PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC 2010 June 16.
Published in final edited form as:
PMCID: PMC2846613
NIHMSID: NIHMS176567

Unexpected Lack of Hypersensitivity in LRRK2 Knock-out Mice to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)

Abstract

Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are the most common known cause of Parkinson's disease (PD). Whether loss of LRRK2 function accounts for neurodegeneration of dopamine neurons in PD is not known, nor is it known whether LRRK2 kinase activity modulates the susceptibility of dopamine (DA) neurons to the selective dopaminergic toxin, 1-methyl-4-phenyl-1,2,3,6 tetrahydropyridine (MPTP). To better understand the role of LRRK2 in DA neuronal survival and its role in the susceptibility of DA neurons to MPTP, we generated LRRK2 knockout (KO) mice lacking the kinase domain of LRRK2. Here we show that LRRK2 KO mice are viable and have no major abnormalities and live to adulthood. The dopaminergic system is normal in LRRK2 KO mice as assessed via HPLC for DA and its metabolites and via stereologic assessment of DA neuron number in young and aged mice. Importantly, there is no significant difference in the susceptibility of LRRK2 KO and wild type (WT) mice to MPTP. These results suggest that LRRK2 plays little if any role in the development and survival of DA neurons under physiologic conditions. Thus, PD due to LRRK2 mutations are likely not due to a loss of function. Moreover, LRRK2 is not required for the susceptibility of DA neurons to MPTP.

Keywords: Parkinson's disease, LRRK2, MPTP, knockouts, mitochondria, Dopamine

Introduction

Progressive and selective loss of dopaminergic neurons in the substantia nigra pars compacta (SNpc) is one of the main neuropathological findings in Parkinson's disease (PD). Although PD is mostly a sporadic disorder and the etiology is not known, its pathogenesis may involve genetic susceptibility and environmental factors, that will cause oxidative stress, impairments in mitochondria and the proteosome, or aggregation of misfolded proteins (Dawson and Dawson, 2003; Vila and Przedborski, 2004; Moore et al., 2005).

Only a 10% of the PD cases are linked to Mendelian genetic defects, and mutations in Leucine-rich repeat kinase 2 (LRRK2) are the most frequent of the familial forms of PD (Gasser, 2007; Lees et al., 2009). Several missense mutations distributed along the protein have been reported, but the role of LRRK2 in the pathophysiology of PD is still not well known. The kinase activity may be a link between LRRK2 and PD (Smith et al., 2005; West et al., 2005; West et al., 2007) as attenuation of LRRK2 kinase activity prevents LRRK2 toxicity in cellular models of PD. LRRK2 also has independent GTPase activity that can regulate its kinase activity (Greggio et al., 2008). It is assumed that LRRK2 mutations linked to PD are gain of function mutations in which the kinase domain is critical for the toxic actions of mutant LRRK2 (Biskup and West, 2009).

Previous studies showed that LRRK2 is associated with the mitochondria (Biskup et al., 2006), and that the toxicity mediated by LRRK2 mutants could be due to mitochondria-dependent apoptosis (Iaccarino et al., 2007). Wild-type LRRK2, but not the mutants attenuate hydrogen peroxide (H2O2)-induced oxidative stress suggesting a protective role for LRRK2 (Liou et al., 2008). Moreover, data generated in lines of Caenorhabditis elegans expressing human wild-type and mutant LRRK2 suggest that LRRK2 plays a role modulating the response of the mitochondria to different stressors like rotenone and paraquat (Saha et al., 2009) and work in Drosophila indicate that LRRK2 mutant flies display increased sensitivity to rotenone, a mitochondrial complex I inhibitor (Ng et al., 2009). Thus, it seems that LRRK2 may play important roles in mitochondrial function.

