PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC 2010 August 24.
Published in final edited form as:
PMCID: PMC2843151
NIHMSID: NIHMS181637

Homer 1a gates the induction mechanism for endocannabinoid-mediated synaptic plasticity

Abstract

At hippocampal excitatory synapses, endocannabinoids (eCBs) mediate two forms of retrograde synaptic inhibition that are induced by postsynaptic depolarization or activation of metabotropic glutamate receptors (mGluRs). The homer family of molecular scaffolds provides spatial organization to regulate postsynaptic signaling cascades, including those activated by mGluRs. Expression of the homer 1a (H1a) immediate early gene produces a short homer protein that lacks the domain required for homer oligomerization, enabling it to uncouple homer assemblies. Here, we report that H1a differentially modulates two forms of eCB-mediated synaptic plasticity, depolarization-induced suppression of excitation (DSE) and metabotropic suppression of excitation (MSE). Excitatory postsynaptic currents were recorded from cultured hippocampal neurons and DSE evoked by a 15 s depolarization to 0 mV and MSE evoked by a type I mGluR agonist. Expression of H1a enhanced DSE and inhibited MSE at the same synapse. Many physiologically important stimuli initiate H1a expression including brain derived neurotrophic factor (BDNF). Treating hippocampal cultures with BDNF increased transcription of H1a and uncoupled homer1c-GFP clusters. BDNF treatment blocked MSE and enhanced DSE. Thus, physiological changes in H1a expression gate the induction pathway for eCB-mediated synaptic plasticity by uncoupling mGluR from eCB production.

Keywords: endocannabinoid, homer, brain derived neurotrophic factor, DSE, metabotropic glutamate receptor, synaptic plasticity

Introduction

The endocannabinoid (eCB) system is an important mediator of synaptic plasticity in the CNS. eCBs produced postsynaptically diffuse in a retrograde direction to act on presynaptic cannabinoid receptor-1 (CB1R) and inhibit neurotransmitter release (Lovinger, 2008). Production of eCBs is initiated by two distinct yet related postsynaptic mechanisms: depolarization and metabotropic receptor activation. These processes induce short-term plasticity at excitatory synapses, termed depolarization-induced (DSE) or metabotropic (MSE) suppression of excitation. DSE requires Ca2+ influx via voltage-gated Ca2+ channels (VGCC), which may be amplified by ryanodine sensitive Ca2+ stores, and subsequent Ca2+-stimulated production of 2-arachydonylglycerol (2-AG) (Isokawa and Alger, 2006). Type I metabotropic glutamate receptors (mGluRs) produce MSE by activating phospholipase Cβ (PLCβ) to release diacylglycerol (DAG) that is hydrolyzed by DAG lipase (DGL) to 2-AG (Maejima et al., 2001; Straiker and Mackie, 2006).

The Homer family of postsynaptic scaffolding proteins is central to synaptic development, organization, and plasticity (Worley et al., 2007) and has been associated with neuronal disease and addiction (Szumlinski et al., 2006; Szumlinski et al., 2008). Homer proteins contain a N-terminal Ena/VASP homology domain 1 (EVH1 domain) that recognizes target proteins involved in eCB signaling including: mGluR, PLCβ, ryanodine receptors (RyR), and L-Type VGCCs (Worley et al., 2007). Homer proteins couple signaling molecules in the postsynaptic density (PSD) by oligomerizing through their C-terminal coiled coil (CC) domain and cross-linking with other structural proteins in the PSD such as Shank and PSD-95 (Tu et al., 1999). Thus, the combination of EVH1 interaction with signaling proteins and CC-domain-mediated oligomerization leads to the structural and functional apposition of synaptic proteins. Three homer genes are subject to alternative splicing yielding an array of protein products (Shiraishi-Yamaguchi and Furuichi, 2007). Expression of the short homer isoform 1a (H1a) uncouples CC-homer structures (Xiao et al., 1998). H1a contains an EVH1 domain but lacks the CC-domain, enabling it to act in a dominant-negative capacity. H1a is an immediate early gene induced by glutamate (Sato et al., 2001), brain derived neurotrophic factor (BDNF) (Kato et al., 2003), activation of adenylyl cyclase (Kammermeier, 2008), stimuli that induce long-term potentiation (Kato et al., 1998), and exploratory behavior (Brakeman et al., 1997). Indeed, the rapid induction and dominant-negative properties of H1a make it a powerful modulator of postsynaptic function.

Several studies suggest a link between Homer proteins and eCB signaling. Homer 2a (H2a) properly localized the 2-AG synthetic enzyme DGL in Neuro-2a cells (Jung et al., 2007) and mGluRs are attached to homer scaffolds. The inhibition of eCB-mediated long-term depression (LTD) by cocaine correlated with the expression of CC-homers (Fourgeaud et al., 2004). Thus, there are intriguing hints linking homer proteins to eCB signaling but this putative relationship has not been fully examined.

Here we tested the hypothesis that H1a regulates the induction of eCB mediated synaptic plasticity. Our data indicate that H1a expression suppressed metabotropic-mediated while it enhanced depolarization-mediated eCB production. Furthermore, treatment with BDNF elevated H1a levels demonstrating a physiological mechanism to regulate eCB-mediated synaptic plasticity.

Materials and Methods

Materials

Dulbecco’s modified Eagle medium (DMEM) and sera were purchased from InVitrogen (Carlsbad, CA). BDNF was obtained from R&D Systems (Minneapolis, MN). Bicuculline methochloride and dihydroxyphenylglycine (DHPG) were purchased from Ascent Scientific (Princeton, NJ). All other reagents were purchased from Sigma (St. Louis, MO).

Cell Culture

Rat hippocampal neurons were grown in primary culture as described previously (Pottorf et al., 2006) with minor modifications. Fetuses were removed on embryonic day 17 from maternal rats euthanized with CO2 under a protocol approved by the University of Minnesota Institutional Animal Care and Use Committee in accordance with the National Institutes of Health guide for the care and use of laboratory animals. Hippocampi were dissected and placed in Ca2+ and Mg2+-free HEPES buffered Hanks’ salt solution, pH 7.45. HEPES buffered Hanks’ salt solution was composed of the following (in mM): HEPES 20, NaCl 137, CaCl2 1.3, MgSO4 0.4, MgCl2 0.5, KCl 5.0, KH2PO4 0.4, Na2HPO4 0.6, NaHCO3 3.0, and glucose 5.6. Cells were dissociated by trituration through a series of flame-narrowed Pasteur pipettes, pelleted and resuspended in Dulbecco's modified Eagle medium (DMEM) without glutamine, supplemented with 10% fetal bovine serum and penicillin/streptomycin (100 U/mL and 100 µg/mL, respectively). Dissociated cells then were plated at a density of 10,000–15,000 cells/dish onto 25-mm-round cover glasses precoated with matrigel (250 µL, 0.1mg/mL). Neurons were grown in a humidified atmosphere of 10% CO2 and 90% air at 37°C, and fed on days 1 and 6 by exchange of 75% of the media with DMEM supplemented with 10% horse serum and penicillin/streptomycin. Cells used in these experiments were cultured without mitotic inhibitors for a minimum of 11 days.

