BACE1 and Presenilin1 (PS1) are also cargo proteins in these vesicles has been controversial (Kamal et al., 2001; Lazarov et al., 2005; Goldsbury et al., 2006). To clarify this issue, we performed APP/kinesin-1 double immunisolations as described above, and examined the presence of APP secretases and APP processing in the isolated membrane fractions. In Western blot analysis of APP/kinesin-1 double immunoisolates from mouse brain homogenates neither BACE1 nor PS1 were detectable (Fig. 7A). Nicastrin, another component of γ-secretase was also undetectable in APP/kinesin-1 double immunoisolates (Fig. 7A). We also tested for presence of the putative α-secretases ADAM10 and ADAM17. From these, only ADAM10 was detected in double-immunoisolates obtained from wild type, but not from APP knockout mouse brain, suggesting that APP/kinesin-1 double immunoisolated membrane compartments contain ADAM10 as a cargo protein.

Figure 7
APP and ADAM10 are cargoes of a common transport vesicle

Next, we evaluated APP processing in the isolated APP transport vesicle fraction. For this purpose we probed APP/kinesin-1 double-immunoisolates with an antibody directed against the APP N-terminus (22C11, which recognizes both full length APP and cleaved, secreted APP (sAPP)), and with an antibody directed against the APP C-terminus (CT-20, which recognizes full length APP, but not sAPP) (Fig. 7B). These analyses revealed a clear difference in the detected pattern of APP immunoreactivity. The N-terminal specific antibody recognized a lower molecular weight band, not detected by the C-terminal antibody, representing sAPP. To exclude non-specific cross reactivity of the 22C11 antibody, we tested the antibody on brain extracts of wild type and APP knockout mice. No immunoreactivity was seen with the 22C11 antibody in APP knockout mice (data not shown). Further, to test whether APP can be cleaved by α-secretase in the APP/kinesin-1 double-immunoisolated membrane compartment, we treated the membrane fractions over a time period of about 30h with a membrane permeable zinc chelator (10μM TPEN) that inhibits α-secretase activity (Fonte et al., 2001). The generation of the lower molecular weight putative sAPP band was reduced in presence of the α-secretase inhibitor. Together, these data suggest that APP might be processed in the APP/kinesin-1 double-immunoisolated membrane compartment by α-secretase activity, most likely mediated by ADAM10.

DISCUSSION

The APP C-terminus is not essential for fast anterograde transport

A role of APP as a putative cargo receptor for conventional kinesin has been a contentious issue (Kamal et al., 2000; Kamal et al., 2001; Lazarov et al., 2005). Various reports proposed that transport of APP-containing vesicles depends upon a direct interaction between the C-terminus of APP and the KLCs of conventional kinesin, suggesting that APP acts as a motor protein adaptor/receptor. Contrasting with predictions from this model, others and we showed that APP constructs lacking the C-terminal intracellular domain are transported to the nerve terminal (Tienari et al., 1996; Torroja et al., 1999; Back et al., 2007; Rusu et al., 2007). However, it was unclear whether the anterograde FAT of APP lacking its C-terminus was mediated by mechanisms different of those underlying transport of full-length APP. In this study we demonstrate by time-lapse analyses of fluorescently labeled APP that APP lacking its C-terminus is packed and transported in the same type of FAT vesicles as full-length APP. Treatment of APP/kinesin-1 co-immunoisolated membranes with detergents caused the dissociation of kinesin-1 from the APP-immunoisolated membranes, arguing against a direct interaction between these proteins. Together, our data demonstrates that APP is a cargo of a specific subset of membranes, and not a receptor protein directly linking conventional kinesin via its C-terminus to this vesicle type. Although various scaffolding proteins have been identified that facilitate interactions between APP and other binding partners, molecular components mediating the binding of conventional kinesin to its transported membrane cargoes remain widely unknown. Further analyses will be necessary to determine the molecular basis underlying the association of conventional kinesin with APP transport vesicles.

As with many integral membrane proteins, a fraction of the APP is returned by retrograde transport (see for example Fig. 1 in (Lazarov et al., 2007)). With cultured neurons, another issue may also be relevant. Our analysis of APP-GFP transport included proximal dendrites. As the microtubule cytoskeleton in this area is not uniformly organized (microtubules may exhibit both polarities), kinesin dependent transport can take place in both directions (retrogradely and anterogradely relative to the cell body). Consistently, in areas with unipolar microtubule organization, such as the axon, less retrograde transport of APP was detected (data not shown). However, the presence of some APP in the endosomal compartments (Ferreira et al., 1993) is consistent with retrograde FAT.