Here, we show for the first time that the absence of LRRK2 in mice does not lead to major progressive behavioral, neurochemical, or anatomical deficits in the dopaminergic system. In addition, ablation of LRRK2 unexpectedly does not exacerbate the dopaminergic neurodegeneration caused by the parkinsonian neurotoxin 1-methyl-4-phenyl-1,2,3,6 tetrahydropyridine (MPTP). Thus, LRRK2 appears to play little if any role in the maintenance or the survival of dopamine (DA) neurons or the susceptibility of DA neurons to MPTP.

Materials and Methods

Gene Targeting and Generation of LRRK2 Null Mice

The LRRK2 gene contains 51 exons and the target sequences for generating LRRK2 knockout mice include partial exon 39 and complete exon 40. The map of designed targeting construct for generating LRRK2 knockout mice is shown in Figure 1A. Restriction enzyme site Bam HI was used for inserting the long arm into the targeting construct. Cla I and Aat II were used for inserting the short arm, and AscI and Sal I were used for inserting a stop codon and a loxP flanked neomycin gene into the targeting construct. Rsr II was used for inserting the negative selection gene thymidine kinase (TK) into the targeting construct and Xho I was used to linearize the targeting construct. The expected mutant allele is also shown in Figure 1A. The expression of LRRK2 is disrupted by the deletion of partial exon 39 and complete exon 40 as well as by the introduction of a stop codon into the coding sequences. Embryonic stem cells carrying the mutant allele were injected into blastocysts and the resulting male chimeric mice were bred to C57BL/6 female mice to obtain heterozygous LRRK2 mutant male and female mice, which were subsequently bred to generate LRRK2 null mice.

Figure 1
Targeted disruption of LRRK2 in LRRK2 KO mice. (A) Schematic representation of the targeting strategy. (B) Southern blot analysis of genomic DNA from WT (+/+), heterozygous (+/-) and homozygous LRRK2 KO (-/-) mice. (C) PCR analysis of genomic DNA from ...

Genotyping LRRK2 Mice by Polymerase Chain Reaction

LRRK2 mice genomic DNA was purified from mouse tail tissue using standard protocols. Primer pair (forward: 5′ CCCAGGGCTGAGAACGATTAAGTC 3′; reverse: 5′CTGGAGTGGACTCAGGGTTACAGC3′) was used to amplify a 590-bp DNA fragment from wild-type LRRK2 allele, and primer pair (forward: 5′GGCCTACCCGCTTCCATTGCTCAGCGG3′; reverse: 5′CCGAACAAACGACCCAACACCCGTGCG3′) was used to amplify a 328-bp DNA fragment from mutant LRRK2 allele. The amplification products were separated on a 1% agarose gel.

Southern and Northern blot analysis

Southern blot analysis was carried out by using DNA extracted from liver after proteinase K digestion. DNA (20 μg) was digested with SphI, separated on a 1% agarose gel, denatured, and neutralized by 0.5 M NaOH/1.5 M NaCl and 1 M Tris-HCl (pH 8.0)/1.5 M NaCl, respectively, and transferred onto a nylon membrane (Nytran SuperCharge, Schleicher & Schuell) in the presence of 10 × SSC. A region downstream of exon 40 of the mouse LRRK2 gene was amplified by PCR using a pair of primers (sense: TGCAGACAGGACATCACACCGTTT, antisense: AGGCTCAAACCCGGACATGTGA, see Fig. 1A – S-probe) from the target construct. This fragment was labeled in the presence of [32P]-dATP and used as probe for hybridization at 65°C for 16 h. After hybridization, the membrane was washed in 2 × SSC/0.1% SDS (5 min, room temperature) and 0.2× SSC/0.1% SDS (2 × 10 min, 68°C), and the result was visualized using a Phospho-Imager system (Cyclone, Packard). For Northern blot analysis, total RNA was extracted from mouse brain using the acid-phenol-guanidine isothiocyanate method (TRIzol, Invitrogen). Total RNA (5 μg) was applied to a formaldehyde-denatured agarose gel and transferred onto a nylon membrane. A region of mouse LRRK2 cDNA (1730 nt to 2310 nt) was amplified by PCR using a plasmid containing the full-length mouse LRRK2 cDNA as template, (kindly provided by Bettina Lorenz-Ceperieux). The resultant fragment was labeled in the presence of [32P]-dATP and used to probe the membrane, and the result was visualized using a phospho-imager system.