Excitatory postsynaptic current (EPSC) recordings

6-Cyano-2,3-dihydroxy-7-nitroquinoxaline (CNQX)-sensitive EPSCs were recorded using the whole-cell configuration of the patch-clamp technique (Kouznetsova et al., 2002). Pipettes (Narishige) with open resistances of 3–5 MΩ were filled with solution that contained (in mM): K-gluconate 120, KCl 15, MgCl2 6, EGTA 0.2, HEPES 10, Na2ATP 5, pH 7.3 with KOH, 290 mOsm/kg for DSE recordings or K-gluconate 113, KCl 15, MgCl2 6, BAPTA 10, HEPES 10, Na2ATP 5, CaCl2 6.85, pH 7.3 (KOH), 290 mOsm for MSE experiments. Recordings were performed at room temperature (22 °C) in an extracellular solution that contained (in mM); NaCl 140, KCl 5, CaCl2 9, MgCl2 6, glucose 5, HEPES 10, bicuculline methochloride 0.01, 0.5% BSA, pH 7.4 with NaOH, 325 mOsm/kg. Solutions were applied by a gravity-fed superfusion system. Membrane potential was held at −70 mV and monosynaptic EPSCs evoked with a bipolar platinum electrode (FHC Inc, Bowdoinham, ME) placed near a presynaptic neuron. Voltage pulses (0.1 ms) were applied at a fixed rate of 0.5 Hz using a Grass S44 stimulator with a SIU-5 stimulus isolation unit (Astro-Med Inc., West Warwick, RI). DSE was elicited by depolarizing the postsynaptic cell to 0 mV for 15 s followed by continued recording at 0.5 Hz. MSE was induced by superfusion of 1 µM DHPG.

ICa recordings

Whole-cell recordings of currents through voltage-gated Ca2+ channels (VGCCs) were performed using pipettes filled with (in mM); CsMeSO4 145, HEPES 10, BAPTA 10, MgATP 5, Na2GTP 1, pH 7.35 with CsOH, 315mOsm/kg. Seals were formed in; NaCl 140, KCl 5, CaCl2 9, MgCl2 6, glucose 5, HEPES 10 pH 7.4 with NaOH, 325 mOsm/kg and then switched to buffer to isolate ICa that contained (in mM); TEACl 143, CaCl2 5, MgCl2 1, HEPES 10, Glucose 10, 0.1% bovine serum albumin, pH 7.4 with TEAOH, 325 mOsm/kg. Series resistance was compensated by a minimum of 75%. Membrane potential was held at −80 mV and currents evoked by stepping to 0 mV for 200 ms every 10 s (0.1 Hz). Recordings were not corrected for leak as there was essentially no current at the 0 mV test potential in the presence of 200 µM Cd2+.

Data Acquisition and Analysis

Whole-cell currents were amplified using an Axopatch 200A. For EPSC and ICa recordings respectively, data were filtered at 2 and 1 kHz and digitized at 11 and 5 kHz with a Digidata interface controlled by pClamp software (MDS Analytical Technologies, Toronto, Canada). Access resistance and leak currents were monitored continuously, and the recording excluded if either changed significantly. In EPSC experiments sweeps preceded or followed by spontaneous synaptic currents were excluded from analysis. To calculate percent inhibition of EPSC and ICa amplitudes, the mean peak current from the sweeps collected during the 1 min preceding drug application was compared to the average peak current during the final min of drug treatment, the time at which inhibition was maximal.

DNA constructs and transfection

The coding regions for Homer1a and 1c were amplified by PCR from the Marathon-ready mouse brain cDNA library (Clontech, Mountain View, CA) using the 5' primer ATGGGGGAGCAACCTATCTTCAGC and 3' primer TTACTTAATCATGATTGCTGAATTG combination for Homer1a, and the 5' primer ATGGGGGAGCAACCTATCTTCAGC and 3' primer TTAGCTGCATTCCAGTAGCTTGGC combination for Homer1c. PCR products were subsequently cloned into the pcDNA3.1/V5-His-TOPO vector or the pcDNA3.1/NT-GFP-TOPO vector (Invitrogen) according to manufacturer’s specifications. Homer2a was amplified from human cDNA with an additional N-terminal c-myc tag using the 5' primer ACAAGCTTATGGAACAAAAACTTATTTCTGAAGAAGATCTGGGAGAACAGCCCATCTT and 3' primer CGGCCGCCTAGTTATCGGTGCCCAGCT. PCR products were subsequently cloned into pcDNA3.1 vector via the 5' HindIII and 3' NotI restriction digest sites. Similarly, Homer3a was PCR amplified from mouse cDNA and cloned into pcDNA3.1 using the 5' primer ACAAGCTTATGGAACAAAAACTTATTTCTGAAGAAGATCTGTCCACAGCCAGGAACA and 3' primer GCGGCCGCCTAGGGTGCTGCCTCTGCCA. All constructs were propagated in Escherichia coli Top-10 strain (Invitrogen), isolated using Maxiprep kits (Qiagen, Valencia, CA) and sequenced.

Hippocampal neurons were transfected with plasmid DNA using the calcium phosphate procedure described by Xia et al (Xia et al., 1996), with some modifications. Briefly, 9–11 days after plating, hippocampal neurons were placed in serum-free DMEM (1 ml per dish) supplemented with 1 mM sodium kynurenate, 10 mM MgCl2 and 5 mM HEPES, pH 7.5 for 30 min. The conditioned media was saved. A DNA/calcium phosphate precipitate was prepared by mixing 3.8 µl of 2 M CaCl2, 1 µg DNA per plasmid and dH2O in a volume of 30 µl with an equal volume of 2x HEPES buffered saline (274 mM NaCl, 10 mM KCl, 1.4 mM Na2HPO4, 15 mM D-glucose, 42 mM HEPES, pH 7.05). The precipitate was allowed to form for 30 min at room temperature (22°C) before addition to the cultures. Sixty microliters of the DNA/calcium phosphate precipitate were added drop-wise to each dish. Dishes were returned to the 10 % CO2 incubator. After 1.5 hrs the incubation was stopped by washing the cells three times with 3 ml per well of DMEM (10 mM MgCl2, 5 mM HEPES). The saved conditioned medium was added back to each well, and the cells were returned to a 10 % CO2 incubator at 37°C. The transfection efficiency ranged from 2 to 11%.