Kinesin-1C mediates axonal transport of APP

Based on studies of APP transport after treatment with antisense oligos directed against kinesin-1B, it was assumed that APP anterograde transport is mediated by kinesin-1B (Ferreira et al., 1992; Kaether et al., 2000). However, in these studies neither a specific reduction of kinesin-1B nor analyses of other kinesin-1 isoforms were performed. Here, we tested systematically for kinesin-1 family members (kinesin-1A, -B, -C) which might be selectively associated with APP-containing membrane fractions. Interestingly, we found that kinesin-1B was not detectable in APP immunoisolates, but kinesin-1C (and to a much lesser extent, kinesin-1A) is preferentially associated with APP transport vesicles. Recently, it was shown that conventional kinesin holoenzymes are formed of kinesin-1 homodimers, which associate with biochemically different cargoes (Deboer et al., 2008). The selective association of APP-containing transport vesicles with kinesin-1C reported here appears consistent with a role of kinesin-1s in the targeting of conventional kinesin holoenzymes to specific MBO cargoes (Deboer et al., 2008). The association of APP transport vesicles to a specific kinesin-1 isoform could also allow for the selective regulation of APP moving in FAT (Morfini et al., 2006; Deboer et al., 2008).

A presynaptic transport vesicle subtype contains Rab3A and APP

Our detailed biochemical characterization of APP transport vesicles in association with kinesin-1C revealed that these membrane compartments contained no postsynaptic protein contents, but instead contained a subset of presynaptic proteins, including synapsin-I, SNAP25, syntaxin-1B, VAMP2, Munc13-1, RIM2, Rab3, Rab3GAP p130 and p150. Significantly, all these protein cargoes are involved in various aspects of synaptic vesicle fusion. Thus, our results here are consistent with, previous studies suggesting APP may play a role in the regulation of vesicle fusion and synaptic function (Wang et al., 2005; Yang et al., 2007).

Rab3A was previously shown to be present in several different presynaptic vesicle types along with various other proteins, including syntaxin-1, SNAP25, bassoon, piccolo, Munc18, N-Cadherin, and VAMP2 (Okada et al., 1995; Zhai et al., 2001), which are transported by different velocities along the axon (Shapira et al., 2003). Likely, APP transport vesicles represent only a subset of the cargo proteins that can be co-transported with Rab3A. Our data suggests that Rab3A may be involved in the packaging of specific proteins into different vesicle subtypes that in turn may be moved by specific motor proteins. In this regard, it is remarkable that inhibition of Rab3A had no influence on the anterograde transport of synaptophysin, even though Rab3 colocalizes with synaptophysin at nerve terminals (Li et al., 1996a), and has been co-purified from synaptic vesicles in immunoisolation experiments (Fischer von Mollard et al., 1990; de Wit et al., 1999). The anti-Rab3 antibody used in these two studies does not allow differentiating between the Rab3 isoforms. Thus, the apparent discrepancy between these studies and our analyses might be explained by the fact that synaptophysin is not a cargo of a Rab3A, but possibly a cargo of Rab3B, C, or D containing vesicles. Alternatively, Rab3A and synaptophysin may be packaged in a common vesicle after they have reached the nerve terminal in distinct transport vesicles, as suggested by previous immunoisolation studies (Okada et al., 1995). Consistent with this latter possibility, some components of the APP transport vesicle have been found in association with synaptic vesicle fractions (synapsin-I, syntaxin-1, SNAP25, etc.) even though APP has not been found as a component of synaptic vesicles (Takamori et al., 2006).