Histopathology and Clinical Pathology

For histopathology assessment, tissues were fixed in 10% neutral buffered formalin, processed and embedded in paraffin. Five micron sections were mounted on glass slides and stained with hematoxylin and eosin for microscopic examination. Automated CBC's (HemaVet 950FS; Drew Scientific; Waterbury, CT) and serum chemistry panels (Vet Ace; Diagnostic Technologies; West Caldwell, NJ) were performed at an in-house core laboratory according to manufacturer's instructions.

Immunohistochemistry and Stereological Cell Counts

Mice were perfused with ice-cold PBS and 4% paraformaldehyde/PBS (pH 7.4). Brains were removed and postfixed 4 hours in the same fixative. After cryoprotection in 20% and 30% sucrose/PBS (pH 7.4), brains were frozen, and serial coronal sections (30-μm sections) were cut with a microtome. Free floating sections were blocked with 4% goat serum/PBS plus 0.2% Triton × 100 and incubated with primary antibodies against tyrosine hydroxylase (TH) (rabbit polyclonal; Novus Biologicals, Littleton, CO) or α-synuclein (mouse monoclonal; BD Transduction Laboratories, San Jose, CA), followed by incubation with biotin-conjugated anti-rabbit or anti-mouse (goat polyclonal; Jackson ImmunoResearch), ABC reagents (Vector Laboratories), and SigmaFast DAB Peroxidase Substrate (Sigma). The sections stained for TH were then counterstained with Nissl (0.09% thionin) for 6 min, followed by destaining with 1% formalin acetic acid for 40 s. Cell counts of TH and Nissl-positive neurons of the SNpc were counted using the optical fractionator STEREO INVESTIGATOR software (MicroBrightField).

HPLC analysis of biogenic amines

Biogenic amines in discrete brain regions were measured by sonicating the respective tissues in chilled 0.1 M perchloric acid (100μl/mg). After centrifugation (15,000 × g, 20 min, 4 °C), 10 μl of the supernatant was isocratically eluted through a 80 × 4.6 mm C18 column (ESA, Inc. Chelmsford, MA) with a mobile phase containing 75 mM of NaH2PO4, 1.5 mM Octane sulphonic acid, 5% acetonitrile (pH 3.0), and detected by a two-channel Coulochem II electrochemical detector (ESA, Inc. Chelmsford, MA) kept at a potential of 0.7 mv and flow rate of 1 ml/min. Data were collected and processed using external standards for respective amines on a EZChrome Elite Client Workstation (ESA, Inc. Chelmsford, MA). Data were normalized by protein concentration or tissue weight.

MPTP Injections

All procedures were approved by and conformed to the guidelines of the Institutional Animal Care Committee of Johns Hopkins University. LRRK2 KO animals were backcrossed to C57B6 mice for 10 generations and LRRK2 KO and WT littermates from F9 and F10 heterozygote crosses were used for the MPTP studies. Animals received four injections i.p. of MPTP-HCl (20 mg/kg free base, Sigma Aldrich) or saline control every 2 hours. Animals were decapitated or perfused 7 days after the last MPTP injection and brains were removed for analysis.