Quantitative real-time reverse transcription-PCR (Q-RT-PCR) experiments

RNA was extracted from hippocampal cultures using an RNA isolation kit (Stratagene, La Jolla, CA). Q-RT-PCR was performed on 100 ng of isolated RNA using a SYBR Green QRT-PCR kit (Stratagene). Homer 1a primers (5’-CAAACACTGTTTATGGACTG-3’ and 5’-TGCTGAATTGAATGTGTACC-3’) were designed against the unique 3’ mRNA end of homer 1a, not present in the long-splice isoforms of homer (i.e. homer 1c). In addition to using equal amounts of total RNA as defined by UV spectroscopy we also included an internal reference control (GAPDH) to account for the integrity of mRNA. QuantiTect primers (Qiagen, Valencia, CA) were used for amplification of GAPDH mRNA. PCR cycling and detection was performed on a Mx3005P PCR System and quantitiative analysis performed with MxPro-Mx3005P Software v4.01 (Stratagene).

Confocal Microscopy

48–72 hours following transfection with expression vectors for DsRed2 and Homer 1c fused to green fluorescent protein (H1c-GFP) (Inoue et al., 2007) the Petri dish with cells was sealed with Parafilm and imaged with an Olympus Fluoview 300 laser scanning confocal microscope (Melville, NY, USA) attached to an inverted Olympus IX70 microscope equipped with a PlanApo 60 × oil emersion objective (NA 1.40) (Tokyo, Japan). For all experiments, an 8 step (1 µm/step) z-series was performed. GFP was excited at 488 nm with an Argon laser and imaged at 530 nm (10 nm bandpass). DsRed2 was excited at 546 nm with a He-Ne laser and imaged at 605 nm (75 nm bandpass). Cells were returned to the incubator immediately after imaging.

Image Processing

To count and label homer 1c-GFP puncta an automated algorithm was created using MetaMorph 6.2 image processing software (Waataja et al., 2008). First, maximum z-projection images were created from the DsRed2 and GFP image stacks. Next, a threshold set 1 s.d. above the image mean was applied to the DsRed2 image. This created a 1-bit image that was used as a mask via a logical AND function with the GFP maximum z-projection. A top-hat filter (80 pixels) was applied to the masked H1c-GFP image. A threshold set 1.5 s.d. above the mean intensity inside the mask was then applied to the contrast enhanced image. Structures between 8 and 80 pixels (approximately 0.37 to 3.12 µm in diameter) were counted as puncta. The structures were then dilated and superimposed on the DsRed2 maximum z-projection for visualization. Changes in the number of H1c-GFP puncta were presented as a percent of the initial puncta count from the entire cell; n was the number of cells, each from separate cover glass.

All data are presented as mean ± SE. Significance was determined using Student’s t test or ANOVA with Bonferroni post test for multiple comparisons.

Results

eCBs modulate synaptic strength following postsynaptic synthesis and retrograde diffusion to act on presynaptic CB1Rs. In hippocampus, 2-AG synthesis can be induced by activation of type I mGluRs that couple to the PLCβ cascade or by activation of VGCCs (Maejima et al., 2001; Straiker and Mackie, 2006). Elements of this pathway interact with members of the homer family of molecular scaffolds (Nakamura et al., 2004; Hwang et al., 2005). However, the level of homer interaction with the eCB pathway induced by either mGluRs or VGCCs is largely unknown. Here we examined the role of homer proteins in regulating 2-AG production at excitatory synapses between hippocampal neurons in culture. Synaptic currents were recorded from a postsynaptic neuron held at −70 mV using the whole-cell configuration of the patch-clamp technique. EPSCs were evoked by stimulation of the presynaptic neuron with an extracellular electrode (0.5 Hz). MSE was induced by superfusion of the type I mGluR agonist DHPG and DSE was evoked by a 15 s test pulse to 0 mV.

H1a inhibits MSE

Activation of postsynaptic mGluRs stimulates the PLCβ cascade producing 2-AG that inhibits EPSCs by activating presynaptic CB1Rs (Fig 1A). Application of 1 µM DHPG for 2 min inhibited EPSCs by 51 ± 4 % (n=12) (Fig. 1B, F). DHPG-mediated inhibition was blocked completely by preincubation with the CB1R antagonist N-(Piperidin-1-yl)-5-(4-iodophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251; 300nM; n=3). Transfection of neurons with an expression construct for H1a resulted in a significant loss of DHPG mediated inhibition to 12 ± 10% (Fig. 1C, F; n=4; p<0.001). H1a, which lacks the C-terminal coiled-coil (CC) domain present in full length members of the homer family (Fig 1A; inset), is expected to uncouple type 1 mGluR from other homer binding proteins (Xiao et al., 1998). The naive synaptic network that forms in hippocampal cultures lacks significant eCB tone, as indicated by the failure of 300 nM AM251 to affect EPSC amplitude (n=3). Similarly, 300 nM AM251 failed to affect EPSC amplitude in H1a–expressing cells (n=3), indicating that an increase in eCB tone was not occluding a response to DHPG. In contrast to H1a expression, expression of H2a, which contains the CC domain, did not change DHPG mediated inhibition (50 ± 5 %) (Fig. 1D, F; n=3). Interestingly, expression of Homer 3a (H3a) which, like H2a has both binding domains also attenuated DHPG mediated inhibition of EPSCs to 10 ± 8% (Fig 1E, F; p<0.001). Thus H1a and H3a expression interfere with mGluR mediated eCB production machinery while H2a does not.

Figure 1
H1a expression inhibits MSE. (A) Schematic representation of MSE. Activation of type I mGluRs with DHPG leads to Gq-mediated activation of PLCβ. PLCβ enzymatically cleaves phosphatidylinositol 4,5-bisphosphate (PIP2) producing DAG. DGL ...