Rab3A GTPase activity is required for APP transport

By using a Rab3A GTPase deficient mutant and by silencing of Rab3GAP p130 or p150, we showed that conversion of Rab3A-GTP to Rab3A-GDP is essential for anterograde FAT transport of APP in neuronal cells. These findings are consistent with previous experiments in isolated axoplasm indicating that FAT depends upon the activity of small GTPases (Bloom et al, JCB 1993). Rab3 GTPase family members are key regulators of presynaptic vesicular transport with overlapping, but not identical functions (Deneka et al., 2003; Schluter et al., 2004; Ali and Seabra, 2005; Star et al., 2005). They undergo a cycle of GTPase activity, interconnected to a cycle of reversible attachment to membranes (Burstein et al., 1993). After delivery to their respective membranes, Rabs are activated by replacement of GDP by GTP. GTP-bound Rabs are thought to orchestrate the assembly of cargo contents, motor association and docking interactions between donor and target membranes, whereas Rab3-GDP is presumably generated during or following exocytosis, allowing Rab3 release from the target membrane (Fischer von Mollard et al., 1991; Stahl et al., 1994; Sakisaka et al., 2002; Star et al., 2005). Recent data, however, showed that Rab3A knockdown, knockout or overexpression of GTP-locked mutant Rab3A significantly decreases the number of vesicles docked to the plasma membrane without altering the kinetics of individual exocytotic events (Schluter et al., 2006; Tsuboi and Fukuda, 2006; Coleman et al., 2007; Handley et al., 2007; van Weering et al., 2007). Taken together with these studies, our data argue that Rab3A does not play an essential role in vesicle fusion, but rather in the transport of vesicles to the plasma membrane. In addition, our studies suggest that Rab3A-GTP hydrolysis takes place before the vesicle docks to the target membrane.

Results from siRNA experiments and overexpression of GTPase-defective Rab3A constructs above suggested a role of Rab3A in the regulation of APP FAT, but these studies did not reveal specific molecular events affected. The well-established role of Rabs in protein sorting leads us to examine alterations in the composition of APP-containing membrane cargoes induced by reduced Rab3A activity. Significantly, we found reduced levels of kinesin-1C and other protein cargoes in APP-containing membranous organelles obtained from p130 −/− mouse brain, where Rab3A GTPase activity is inhibited. Taken together, our findings suggest a model in which Rab3 GTPase activity is required for correct assembly of APP and other membrane proteins (i.e., syntaxin-1, SNAP-25 and synapsin I) in a biochemically distinct transport vesicle type. In addition, our results suggest that Rab3A may regulate the association of kinesin-1C to the APP transport vesicle (Fig. 8).

Figure 8
Model of APP anterograde transport vesicle assembly

APP can be cleaved by α-secretase in transport vesicles

The subcellular compartment and spatial regulation of APP processing secretases, such as ADAM10, ADAM17, BACE1 or PS1, remains to be determined, as this information is critical for understanding the biology of APP. Early suggestions that BACE1 and PS1 are co-transported with APP in anterogradely transported axonal vesicles (Kamal et al., 2001) were not confirmed in subsequent studies (Lazarov et al., 2005; Goldsbury et al., 2006). Our studies here found that APP/kinesin-1 immunoisolated membrane fractions did not contain detectable levels of ADAM17, BACE1, PS1, or Nicastrin. Of the secretase components examined, only ADAM10 was detected in these membrane preparations. Remarkably, sAPP was detected in the isolated membrane fractions after in vitro incubations. Generation of this sAPP was blocked by a zinc chelator/inhibitor of α-secretase, consistent with the possibility that active α-secretase is present in the immunoisolated organelle fractions. However, in comparison to full length APP the amount of sAPP was below one percent, indicating that only low amounts of sAPP might be generated on its way to the plasma membrane. Alternatively, the process of immunoisolation may lead to activation of associated ADAM10. The physiological significance of this processing in immunoisolated vesicles remains to be determined, but the co-transport of ADAM10 with APP opens the avenue for novel therapeutic strategies against Alzheimer’s disease.

In sum, our data show that APP is a cargo, and not a kinesin cargo receptor, of a Rab3A-dependent transport vesicle type containing various presynaptic components. Further, we provide evidence that the conversion of Rab3A-GTP to Rab3A-GDP is essential for the assembly of various presynaptic proteins (i.e., Munc13 and RIM2) to an APP-containing transport vesicle, and the association of this vesicle type with the kinesin-1 motor. Finally, our data suggest that APP can be cleaved in these transport vesicles by an α-secretase, most likely ADAM10. Traditionally, the process of FAT executed by conventional kinesin has been considered separately from membrane trafficking and packaging events, normally regulated by cycling of Rab GTPases. Our results lead us to propose a novel mechanism for the coordinated regulation of trafficking and axonal transport events.