Immunoblot analysis

Mouse brain tissue from 10-week old females was homogenized in 4 × volumes of ice-cold PBS containing 0.1% Triton X-100 with protease inhibitors [0.5mM AEBSF (Sigma), 2ug/ml Aprotinin (Roche), 5ug/ml Bestatin (Sigma), 5ug/ml E-64 (Roche), 5ug/ml Leupeptin (Roche), and 1ug/ml Pepstatin (Sigma)]. The tissue homogenate was centrifuged at 37,000 g at 4° C for 20 min. The supernatant was used for the western blot. Protein concentration was measured by BCA protein assay. Brain lysates (40 μg) were electrophoresed in 7% SDS-PAGE gels and transferred to nitrocellulose membranes. Membranes were incubated with primary antibody diluted in blocking solution (5% non-fat milk overnight at 4° C, and for 1 h with a secondary antibody labelled with horseradish peroxidase (1:5000-20000). The signal was detected using chemiluminescent substrates. Primary polyclonal antibodies 5514, which recognizes amino acids 2500 through 2515 (Biskup et al., 2006), 1182E which recognizes amino acids 841 to 960 (Waxman et al., 2009), 5824 which recognizes amino acids 1 to 500 and monoclonal antibody 6.1, which recognizes amino acids 1 to 500 (X. Li, V.L. Dawson and T.M. Dawson, unpublished observation) were used for immunoblot against LRRK2. After extensive washing, the blot was incubated with the secondary anti-Rabbit-HRP antibody (GE Healthcare) (for antibody 5514, 1182, and 5824) or the secondary anti-Mouse-HRP antibody (GE Healthcare) (for antibody 6.1) at room temperature for 1 hour using a 1:10,000 dilution. The immunoblot signal was detected by SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific).

Statistical analysis

Significance was determined by one or two-way ANOVA followed by the Student–Newman–Keuls test, or a two-tailed non-paired Student's t-test. Significance was set at p ≤ 0.05.

Results

Generation of LRRK2 KO mice

LRRK2 was disrupted by deletion of exon 39 and 40, which contains the kinase domain, and by the introduction of a stop codon and a neo selection cassette (Figure 1A). Heterozygous male and female mice were bred to generate homozygous mice and wild type (WT) littermates. Southern blot and PCR analysis (Fig. 1B and C) confirms disruption of LRRK2. Northern blot analysis of LRRK2 KO mouse brain shows the lack of endogenous LRRK2 transcript (Fig. 1D). Immunoblot analyses using four different antibodies spanning different regions of the LRRK2 protein including c-terminal and n-terminal antibodies indicate that there is a reduction of LRRK2 protein in heterozygous mice and no LRRK2 protein expression in LRRK2 KO mice (Fig. 1E).

Histopathology and Clinical pathology

The offspring of the heterozygous crosses gave rise to all three genotypes and 7 to 10% of the homozygous mice are not viable (Table 1). The oldest homozygous mice currently have lived to 2 years of age. No general abnormalities are noted in newborn through young adult LRRK2 KO mice and they appear normal in their growth rates and fertility. A cohort that included 26 LRRK2 KO and 19 WT mice was aged and analyzed at 16-20 months of age. The brain and non-brain tissues were analyzed separately. Alopecia of the skin is commonly observed in the LRRK2 KO mice (data not shown). The alopecia is usually centered on the muzzle and head and is interpreted as being due to excessive grooming. Splenomegaly is also common in KO mice. However, even though the average spleen size of KO mice was larger than in WT mice (KO = 263±65 mg, n=30; WT = 200±49 mg, n=19) the difference is not significantly different as some WT mice of the same age had splenomegaly and some KO mice had spleens of normal size. Although there was some mild individual variation, no consistent alterations in the automated CBC, serum chemistry, or histopathology screens distinguish LRRK2 KO from WT mice (data not shown).