H1a enhances DSE

Depolarization of hippocampal neurons evokes postsynaptic Ca2+ influx via VGCCs that induces eCB synthesis (Fig 2A) (Ohno-Shosaku et al., 2001; Wilson and Nicoll, 2001). Because expression of H1a and H3a inhibited MSE, we postulated that DSE would be similarly inhibited by these homer isoforms. To test this hypothesis we induced DSE by depolarization of the patch pipette (0 mV, 15 s) and monitored changes in EPSC amplitude. Immediately following depolarization, a transient DSE lasting 60 to 90 s was observed with inhibition of EPSCs reaching 45 ± 3 % (Fig. 2B,F; n=16). DSE was completely blocked by pretreatment with 300 nM AM251 (n=3). Unexpectedly, expression of H1a increased the maximal depolarization induced inhibition of EPSCs to 64 ± 7 % (Fig 2C,F; n=8; p<0.01). Thus, H1a elicited an effect on DSE opposite to that observed for MSE, consistent with the idea that MSE requires a specific spatial configuration of the PLCβ signaling cascade (Fig 1A) and that DSE is actually inhibited by long forms of homer (Fig 2A). In H1a-expressing cells, DSE was completely blocked by 300 nM AM251 (n=3), indicating that retrograde eCB signaling still mediated the synaptic depression. In neurons expressing H2a and H3a, DSE behaved similar to MSE with respective inhibition of 43 ± 8 % (Fig 2D,F; n=5) and 23 ± 4 % (Fig 2E,F; n=4; p<0.01). We considered the possibility that H1a expression may be enhancing DSE through increased Ca2+ influx via L-type VGCCs in the postsynaptic neuron (Yamamoto et al., 2005). However, the fraction of Ca2+ current inhibited by 10 µM nimodipine was not significantly different in naive relative to H1a expressing cells (42 ± 3% and 38 ± 6 %, respectively; n=5) (supplemental Fig. 1, available at www.jneurosci.org as supplemental material), suggesting that H1a mediated enhancement of DSE occurs downstream from the VGCC. Overall, H1a expression enhanced DSE in contrast to its marked inhibition of MSE.

Figure 2
H1a expression enhances DSE. (A) Schematic representation of DSE. Depolarization of the postsynaptic neuron evokes Ca2+ influx via VGCCs. Ca2+ stimulates both PLCβ and DGL producing 2-AG that activates presynaptic CB1R to inhibit EPSCs. (B–E) ...

H1a expression lowers the threshold for DSE

The H1a-mediated enhancement of DSE suggests that H1a may lower the threshold to mobilize eCBs. To test this hypothesis we conducted DSE experiments using a relatively brief (5 s) depolarization of the postsynaptic neuron and compared the frequency and magnitude of DSE elicited from both Naïve and H1a expressing cells (Fig 3). Naïve neurons responded sporadically to brief depolarization inhibiting EPSC amplitude in 7 of 11 trials. Naïve neurons that did not display DSE had an average inhibition of −2 ± 4 % from pre-depolarization levels (Figure 4C; Naïve−; n=4) while responsive neurons exhibited DSE of 26 ± 8 % (Fig 3A,C; Naïve +; n=7). DSE elicited in H1a expressing neurons was successful in 5 of 5 trials and led to an inhibition of 54 ± 4 % (Fig 3B,C; n=5; p<0.05). Thus, the threshold stimulus required to evoke DSE was lowered in H1a expressing neurons, suggesting that H1a enhances eCB signaling.

Figure 3
H1a lowers the threshold for DSE. (A–B) EPSCs were evoked by stimulation of the presynaptic neuron. The postsynaptic cell was depolarized to 0 mV for 5 s at the times indicated by the arrows to induce eCB production. Plots show mean EPSC amplitudes ...
Figure 4
H1a shifts neurons toward depolarization mediated production of eCBs. (A–B) Representative plots show peak EPSC amplitude versus time for naive (A) and H1a (B) expressing cells. Control EPSCs were evoked every 2 seconds (0.5 Hz) for 1 minute. ...

H1a overexpression enhances DSE while suppressing MSE in the same neuron

The hypothesis that H1a enhances depolarization-induced, while suppressing mGluR-induced production of eCBs, suggests a critical role for H1a in eCB-mediated plasticity. Thus, DSE and MSE were compared in series to verify that the H1a-induced shift in eCB signaling occurs in the same neuron. Combination experiments on naive cells yielded DSE of 42 ± 4 % with a corresponding MSE of 38 ± 8 % (Fig 4A,C; n=8). Consistent with our hypothesis, similar experiments in H1a expressing cells displayed enhancement of DSE and almost complete inhibition of MSE (Fig 4B,C). EPSCs evoked from H1a expressing cells were inhibited by 64 ± 13 % following postsynaptic depolarization but, subsequent treatment with 1 µM DHPG produced only 8 ± 6 % inhibition (n=4; p<0.05). Thus, H1a appears capable of switching the induction mechanism for eCB signaling.

BDNF treatment increases expression of H1a, enhances DSE and inhibits MSE

We next addressed the question of whether H1a-mediated changes in eCB signaling could be observed under more physiologically relevant conditions than those employed in the preceding studies in which homer proteins were over-expressed. A number of stimuli increase H1a expression including BDNF (Worley et al., 2007). Indeed, BDNF increases the expression of H1a in hippocampal neurons and disperses puncta formed from homer 1c (H1c) assemblies (Sato et al., 2001; Inoue et al., 2004; Inoue et al., 2007). In our experiments, treating hippocampal cultures with 100 ng/mL BDNF for 4 hrs enhanced transcription of H1a mRNA. Quantitative RT-PCR using H1a and GAPDH specific primers revealed a 32 ± 9 fold induction of H1a mRNA (Fig. 5A) compared to no effect on the level of GAPDH mRNA (1.0 ± 0.1 fold, n=3; p<0.001). To determine whether BDNF stimulation of H1a mRNA leads to functional expression of the protein, we examined the dispersement of H1c puncta using confocal imaging (Fig. 5B). Hippocampal cultures were co-transfected with expression vectors for DsRed2 and H1c-GFP. Cells were imaged 48–72 hrs after transfection using confocal imaging to identify H1c-GFP puncta (Fig. 5B). The number of fluorescent puncta was objectively counted using image processing as described in Methods. Cultures were treated with BDNF or vehicle (control) and the same cell imaged again after 4 hrs. Control cells showed a 6 ± 10% increase in the number of H1c-GFP puncta (Fig. 5B; n=6). In contrast, cells treated with BDNF for 4 hrs showed a 30 ± 9 % loss in puncta (Fig. 5B; n=7; p<0.05). These results confirm that BDNF treatment increases H1a transcription/translation leading to the functional uncoupling of H1c-GFP assemblies.