Supplementary Material

Szodorai supplemental

Acknowledgments

We thank for technical support by Rainer Pepperkok at the EMBL in Heidelberg and the Nikon Imaging Center at the University of Heidelberg. We also thank Sylvia Kreger for excellent technical assistance and Dr. Peter Soba for technical support and critical discussions. Research was supported by DFG (S.K.), Fritz-Thyssen Stiftung (S.K.) and Alzheimer Forschung Initative e.V. (S.K.) and in part by NINDS grants NS23868, NS23320, NS41170 and NS43408 (S.B.), MDA (S.B.), ALSA (G.M, S.B), and HDSA (G.M.).

References

  • Ali BR, Seabra MC. Targeting of Rab GTPases to cellular membranes. Biochem Soc Trans. 2005;33:652–656. [PubMed]
  • Amaratunga A, Morin PJ, Kosik KS, Fine RE. Inhibition of kinesin synthesis and rapid anterograde axonal transport in vivo by an antisense oligonucleotide. J Biol Chem. 1993;268:17427–17430. [PubMed]
  • Back S, Haas P, Tschape JA, Gruebl T, Kirsch J, Muller U, Beyreuther K, Kins S. beta-amyloid precursor protein can be transported independent of any sorting signal to the axonal and dendritic compartment. J Neurosci Res. 2007;85:2580–2590. [PubMed]
  • Burstein ES, Brondyk WH, Macara IG, Kaibuchi K, Takai Y. Regulation of the GTPase cycle of the neuronally expressed Ras-like GTP-binding protein Rab3A. J Biol Chem. 1993;268:22247–22250. [PubMed]
  • Coleman WL, Bill CA, Bykhovskaia M. Rab3a deletion reduces vesicle docking and transmitter release at the mouse diaphragm synapse. Neuroscience. 2007;148:1–6. [PubMed]
  • de Wit H, Lichtenstein Y, Geuze HJ, Kelly RB, van der Sluijs P, Klumperman J. Synaptic vesicles form by budding from tubular extensions of sorting endosomes in PC12 cells. Mol Biol Cell. 1999;10:4163–4176. [PMC free article] [PubMed]
  • Deboer SR, You Y, Szodorai A, Kaminska A, Pigino G, Nwabuisi E, Wang B, Estrada-Hernandez T, Kins S, Brady ST, Morfini G. Conventional Kinesin holoenzymes are composed of heavy and light chain homodimers. Biochemistry. 2008;47:4535–4543. [PMC free article] [PubMed]
  • Deneka M, Neeft M, van der Sluijs P. Regulation of membrane transport by rab GTPases. Crit Rev Biochem Mol Biol. 2003;38:121–142. [PubMed]
  • Dresbach T, Qualmann B, Kessels MM, Garner CC, Gundelfinger ED. The presynaptic cytomatrix of brain synapses. Cell Mol Life Sci. 2001;58:94–116. [PubMed]
  • Ferreira A, Caceres A, Kosik KS. Intraneuronal compartments of the amyloid precursor protein. J Neurosci. 1993;13:3112–3123. [PubMed]
  • Ferreira A, Niclas J, Vale RD, Banker G, Kosik KS. Suppression of kinesin expression in cultured hippocampal neurons using antisense oligonucleotides. J Cell Biol. 1992;117:595–606. [PMC free article] [PubMed]
  • Fischer von Mollard G, Sudhof TC, Jahn R. A small GTP-binding protein dissociates from synaptic vesicles during exocytosis. Nature. 1991;349:79–81. [PubMed]
  • Fischer von Mollard G, Mignery GA, Baumert M, Perin MS, Hanson TJ, Burger PM, Jahn R, Sudhof TC. rab3 is a small GTP-binding protein exclusively localized to synaptic vesicles. Proc Natl Acad Sci U S A. 1990;87:1988–1992. [PubMed]
  • Fonte J, Miklossy J, Atwood C, Martins R. The severity of cortical Alzheimer’s type changes is positively correlated with increased amyloid-beta Levels: Resolubilization of amyloid-beta with transition metal ion chelators. J Alzheimers Dis. 2001;3:209–219. [PubMed]
  • Fukui K, Sasaki T, Imazumi K, Matsuura Y, Nakanishi H, Takai Y. Isolation and characterization of a GTPase activating protein specific for the Rab3 subfamily of small G proteins. J Biol Chem. 1997;272:4655–4658. [PubMed]