Table 1
Reduced numbers of knockout animals

Nigrostriatal dopaminergic system in LRRK2 KO mice

LRRK2 KO animals show no differences in brain development and gross anatomy. Gross histological examination of the brain reveals normal morphology in LRRK2 KO mice of different ages (data not shown). Total content of DA, serotonin and its metabolites in different brain regions were analyzed in KO and WT age-matched littermate mice. No significant changes in the levels of neurotransmitters are observed (Table 2). We examined striatal tyrosine hydroxylase (TH) immunoreactivity in LRRK2 KO and WT age-matched littermate mice. There is no difference in the dopaminergic innervation of the striatum in 2-3 month (data no shown) and 18-24 month old mice (Fig. 2A and B). The number of dopaminergic neurons in the substantia nigra pars compacta (SNpc) was assessed by TH immunoreactivity (Fig. 2C and D). We performed stereological quantification of TH- and Nissl-positive neurons in SNpc (Fig. 2E). We did not find significant differences in the number of dopaminergic neurons in SNpc of 2-3 month and 18-22 month LRRK2 KO mice compared with WT mice (Fig. 2E). In addition, we determined the concentration of DA and its metabolites in the striatum and we observed no change in the levels of DA and its metabolites, 3,4-dihydroxyphenylactic acid (DOPAC) and homovanillic acid (HVA) in KO mice compared with WT age-matched littermate (Fig. 2F and G).

Figure 2
Characterization of the nigrostriatal dopaminergic system in LRRK2 KO mice. (A-D) Immunohistochemical staining for TH and Nissl was performed on coronal brain sections from (A and C) LRRK2 WT and (B and D KO mice). (A and B) Striatum and (C and D) ventral ...

LRKK2 KO susceptibility to MPTP-Induced nigrostriatal Neuronal Death

Since LRRK2 is localized, in part, to mitochondria (Biskup et al., 2006) and studies suggest that it may play an important role in mitochondrial function (Iaccarino et al., 2007; Ng et al., 2009; Saha et al., 2009), the vulnerability of nigral dopaminergic neurons to the neurotoxin, MPTP, was assessed (Fig. 3). Two to three month old WT and KO mice were injected with MPTP (20 mg/kg every two hours, four times) or saline. The effects of MPTP 7 days after the MPTP treatment were examined histologically. Immunostaining in LRRK2 KO and WT SNpc sections showed decreased TH-positive neuron numbers (Fig. 3B and D) compared with saline-treated controls (Fig. 3A and C). Quantitation of TH- and Nissl-positive neuron numbers in MPTP-treated LRRK2 KO and WT mice shows a significant loss of dopaminergic neurons in mice treated with MPTP (Fig. 3E) and striatal dopaminergic nerve terminals (data not shown), but unexpectedly no significant differences are observed between KO and WT mice. HPLC analysis reveals a significant reduction in striatal dopamine and its metabolites (DOPAC and HVA) in WT and LRRK2 KO mice injected with MPTP compared to saline controls (Fig. 3F). However, no statistical differences in the levels of dopamine and its metabolites after MPTP administration are observed between WT and KO mice (Fig. 3F). Since LRRK2 and alpha-synuclein are found in a percentage of Lewy bodies, sections were immunostained for alpha-synuclein in KO and WT mice treated with saline or MPTP. No difference in staining was observed between groups (data not shown).

Figure 3
Evaluation of the effect of MPTP in LRRK2 KO mice. Stereological counting of dopaminergic neurons in the substantia nigra of mice treated with MPTP. TH immuno-staining in the substantia nigra of (A and B) WT and (C and D) LRRK2 KO mice (B and D) treated ...

Discussion

In the present study, we show for the first time that ablation of LRRK2 gene in mice does not lead to the loss of dopaminergic neurons. Moreover, LRRK2 KO mice are viable, and live a normal life span with clinical and pathologic feature indistinguishable from WT littermate mice. In addition, we provide evidence that the LRRK2 protein is dispensable for the development and maintenance of the nigrostriatal pathway. Our results agree with a previous report, which observed that the Drosophila ortholog of LRRK2 is dispensable for the survival of dopaminergic neurons (Wang et al., 2008). A different study performed in Drosophila showed opposite results, in which the loss of the LRRK2 ortholog induced degeneration of DA neurons (Lee et al., 2007). What factors account for the difference in the two Drosophila studies is not clear. However, in mice LRRK2 does not appear to be essential for the development and maintenance of DA neurons. It is somewhat surprising that Mendelian ratios obtained from offspring of heterozygote matings suggest that ablation of LRRK2 leads to a 7-10% loss of homozygotes during embryonic and perinatal development in mice. The reason for this is not clear at present.