Figure 5
BDNF induces expression of H1a mRNA and disperses H1c-GFP puncta. (A) Hippocampal cultures were treated for 4 hours with 100 ng/mL BDNF or vehicle control prior to RNA isolation and amplification by RT-PCR. Shown is gel electrophoresis of representative ...

To test whether treatment with BDNF shifts the balance between DSE and MSE, cells were treated for 4 hours with 100 ng/mL BDNF and then examined in synaptic transmission experiments. Following treatment with BDNF, depolarization led to a 59 ± 7 % inhibition which is significantly greater than naive controls (Fig 6A,C; n=6; p<0.05) and similar to that seen in H1a transfected neurons (p=0.62). BDNF attenuated MSE produced by 1 µM DHPG to 16 ± 13 % that is significantly reduced relative to naive controls (Fig 6B,C; n=5; p<0.01), yet similar to the effects observed in H1a expressing cells (p=0.82). These data suggest that BDNF induced H1a expression that led to changes in eCB-mediated synaptic plasticity.

Figure 6
DSE was enhanced and MSE was inhibited in BDNF-treated neurons. (A) 4 hour treatment with BDNF increased the magnitude of DSE. Plot shows mean EPSC amplitudes, normalized to the 30 responses immediately before depolarization plotted versus time. The postsynaptic ...

Discussion

Homer proteins act as molecular scaffolds in the PSD to organize signaling cascades for effective receptor activation of downstream signaling. In the current study, we show that expression of H1a, a short isoform that disrupts homer scaffolds, modulates eCB-mediated plasticity at glutamatergic synapses in hippocampal cultures. Expression of H1a lowered the stimulus threshold to evoke and enhanced the magnitude of DSE while inhibiting MSE. Treatment with BDNF enhanced the transcription of H1a mRNA and dispersed H1c-GFP puncta indicating expression of H1a protein and uncoupling of CC-homer assemblies. Furthermore, BDNF produced a shift towards depolarization mediated eCB production similar to that seen when H1a was expressed. These results demonstrate that regulated expression of homer proteins provides a mechanism by which the balance between metabotropic and depolarization-induce eCB signaling may be spatially and temporally controlled.

Opposite effects of H1a on DSE versus MSE

H1a acts as a dominant-negative inhibitor of homer scaffolds by binding to target proteins via its EVH1 domain but, because it lacks a CC domain, fails to oligomerize with other homer proteins. Components of the eCB signaling pathway including mGluR1a, mGluR5, PLCβ and DGL all bind homer EVH1 domains (Shiraishi-Yamaguchi and Furuichi, 2007; Jung et al., 2007). H1a binding to type 1 mGluRs will induce constitutive, ligand-independent activation of the receptor (Ango et al., 2001). eCB tone was not elevated in H1a-expressing cells as indicated by a lack of effect of AM251 on EPSC amplitude. Furthermore, if tonic mGluR activation occluded MSE, we would have expected DSE to be inhibited as well, which was not the case. Ligand-independent activation could lead to desensitization of mGluRs uncoupling the receptors from downstream effectors. Thus, the most likely explanation for the H1a-mediated inhibition of MSE described here is an uncoupling of the type 1 mGluRs from downstream enzymes responsible for 2-AG synthesis as a result of either receptor desensitization or disruption of the homer scaffold. A previous report outlined a critical interaction between DGL and H2a (Jung et al., 2007). Linkage through a PPxxF domain on DGL was required for effective mGluR-mediated 2-AG production but, had no effect on enzymatic activity. These data are consistent with the lack of effect of H2a expression on both DSE and MSE observed in our studies. Presumably, endogenous long isoforms of homer maintain the molecular assembly required for MSE but are not limiting, consistent with the expression of H1b/c, H2a/b, and H3a/b in hippocampal neurons (Shiraishi et al., 2004). This reasoning would suggest that increased expression of long homer proteins should not affect MSE but, surprisingly H3a expression effectively blocked MSE. Expression of H3a also attenuated DSE suggesting a less selective interaction than that produced by H1a. Although the overall domain composition is shared between H3a and H2a, these proteins exhibit notable differences in their amino acid sequences. While their EVH1 domains are strongly conserved with 80% sequence identity, the CC-domains vary substantially and exhibit less than 30% identity. These differences are likely to produce unique preferences for interacting with various binding partners and/or regulation by posttranslational modification, ultimately resulting in the distinct effects of the two proteins. For instance, H3a, but not H2a, was found to contain a CaMKII phosphorylation site which selectively uncouples mGluR-homer-IP3R complexes . (Mizutani et al., 2008). This may explain the apparent loss of MSE after H3a expression, however other CC-homers have this same site, and thus its role in eCB signaling is unclear.

H1a expression enhanced DSE. Thus, H1a expression does not grossly impair the 2-AG synthetic machinery. We suggest that DSE is less dependent on close apposition of VGCCs to PCLβ and DGL relative to the more constrained organization required for MSE. Because infusion of H1a into neocortical pyramidal cells up-regulated L-type VGCCs (Yamamoto et al., 2005) we examined the effects of H1a expression on Ca2+ currents. We did not observe an increase in L-type Ca2+ currents in cells expressing H1a although, we note that the currents were recorded from the soma with Ca2+ chelator in the intracellular solution. Thus, we would not have observed an increased L-type Ca2+ current if the H1a effect were limited to dendritic regions or was secondary to reduced Ca2+ dependent feedback. RyRs participate in DSE by amplifying Ca2+ influx mediated by VGCC (Isokawa and Alger, 2006). CC-homer proteins bind to and inhibit RyR function and their inhibition is reversed dose-dependently by H1a (Hwang et al., 2003; Westhoff et al., 2003). Thus, it is possible that H1a reduces this inhibition resulting in enhanced Ca2+ release from intracellular stores and more efficient DSE. Alternatively, DSE is independent of PLCβ and Ca2+ stores in cerebellum (Brenowitz et al., 2006) and experiments with DGL inhibitors have yielded mixed results (Chiu and Castillo, 2008; Tanimura et al., 2009). Thus, depolarization and metabotropic receptor activation may produce eCBs by different pathways. Overall, our results demonstrate that MSE is more sensitive to H1a-induced uncoupling of homer scaffolds relative to DSE; thus, H1a can gate the induction mechanism for eCB production.