  • Goldsbury C, Mocanu MM, Thies E, Kaether C, Haass C, Keller P, Biernat J, Mandelkow E, Mandelkow EM. Inhibition of APP Trafficking by Tau Protein Does Not Increase the Generation of Amyloid-beta Peptides. Traffic. 2006;7:873–888. [PubMed]
  • Handley MT, Haynes LP, Burgoyne RD. Differential dynamics of Rab3A and Rab27A on secretory granules. J Cell Sci. 2007;120:973–984. [PMC free article] [PubMed]
  • Hilbich C, Monning U, Grund C, Masters CL, Beyreuther K. Amyloid-like properties of peptides flanking the epitope of amyloid precursor protein-specific monoclonal antibody 22C11. J Biol Chem. 1993;268:26571–26577. [PubMed]
  • Inomata H, Nakamura Y, Hayakawa A, Takata H, Suzuki T, Miyazawa K, Kitamura N. A scaffold protein JIP-1b enhances amyloid precursor protein phosphorylation by JNK and its association with kinesin light chain 1. J Biol Chem. 2003;278:22946–22955. [PubMed]
  • Johannes L, Lledo PM, Roa M, Vincent JD, Henry JP, Darchen F. The GTPase Rab3a negatively controls calcium-dependent exocytosis in neuroendocrine cells. Embo J. 1994;13:2029–2037. [PubMed]
  • Kaether C, Skehel P, Dotti CG. Axonal membrane proteins are transported in distinct carriers: a two-color video microscopy study in cultured hippocampal neurons. Mol Biol Cell. 2000;11:1213–1224. [PMC free article] [PubMed]
  • Kamal A, Stokin GB, Yang Z, Xia CH, Goldstein LS. Axonal transport of amyloid precursor protein is mediated by direct binding to the kinesin light chain subunit of kinesin-I. Neuron. 2000;28:449–459. [PubMed]
  • Kamal A, Almenar-Queralt A, LeBlanc JF, Roberts EA, Goldstein LS. Kinesin-mediated axonal transport of a membrane compartment containing beta-secretase and presenilin-1 requires APP. Nature. 2001;414:643–648. [PubMed]
  • Kins S, Lauther N, Szodorai A, Beyreuther K. Subcellular trafficking of the amyloid precursor protein gene family and its pathogenic role in Alzheimer’s disease. Neurodegener Dis. 2006;3:218–226. [PubMed]
  • Koo EH, Sisodia SS, Archer DR, Martin LJ, Weidemann A, Beyreuther K, Fischer P, Masters CL, Price DL. Precursor of amyloid protein in Alzheimer disease undergoes fast anterograde axonal transport. Proc Natl Acad Sci U S A. 1990;87:1561–1565. [PubMed]
  • Kratohvil JP. Size of bile salt micelles: techniques, problems and results. Hepatology. 1984;4:85S–97S. [PubMed]
  • Kuan YH, Gruebl T, Soba P, Eggert S, Nesic I, Back S, Kirsch J, Beyreuther K, Kins S. PAT1a modulates intracellular transport and processing of APP, APLP1 and APLP2. J Biol Chem 2006 [PubMed]
  • Lawrence CJ, Dawe RK, Christie KR, Cleveland DW, Dawson SC, Endow SA, Goldstein LS, Goodson HV, Hirokawa N, Howard J, Malmberg RL, McIntosh JR, Miki H, Mitchison TJ, Okada Y, Reddy AS, Saxton WM, Schliwa M, Scholey JM, Vale RD, Walczak CE, Wordeman L. A standardized kinesin nomenclature. J Cell Biol. 2004;167:19–22. [PMC free article] [PubMed]
  • Lazarov O, Morfini GA, Pigino G, Gadadhar A, Chen X, Robinson J, Ho H, Brady ST, Sisodia SS. Impairments in fast axonal transport and motor neuron deficits in transgenic mice expressing familial Alzheimer’s disease-linked mutant presenilin 1. J Neurosci. 2007;27:7011–7020. [PMC free article] [PubMed]
  • Lazarov O, Morfini GA, Lee EB, Farah MH, Szodorai A, DeBoer SR, Koliatsos VE, Kins S, Lee VM, Wong PC, Price DL, Brady ST, Sisodia SS. Axonal transport, amyloid precursor protein, kinesin-1, and the processing apparatus: revisited. J Neurosci. 2005;25:2386–2395. [PubMed]