The neurotoxin MPTP is an inhibitor of the mitochondrial complex I, and several lines of evidence have linked LRRK2 with the mitochondrial function (Biskup et al., 2006; Iaccarino et al., 2007; Ng et al., 2009; Saha et al., 2009). Surprisingly when we challenged the nigrostriatal pathway with the neurotoxin MPTP, we did not find any statistically significant differences in the number of neurons of the SNpc or the DA content between WT and LRRK2 KO mice. These results could point to the involvement of LRRK2 in a pathway independent of the mitochondria. LRRK2 has been associated with the extrinsic cell death pathway that it is mitochondrial independent (Ho et al., 2009) and with Wnt signaling pathways (Sancho et al., 2009). Interestingly, a recent report in lrk-1 ablated C. elegans reported an enhanced vulnerability of dopaminergic neurons to rotenone, while WT LRRK2 overexpressing animals showed protection against this mitochondrial toxin (Saha et al., 2009). In addition, transgenic expression of mutant LRRK2 in Drosophila, but not WT LRRK2 renders dopaminergic neurons more vulnerable to rotenone (Ng et al., 2009). Thus, WT LRRK2 seems to play little if any role as a determinant of susceptibility of mitochondria to mitochondrial toxins, whereas mutant LRRK2 through as of yet unidentified gain of function mechanism could increase the vulnerability of mitochondria to mitochondrial toxins. Further study is required to understand the relationship of mutant LRRK2 to mitochondrial dysfunction, which will contribute to elucidating the role of LRRK2 in the pathogenesis of PD.

Acknowledgments

The authors thank Drs. Darren Moore and Andrew West for assistance with the antibody generation and initial characterization of the mice. E.A.-M and R.M. had Postdoctoral Fellowship from Ministerio de Educación y Ciencia, Spain. This work was supported by grants from NIH/NINDS P50 NS38377, NS054207. M.F.B. was supported by the Michael J. Fox Foundation, the Parkinson's Disease Foundation, and Department of Defense, and B.T. by NIH/NINDS grant NS060885. T.M.D. is the Leonard and Madlyn Abramson Professor in Neurodegenerative Diseases.