Physiological consequences of H1a-regulated induction of eCB production

The respective roles of DSE and MSE in synaptic transmission provide insight into how H1a modulation of eCB production might influence neuronal function. DSE will tend to evoke 2-AG release from the entire dendritic arbor whereas mGluR-mediated MSE is expected to be input specific (Brenowitz et al., 2006). Thus, H1a expression might potentiate the homeostatic plasticity that accompanies intense stimulation. Indeed, H1a is up-regulated during epileptic activity (Kato et al., 1998) and the eCB system is thought to provide an on-demand neuroprotection from excitotoxicity (Shen and Thayer, 1998; Marsicano et al., 2003). Clearly, this safety mechanism provides a critical defense against aberrant synaptic activity and should not be switched off. Conversely, modulating the strength of individual synapses is thought to underlie learning and memory. Indeed, H1a expression is required for consolidation of long term fear memories (Inoue et al., 2009) and H1a enters synaptic spines in an activity-dependent manner (Okada et al., 2009). Perhaps H1a-mediated uncoupling of mGluR-mediated MSE contributes to synaptic strengthening. Increased expression of H1a lowered the stimulus threshold required to evoke DSE, suggesting that H1a-mediated increases in DSE might enhance on-demand neuroprotection at the expense of single synapse plasticity. The effects of viral-mediated over-expression of various homer isoforms in the hippocampus on cognitive performance and status epilepticus are consistent with this idea (Klugmann et al., 2005). H1a over-expression led to learning deficits, but increased resistance to status epilepticus, while H1c and H1g enhanced cognitive performance, but had no effect on status epilepticus. Thus, our results demonstrating differential effects of homer long and short forms on eCB plasticity parallel complex effects observed following expression of the various isoforms in vivo.

mGluR activation has been strongly linked to changes in plasticity and behavior in part, through modulation of eCB signaling (Bortolotto et al., 1995; Diagana et al., 2002; Bellone et al., 2008). Homer proteins have also been studied in behavioral experiments. Deletion of homer genes impairs behavioral plasticity in drosophila (Diagana et al., 2002) and mimics behaviors associated with cocaine induction and withdrawal in mice (Swanson et al., 2001; Szumlinski et al., 2004). Inhibition of eCB-mediated LTD in the nucleus accumbens following administration of cocaine was accompanied by expression of CC-homers (Fourgeaud et al., 2004). Thus, homer proteins are intimately linked to behavioral plasticity, particularly that induced by drugs of abuse, and the effects of homer proteins on the induction of the eCB system may play an integral role in behavioral modification.

Both homer proteins and eCBs participate in the remodeling of synaptic networks (Ehrengruber et al., 2004; Foa and Gasperini, 2009). H1a affects postsynaptic structures including those associated with H1c (Inoue et al., 2004) and inhibits spine morphogenesis (Sala et al., 2003). H1a is an immediate early gene induced by several pharmacologic and activity-related stimuli (Worley et al., 2007) including BDNF, which robustly activates H1a transcription (Sato et al., 2001). We found that BDNF increased H1a mRNA and uncoupled H1c puncta found in dendritic structures. H1a induction led to enhanced DSE at the expense of MSE. BDNF plays a critical role in synaptic development, changes in synaptic strength, and the induction and adaptation to seizures (Kuczewski et al., 2009) . eCBs also participate in these processes (Monory et al., 2006; Lovinger, 2008). Thus, it is reasonable to speculate that BDNF-induced, homer-mediated changes in eCB signaling contribute to dynamic changes in synaptic networks.

The H1a-mediated switch in eCB signaling may play a potentially important role in the synaptic changes that accompany drug dependence (Fourgeaud et al., 2004; Szumlinski et al., 2008), seizure disorders (Potschka et al., 2002; Marsicano et al., 2003) and learning (Heifets and Castillo, 2009; Inoue et al., 2009). This mechanism may also display regional or developmental changes. While hippocampal neurons in culture are an established model for studying eCB signaling (Ohno-Shosaku et al., 2001; Straiker and Mackie, 2005; Roloff and Thayer, 2009) and have also been used to characterize the function of homer proteins (Sala et al., 2003; Kammermeier, 2008), in vivo studies that extend the cellular studies described here will be of considerable interest.

Conclusion

We have shown that the postsynaptic compliment of homer proteins has profound effects on both depolarization-mediated and mGluR-mediated eCB signaling. Homer regulated changes in PSD structure provide a point of crosstalk at which the diverse signals that regulate homer immediate early gene expression can influence eCB mediated changes in synaptic plasticity.

Supplementary Material

Supp1

Acknowledgements

National Institutes of Health grants DA07304, DA24428, and DA11806 to S.A.T. and DA021743 and DA026405 to K.A.M. supported this work. A.M.R. was supported by NIDA training grant DA07097 and G.R.A. was supported by DA024944. K.A.M is supported by a McKnight Land-Grant Professorship. We thank Dr. Keqiang Xie (University of Minnesota) for generation of H2a and H3a expression constructs and Dr. Don Arnold (University of Southern California) for the PSD95-GFP expression plasmid.