  • Li JY, Jahn R, Hou XE, Kling-Petersen A, Dahlstrom A. Distribution of Rab3a in rat nervous system: comparison with other synaptic vesicle proteins and neuropeptides. Brain Res. 1996a;706:103–112. [PubMed]
  • Li ZW, Stark G, Gotz J, Rulicke T, Gschwind M, Huber G, Muller U, Weissmann C. Generation of mice with a 200-kb amyloid precursor protein gene deletion by Cre recombinase-mediated site-specific recombination in embryonic stem cells. Proc Natl Acad Sci U S A. 1996b;93:6158–6162. [PubMed]
  • Morfini G, Quiroga S, Rosa A, Kosik K, Caceres A. Suppression of KIF2 in PC12 cells alters the distribution of a growth cone nonsynaptic membrane receptor and inhibits neurite extension. J Cell Biol. 1997;138:657–669. [PMC free article] [PubMed]
  • Morfini G, Pigino G, Szebenyi G, You Y, Pollema S, Brady ST. JNK mediates pathogenic effects of polyglutamine-expanded androgen receptor on fast axonal transport. Nat Neurosci. 2006;9:907–916. [PubMed]
  • Nagano F, Sasaki T, Fukui K, Asakura T, Imazumi K, Takai Y. Molecular cloning and characterization of the noncatalytic subunit of the Rab3 subfamily-specific GTPase-activating protein. J Biol Chem. 1998;273:24781–24785. [PubMed]
  • Okada Y, Yamazaki H, Sekine-Aizawa Y, Hirokawa N. The neuron-specific kinesin superfamily protein KIF1A is a unique monomeric motor for anterograde axonal transport of synaptic vesicle precursors. Cell. 1995;81:769–780. [PubMed]
  • Partearroyo MA, Goni FM, Katime I, Alonso A. Micellar properties of the zwitterionic bile derivative CHAPS. Biochem Int. 1988;16:259–265. [PubMed]
  • Pfister KK, Wagner MC, Stenoien DL, Brady ST, Bloom GS. Monoclonal antibodies to kinesin heavy and light chains stain vesicle-like structures, but not microtubules, in cultured cells. J Cell Biol. 1989;108:1453–1463. [PMC free article] [PubMed]
  • Reinhard C, Hebert SS, De Strooper B. The amyloid-beta precursor protein: integrating structure with biological function. Embo J. 2005;24:3996–4006. [PubMed]
  • Rusu P, Jansen A, Soba P, Kirsch J, Lower A, Merdes G, Kuan YH, Jung A, Beyreuther K, Kjaerulff O, Kins S. Axonal accumulation of synaptic markers in APP transgenic Drosophila depends on the NPTY motif and is paralleled by defects in synaptic plasticity. Eur J Neurosci. 2007;25:1079–1086. [PubMed]
  • Sabo SL, Ikin AF, Buxbaum JD, Greengard P. The amyloid precursor protein and its regulatory protein, FE65, in growth cones and synapses in vitro and in vivo. J Neurosci. 2003;23:5407–5415. [PubMed]
  • Sakane A, Manabe S, Ishizaki H, Tanaka-Okamoto M, Kiyokage E, Toida K, Yoshida T, Miyoshi J, Kamiya H, Takai Y, Sasaki T. Rab3 GTPase-activating protein regulates synaptic transmission and plasticity through the inactivation of Rab3. Proc Natl Acad Sci U S A. 2006;103:10029–10034. [PubMed]
  • Sakisaka T, Meerlo T, Matteson J, Plutner H, Balch WE. Rab-alphaGDI activity is regulated by a Hsp90 chaperone complex. Embo J. 2002;21:6125–6135. [PubMed]
  • Satpute-Krishnan P, DeGiorgis JA, Conley MP, Jang M, Bearer EL. A peptide zipcode sufficient for anterograde transport within amyloid precursor protein. Proc Natl Acad Sci U S A. 2006;103:16532–16537. [PubMed]
  • Schluter OM, Basu J, Sudhof TC, Rosenmund C. Rab3 superprimes synaptic vesicles for release: implications for short-term synaptic plasticity. J Neurosci. 2006;26:1239–1246. [PubMed]
  • Schluter OM, Schmitz F, Jahn R, Rosenmund C, Sudhof TC. A complete genetic analysis of neuronal Rab3 function. J Neurosci. 2004;24:6629–6637. [PubMed]