References

  • Biskup S, West AB. Zeroing in on LRRK2-linked pathogenic mechanisms in Parkinson's disease. Biochim Biophys Acta. 2009;1792:625–633. [PMC free article] [PubMed]
  • Biskup S, Moore DJ, Celsi F, Higashi S, West AB, Andrabi SA, Kurkinen K, Yu SW, Savitt JM, Waldvogel HJ, Faull RL, Emson PC, Torp R, Ottersen OP, Dawson TM, Dawson VL. Localization of LRRK2 to membranous and vesicular structures in mammalian brain. Ann Neurol. 2006;60:557–569. [PubMed]
  • Dawson TM, Dawson VL. Molecular pathways of neurodegeneration in Parkinson's disease. Science. 2003;302:819–822. [PubMed]
  • Gasser T. Update on the genetics of Parkinson's disease. Mov Disord. 2007;22 17:S343–350. [PubMed]
  • Greggio E, Zambrano I, Kaganovich A, Beilina A, Taymans JM, Daniels V, Lewis P, Jain S, Ding J, Syed A, Thomas KJ, Baekelandt V, Cookson MR. The Parkinson disease-associated leucine-rich repeat kinase 2 (LRRK2) is a dimer that undergoes intramolecular autophosphorylation. J Biol Chem. 2008;283:16906–16914. [PMC free article] [PubMed]
  • Ho CCY, Rideout HJ, Ribe E, Troy CM, Dauer WT. The Parkinson Disease Protein Leucine-Rich Repeat Kinase 2 Transduces Death Signals via Fas-Associated Protein with Death Domain and Caspase-8 in a Cellular Model of Neurodegeneration. J Neurosci. 2009;29:1011–1016. [PMC free article] [PubMed]
  • Iaccarino C, Crosio C, Vitale C, Sanna G, Carri MT, Barone P. Apoptotic mechanisms in mutant LRRK2-mediated cell death. Hum Mol Genet. 2007;16:1319–1326. [PubMed]
  • Lee SB, Kim W, Lee S, Chung J. Loss of LRRK2/PARK8 induces degeneration of dopaminergic neurons in Drosophila. Biochem Biophys Res Commun. 2007;358:534–539. [PubMed]
  • Lees AJ, Hardy J, Revesz T. Parkinson's disease. Lancet. 2009;373:2055–2066. [PubMed]
  • Liou AK, Leak RK, Li L, Zigmond MJ. Wild-type LRRK2 but not its mutant attenuates stress-induced cell death via ERK pathway. Neurobiol Dis. 2008;32:116–124. [PMC free article] [PubMed]
  • Moore DJ, West AB, Dawson VL, Dawson TM. Molecular pathophysiology of Parkinson's disease. Annu Rev Neurosci. 2005;28:57–87. [PubMed]
  • Ng CH, Mok SZS, Koh C, Ouyang X, Fivaz ML, Tan EK, Dawson VL, Dawson TM, Yu F, Lim KL. Parkin Protects Against LRRK2 G2019S Mutant-induced Dopaminergic Neurodegeneration in Drosophila. Journal of Neuroscience. 2009 in press. [PMC free article] [PubMed]
  • Saha S, Guillily MD, Ferree A, Lanceta J, Chan D, Ghosh J, Hsu CH, Segal L, Raghavan K, Matsumoto K, Hisamoto N, Kuwahara T, Iwatsubo T, Moore L, Goldstein L, Cookson M, Wolozin B. LRRK2 modulates vulnerability to mitochondrial dysfunction in Caenorhabditis elegans. J Neurosci. 2009;29:9210–9218. [PMC free article] [PubMed]
  • Sancho RM, Law BM, Harvey K. Mutations in the LRRK2 Roc-COR tandem domain link Parkinson's disease to Wnt signalling pathways. Hum Mol Genet 2009 [PMC free article] [PubMed]
  • Smith WW, Pei Z, Jiang H, Moore DJ, Liang Y, West AB, Dawson VL, Dawson TM, Ross CA. Leucine-rich repeat kinase 2 (LRRK2) interacts with parkin, and mutant LRRK2 induces neuronal degeneration. Proc Natl Acad Sci U S A. 2005;102:18676–18681. [PubMed]
  • Vila M, Przedborski S. Genetic clues to the pathogenesis of Parkinson's disease. Nat Med. 2004;10(Suppl):S58–62. [PubMed]
  • Wang D, Tang B, Zhao G, Pan Q, Xia K, Bodmer R, Zhang Z. Dispensable role of Drosophila ortholog of LRRK2 kinase activity in survival of dopaminergic neurons. Mol Neurodegener. 2008;3:3. [PMC free article] [PubMed]
  • Waxman EA, Covy JP, Bukh I, Li X, Dawson TM, Giasson BI. Leucine-rich repeat kinase 2 expression leads to aggresome formation that is not associated with alpha-synuclein inclusions. J Neuropathol Exp Neurol. 2009;68:785–796. [PMC free article] [PubMed]
  • West AB, Moore DJ, Biskup S, Bugayenko A, Smith WW, Ross CA, Dawson VL, Dawson TM. Parkinson's disease-associated mutations in leucine-rich repeat kinase 2 augment kinase activity. Proc Natl Acad Sci U S A. 2005;102:16842–16847. [PubMed]
  • West AB, Moore DJ, Choi C, Andrabi SA, Li X, Dikeman D, Biskup S, Zhang Z, Lim KL, Dawson VL, Dawson TM. Parkinson's disease-associated mutations in LRRK2 link enhanced GTP-binding and kinase activities to neuronal toxicity. Hum Mol Genet. 2007;16:223–232. [PubMed]