References

  • Ango F, Prezeau L, Muller T, Tu JC, Xiao B, Worley PF, Pin JP, Bockaert J, Fagni L. Agonist-independent activation of metabotropic glutamate receptors by the intracellular protein Homer. Nature. 2001;411:962–965. [PubMed]
  • Bellone C, Luscher C, Mameli M. Mechanisms of synaptic depression triggered by metabotropic glutamate receptors. Cell Mol Life Sci. 2008;65:2913–2923. [PubMed]
  • Bortolotto ZA, Bashir ZI, Davies CH, Taira T, Kaila K, Collingridge GL. Studies on the role of metabotropic glutamate receptors in long-term potentiation-some methodological considerations. Journal of Neuroscience Methods. 1995;59:19–24. [PubMed]
  • Brakeman PR, Lanahan AA, O'Brien R, Roche K, Barnes CA, Huganir RL, Worley PF. Homer: a protein that selectively binds metabotropic glutamate receptors. Nature. 1997;386:284–288. [PubMed]
  • Brenowitz SD, Best AR, Regehr WG. Sustained Elevation of Dendritic Calcium Evokes Widespread Endocannabinoid Release and Suppression of Synapses onto Cerebellar Purkinje Cells. J Neurosci. 2006;26:6841–6850. [PubMed]
  • Chiu CQ, Castillo PE. Input-specific plasticity at excitatory synapses mediated by endocannabinoids in the dentate gyrus. Neuropharmacol. 2008;54:68–78. [PMC free article] [PubMed]
  • Diagana TT, Thomas U, Prokopenko SN, Xiao B, Worley PF, Thomas JB. Mutation of Drosophila homer disrupts control of locomotor activity and behavioral plasticity. J Neurosci. 2002;22:428–436. [PubMed]
  • Ehrengruber MU, Kato A, Inokuchi K, Hennou S. Homer/Vesl proteins and their roles in CNS neurons. Mol Neurobiol. 2004;29:213–227. [PubMed]
  • Foa L, Gasperini R. Developmental roles for Homer: more than just a pretty scaffold. J Neurochem. 2009;108:1–10. [PubMed]
  • Fourgeaud L, Mato S, Bouchet D, Hemar A, Worley PF, Manzoni OJ. A Single In Vivo Exposure to Cocaine Abolishes Endocannabinoid-Mediated Long-Term Depression in the Nucleus Accumbens. J Neurosci. 2004;24:6939–6945. [PubMed]
  • Heifets BD, Castillo PE. Endocannabinoid signaling and long-term synaptic plasticity. Annu Rev Physiol. 2009;71:283–306. [PubMed]
  • Hwang JI, Kim HS, Lee JR, Kim E, Ryu SH, Suh PG. The interaction of phospholipase C-beta3 with Shank2 regulates mGluR-mediated calcium signal. J Biol Chem. 2005;280:12467–12473. [PubMed]
  • Hwang SY, Wei J, Westhoff JH, Duncan RS, Ozawa F, Volpe P, Inokuchi K, Koulen P. Differential functional interaction of two Vesl/Homer protein isoforms with ryanodine receptor type 1: a novel mechanism for control of intracellular calcium signaling. Cell Calcium. 2003;34:177–184. [PubMed]
  • Inoue N, Nakao H, Migishima R, Hino T, Matsui M, Hayashi F, Nakao K, Manabe T, Aiba A, Inokuchi K. Requirement of the immediate early gene vesl-1S/homer-1a for fear memory formation. Mol Brain. 2009;2:7. [PMC free article] [PubMed]
  • Inoue Y, Udo H, Inokuchi K, Sugiyama H. Homer1a regulates the activity-induced remodeling of synaptic structures in cultured hippocampal neurons. Neurosci. 2007;150:841–852. [PubMed]
  • Inoue Y, Honkura N, Kato A, Ogawa S, Udo H, Inokuchi K, Sugiyama H. Activity-inducible protein Homer1a/Vesl-1S promotes redistribution of postsynaptic protein Homer1c/Vesl-1L in cultured rat hippocampal neurons. Neurosci Lett. 2004;354:143–147. [PubMed]
  • Isokawa M, Alger BE. Ryanodine receptor regulates endogenous cannabinoid mobilization in the hippocampus. J Neurophysiol. 2006;95:3001–3011. [PubMed]
  • Jung KM, Astarita G, Zhu C, Wallace M, Mackie K, Piomelli D. A key role for diacylglycerol lipase-a in metabotropic glutamate receptor-dependent endocannabinoid mobilization. Mol Pharmacol. 2007 [PubMed]
  • Kammermeier PJ. Endogenous Homer Proteins Regulate Metabotropic Glutamate Receptor Signaling in Neurons. J Neurosci. 2008;28:8560–8567. [PubMed]
  • Kato A, Fukazawa Y, Ozawa F, Inokuchi K, Sugiyama H. Activation of ERK cascade promotes accumulation of Vesl-1S/Homer-1a immunoreactivity at synapses. Brain Res Mol Brain Res. 2003;118:33–44. [PubMed]
  • Kato A, Ozawa F, Saitoh Y, Fukazawa Y, Sugiyama H, Inokuchi K. Novel members of the Vesl/Homer family of PDZ proteins that bind metabotropic glutamate receptors. J Biol Chem. 1998;273:23969–23975. [PubMed]
  • Klugmann M, Symes CW, Leichtlein CB, Klaussner BK, Dunning J, Fong D, Young D, During MJ. AAV-mediated hippocampal expression of short and long Homer 1 proteins differentially affect cognition and seizure activity in adult rats. Mol Cell Neurosci. 2005;28:347–360. [PubMed]
  • Kouznetsova M, Kelley B, Shen M, Thayer SA. Desensitization of cannabinoid-mediated presynaptic inhibition of neurotransmission between rat hippocampal neurons in culture. Mol Pharmacol. 2002;61:477–485. [PubMed]
  • Kuczewski N, Porcher C, Lessmann V, Medina I, Gaiarsa JL. Activity-dependent dendritic release of BDNF and biological consequences. Mol Neurobiol. 2009;39:37–49. [PubMed]
  • Lovinger DM. Presynaptic modulation by endocannabinoids. Handb Exp Pharmacol. 2008:435–477. [PubMed]
  • Maejima T, Hashimoto K, Yoshida T, Aiba A, Kano M. Presynaptic inhibition caused by retrograde signal from metabotropic glutamate to cannabinoid receptors. Neuron. 2001;31:463–475. [PubMed]
  • Marsicano G, Goodenough S, Monory K, Hermann H, Eder M, Cannich A, Azad SC, Cascio MG, Gutierrez SO, van der Stelt M, Lopez-Rodriguez ML, Casanova E, Schutz G, Zieglgansberger W, Di Marzo V, Behl C, Lutz B. CB1 Cannabinoid Receptors and On-Demand Defense Against Excitotoxicity. Science. 2003;302:84–88. [PubMed]
  • Mizutani A, Kuroda Y, Futatsugi A, Furuichi T, Mikoshiba K. Phosphorylation of Homer3 by Calcium/Calmodulin-Dependent Kinase II Regulates a Coupling State of Its Target Molecules in Purkinje Cells. J Neurosci. 2008;28:5369–5382. [PubMed]