  • Selkoe DJ. Alzheimer’s disease: genes, proteins, and therapy. Physiol Rev. 2001;81:741–766. [PubMed]
  • Shapira M, Zhai RG, Dresbach T, Bresler T, Torres VI, Gundelfinger ED, Ziv NE, Garner CC. Unitary assembly of presynaptic active zones from Piccolo-Bassoon transport vesicles. Neuron. 2003;38:237–252. [PubMed]
  • Simons M, Ikonen E, Tienari PJ, Cid-Arregui A, Monning U, Beyreuther K, Dotti CG. Intracellular routing of human amyloid protein precursor: axonal delivery followed by transport to the dendrites. J Neurosci Res. 1995;41:121–128. [PubMed]
  • Soba P, Eggert S, Wagner K, Zentgraf H, Siehl K, Kreger S, Lower A, Langer A, Merdes G, Paro R, Masters CL, Muller U, Kins S, Beyreuther K. Homo- and heterodimerization of APP family members promotes intercellular adhesion. Embo J. 2005;24:3624–3634. [PubMed]
  • Stahl B, von Mollard GF, Walch-Solimena C, Jahn R. GTP cleavage by the small GTP-binding protein Rab3A is associated with exocytosis of synaptic vesicles induced by alpha-latrotoxin. J Biol Chem. 1994;269:24770–24776. [PubMed]
  • Stamer K, Vogel R, Thies E, Mandelkow E, Mandelkow EM. Tau blocks traffic of organelles, neurofilaments, and APP vesicles in neurons and enhances oxidative stress. J Cell Biol. 2002;156:1051–1063. [PMC free article] [PubMed]
  • Star EN, Newton AJ, Murthy VN. Real-time imaging of Rab3a and Rab5a reveals differential roles in presynaptic function. J Physiol. 2005;569:103–117. [PubMed]
  • Takamori S, Holt M, Stenius K, Lemke EA, Gronborg M, Riedel D, Urlaub H, Schenck S, Brugger B, Ringler P, Muller SA, Rammner B, Grater F, Hub JS, De Groot BL, Mieskes G, Moriyama Y, Klingauf J, Grubmuller H, Heuser J, Wieland F, Jahn R. Molecular anatomy of a trafficking organelle. Cell. 2006;127:831–846. [PubMed]
  • Tienari PJ, De Strooper B, Ikonen E, Simons M, Weidemann A, Czech C, Hartmann T, Ida N, Multhaup G, Masters CL, Van Leuven F, Beyreuther K, Dotti CG. The beta-amyloid domain is essential for axonal sorting of amyloid precursor protein. Embo J. 1996;15:5218–5229. [PubMed]
  • Torroja L, Packard M, Gorczyca M, White K, Budnik V. The Drosophila beta-amyloid precursor protein homolog promotes synapse differentiation at the neuromuscular junction. J Neurosci. 1999;19:7793–7803. [PubMed]
  • Tsuboi T, Fukuda M. Rab3A and Rab27A cooperatively regulate the docking step of dense-core vesicle exocytosis in PC12 cells. J Cell Sci. 2006;119:2196–2203. [PubMed]
  • van Weering JR, Toonen RF, Verhage M. The role of Rab3a in secretory vesicle docking requires association/dissociation of guanidine phosphates and Munc18–1. PLoS ONE. 2007;2:e616. [PMC free article] [PubMed]
  • Wang P, Yang G, Mosier DR, Chang P, Zaidi T, Gong YD, Zhao NM, Dominguez B, Lee KF, Gan WB, Zheng H. Defective neuromuscular synapses in mice lacking amyloid precursor protein (APP) and APP-Like protein 2. J Neurosci. 2005;25:1219–1225. [PubMed]
  • Weidemann A, Konig G, Bunke D, Fischer P, Salbaum JM, Masters CL, Beyreuther K. Identification, biogenesis, and localization of precursors of Alzheimer’s disease A4 amyloid protein. Cell. 1989;57:115–126. [PubMed]
  • Yang L, Wang B, Long C, Wu G, Zheng H. Increased asynchronous release and aberrant calcium channel activation in amyloid precursor protein deficient neuromuscular synapses. Neuroscience. 2007;149:768–778. [PMC free article] [PubMed]
  • Zhai RG, Vardinon-Friedman H, Cases-Langhoff C, Becker B, Gundelfinger ED, Ziv NE, Garner CC. Assembling the presynaptic active zone: a characterization of an active one precursor vesicle. Neuron. 2001;29:131–143. [PubMed]