  • Monory K, Massa F, Egertova M, Eder M, Blaudzun H, Westenbroek R, Kelsch W, Jacob W, Marsch R, Ekker M, Long J, Rubenstein JL, Goebbels S, Nave KA, During M, Klugmann M, Wolfel B, Dodt HU, Zieglgansberger W, Wotjak CT, Mackie K, Elphick MR, Marsicano G, Lutz B. The endocannabinoid system controls key epileptogenic circuits in the hippocampus. Neuron. 2006;51:455–466. [PMC free article] [PubMed]
  • Nakamura M, Sato K, Fukaya M, Araishi K, Aiba A, Kano M, Watanabe M. Signaling complex formation of phospholipase Cbeta4 with metabotropic glutamate receptor type 1alpha and 1,4,5-trisphosphate receptor at the perisynapse and endoplasmic reticulum in the mouse brain. Eur J Neurosci. 2004;20:2929–2944. [PubMed]
  • Ohno-Shosaku T, Maejima T, Kano M. Endogenous cannabinoids mediate retrograde signals from depolarized postsynaptic neurons to presynaptic terminals. Neuron. 2001;29:729–738. [PubMed]
  • Okada D, Ozawa F, Inokuchi K. Input-Specific Spine Entry of Soma-Derived Vesl-1S Protein Conforms to Synaptic Tagging. Science. 2009;324:904–909. [PubMed]
  • Potschka H, Krupp E, Ebert U, Gumbel C, Leichtlein C, Lorch B, Pickert A, Kramps S, Young K, Grune U, Keller A, Welschof M, Vogt G, Xiao B, Worley PF, Loscher W, Hiemisch H. Kindling-induced overexpression of Homer 1A and its functional implications for epileptogenesis. Eur J Neurosci. 2002;16:2157–2165. [PubMed]
  • Pottorf WJ, Johanns TM, Derrington SM, Strehler EE, Enyedi A, Thayer SA. Glutamate-induced protease-mediated loss of plasma membrane Ca pump activity in rat hippocampal neurons. J Neurochem. 2006;98:1646–1656. [PubMed]
  • Roloff AM, Thayer SA. Modulation of excitatory synaptic transmission by Delta 9-tetrahydrocannabinol switches from agonist to antagonist depending on firing rate. Mol Pharmacol. 2009;75:892–900. [PubMed]
  • Sala C, Futai K, Yamamoto K, Worley PF, Hayashi Y, Sheng M. Inhibition of dendritic spine morphogenesis and synaptic transmission by activity-inducible protein Homer1a. J Neurosci. 2003;23:6327–6337. [PubMed]
  • Sato M, Suzuki K, Nakanishi S. NMDA receptor stimulation and brain-derived neurotrophic factor upregulate homer 1a mRNA via the mitogen-activated protein kinase cascade in cultured cerebellar granule cells. J Neurosci. 2001;21:3797–3805. [PubMed]
  • Shen M, Thayer SA. Cannabinoid receptor agonists protect cultured rat hippocampal neurons from excitotoxicity. Mol Pharmacol. 1998;54:459–462. [PubMed]
  • Shiraishi-Yamaguchi Y, Furuichi T. The Homer family proteins. Genome Biol. 2007;8:206. [PMC free article] [PubMed]
  • Shiraishi Y, Mizutani A, Yuasa S, Mikoshiba K, Furuichi T. Differential expression of Homer family proteins in the developing mouse brain. J Comp Neurol. 2004;473:582–599. [PubMed]
  • Straiker A, Mackie K. Depolarization-induced suppression of excitation in murine autaptic hippocampal neurones. J Physiol. 2005;569:501–517. [PubMed]
  • Straiker A, Mackie K. Metabotropic Suppression of Excitation in Autaptic Hippocampal Neurons. J Physiol. 2006 [PubMed]
  • Swanson CJ, Baker DA, Carson D, Worley PF, Kalivas PW. Repeated cocaine administration attenuates group I metabotropic glutamate receptor-mediated glutamate release and behavioral activation: a potential role for Homer. J Neurosci. 2001;21:9043–9052. [PubMed]
  • Szumlinski KK, Kalivas PW, Worley PF. Homer proteins: implications for neuropsychiatric disorders. Curr Opin Neurobiol. 2006;16:251–257. [PubMed]
  • Szumlinski KK, Ary AW, Lominac KD. Homers regulate drug-induced neuroplasticity: implications for addiction. Biochem Pharmacol. 2008;75:112–133. [PMC free article] [PubMed]
  • Szumlinski KK, Dehoff MH, Kang SH, Frys KA, Lominac KD, Klugmann M, Rohrer J, Griffin W, 3rd, Toda S, Champtiaux NP, Berry T, Tu JC, Shealy SE, During MJ, Middaugh LD, Worley PF, Kalivas PW. Homer proteins regulate sensitivity to cocaine. Neuron. 2004;43:401–413. [PubMed]
  • Tanimura A, Kawata S, Hashimoto K, Kano M. Not glutamate but endocannabinoids mediate retrograde suppression of cerebellar parallel fiber to Purkinje cell synaptic transmission in young adult rodents. Neuropharmacol. 2009;57:157–163. [PubMed]
  • Tu JC, Xiao B, Naisbitt S, Yuan JP, Petralia RS, Brakeman P, Doan A, Aakalu VK, Lanahan AA, Sheng M, Worley PF. Coupling of mGluR/Homer and PSD-95 complexes by the Shank family of postsynaptic density proteins. Neuron. 1999;23:583–592. [PubMed]
  • Waataja JJ, Kim HJ, Roloff AM, Thayer SA. Excitotoxic loss of post-synaptic sites is distinct temporally and mechanistically from neuronal death. J Neurochem. 2008;104:364–375. [PubMed]
  • Westhoff JH, Hwang SY, Duncan RS, Ozawa F, Volpe P, Inokuchi K, Koulen P. Vesl/Homer proteins regulate ryanodine receptor type 2 function and intracellular calcium signaling. Cell Calcium. 2003;34:261–269. [PubMed]
  • Wilson RI, Nicoll RA. Endogenous cannabinoids mediate retrograde signalling at hippocampal synapses. Nature. 2001;410:588–592. [PubMed]
  • Worley PF, Zeng W, Huang G, Kim JY, Shin DM, Kim MS, Yuan JP, Kiselyov K, Muallem S. Homer proteins in Ca2+ signaling by excitable and non-excitable cells. Cell Calcium. 2007;42:363–371. [PMC free article] [PubMed]
  • Xia ZG, Dudek H, Miranti CK, Greenberg ME. Calcium influx via the nmda receptor induces immediate early gene transcription by a map kinase/erk-dependent mechanism. J Neurosci. 1996;16:5425–5436. [PubMed]
  • Xiao B, Tu JC, Petralia RS, Yuan JP, Doan A, Breder CD, Ruggiero A, Lanahan AA, Wenthold RJ, Worley PF. Homer regulates the association of group 1 metabotropic glutamate receptors with multivalent complexes of homer-related, synaptic proteins. Neuron. 1998;21:707–716. [PubMed]
  • Yamamoto K, Sakagami Y, Sugiura S, Inokuchi K, Shimohama S, Kato N. Homer 1a enhances spike-induced calcium influx via L-type calcium channels in neocortex pyramidal cells. Eur J Neurosci. 2005;22:1338–1348. [PubMed]