Search tips
Search criteria 


Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Traffic. Author manuscript; available in PMC 2010 June 1.
Published in final edited form as:
PMCID: PMC2827254

Photoreceptor IFT Complexes Containing Chaperones, Guanylyl Cyclase 1, and Rhodopsin


Intraflagellar transport (IFT) provides a mechanism for the transport of cilium specific proteins, but the mechanisms for linkage of cargo and IFT proteins have not been identified. Using the sensory outer segments (OS) of photoreceptors, which are derived from sensory cilia, we have identified IFT-cargo complexes containing IFT proteins, kinesin 2 family proteins, two photoreceptor specific membrane proteins, guanylyl cyclase 1 (GC1, Gucy2e) and rhodopsin (RHO), and the chaperones MRJ (DnajB6), a member of the Dnaj family of co-chaperones, and HSC70 (Hspa8). Analysis of these complexes leads to a model in which MRJ through its binding to IFT88 and GC1 plays a critical role in formation or stabilization of the IFT-cargo complexes. Consistent with the function of MRJ in the activation of HSC70 ATPase activity, Mg-ATP enhances the co-IP of GC1, RHO, and MRJ with IFT proteins. Furthermore, RNAi knockdown of MRJ in IMCD3 cells expressing GC1-GFP reduces cilium membrane targeting of GC1-GFP without apparent effect on cilium elongation.


The outer segment (OS) of vertebrate rods and cones forms developmentally from the membrane of a sensory cilium (1-3). In common with other motile and sensory cilia (5), membrane proteins that function in the OS are synthesized in the adjacent cell body or inner segment (IS), and must pass through the cilium during both initial development and turnover of the mature OS (reviewed in 3). Since photoreceptors in mammals replace about 10% of their OS daily (6), continuous transport of these proteins occurs at a prodigious rate throughout the life of mature photoreceptors. Viewing the OS as a sensory cilium has led to the idea that intraflagellar transport (IFT), which is required for the assembly and maintenance of sensory cilia, motile cilia, and flagella, is necessary for membrane protein transport into the OS (7-9).

A defining feature of IFT is a pair of multi-protein complexes called the A and B sub-particles that collectively comprise at least 16 different proteins (10-12). IFT particles are thought to serve as cargo adaptors for microtubule-based transport of proteins necessary for ciliogenesis (5). Thus, IFT particles and associated proteins move from the cell body to the tip of the cilium or flagellum, and back again (13). The anterograde movement of IFT particles is powered by heterotrimeric members of the kinesin 2 family (10, 14-19), referred to here as the Kif3 complex, while transport in the opposite direction requires the cytoplasmic dynein Dhc1b/2 heavy chain (20-23). Additional anterograde motors also appear to play a role in IFT in C. elegans and in vertebrate photoreceptor (14, 24, 25). Homologues of IFT proteins are found widely among ciliated eukaryotes (26-29). Furthermore, IFT particles have been identified in mammalian systems (4, 8) with properties remarkably similar to those in Chlamydomonas (10, 12, 30).

An essential role for IFT in photoreceptors is supported by the finding that both IFT proteins (4, 8, 31) and IFT motors (32-34) are present on the photoreceptor axoneme, and mice with a targeted disruption of the Kif3 complex subunit, KIF3A (35, 36), or a hypomorphic mutation in IFT88 (8) exhibit progressive photoreceptor degeneration with mis-localization of the membrane protein, RHO. Nonetheless, the molecular details of how IFT proteins bind to putative cargo in photoreceptors or other sensory cilia have not been determined.

Here we examine IFT-cargo complexes in photoreceptors that contain photoreceptor specific membrane guanylyl cyclase 1 (GC1, Gucy2e) and rhodopsin (RHO), two key elements of the OS phototransduction cascade, and the MRJ/HSC70 chaperone pair. The analysis began with the identification of mammalian relative of DNAJ (MRJ), a member of the DnaJ class of chaperones, as an IFT88/polaris binding protein, and led to the finding that MRJ also binds to a cytosolic domain of GC1. A role for MRJ and its co-chaperone, HSC70, is suggested by the finding that addition of Mg-ATP enhances the co-IP of GC1, RHO, and MRJ with IFT proteins. Finally, we stably transfected IMCD3 cells with photoreceptor GC1-GFP and found that it concentrates in the sensory cilium. RNAi knockdown of MRJ reduced GC1-GFP in the cilium without effects on cilium elongation. Our data support a model in which MRJ and HSC70 function in the formation or stabilization of IFT-cargo complexes.


MRJ interacts with IFT88

We screened a bovine retinal yeast two-hybrid library using a domain (aa 117-317) of mouse IFT88 containing a cluster of tetratricopetide repeats (TPR) referred to as IFT88(TPR1-3). We used IFT88 as bait because it is a constituent of the IFT sub-particle B (10), contains TPR protein interaction repeats (37), and is required for proper assembly of the sensory OS (8). The screen revealed multiple colonies containing plasmids encoding 198 residues of the C-terminal domain of MRJ (mammalian relative of DnaJ, DnajB6; Fig. 1A), a member of the DnaJ co-chaperone family. The interaction between IFT88 and MRJ was verified in yeast cells by re-transformation. Cells transformed by GAL4-AD-MRJ alone did not survive on high stringency plates, but when co-transformed with GAL4-BD-IFT88TPR1-3 colonies formed and turned blue after one day of growth (Fig. 1A). This was similar to the positive control in which cells were transformed with plasmids encoding two known interacting proteins (SV40 Large T-antigen and p53). In α-galactosidase quantitative assays we evaluated the interaction between MRJ and the original bait (IFT88(TPR1-3)) as well as a distinct C-terminal sequence (aa 392-727) containing additional TPR repeats (IFT88(TPR4-10)), and a sequence (aa 117-727) containing both N- and C-terminal arrays of TPR repeats with an intervening linker region (Fig. 1B). IFT88(TPR1-3) and IFT88(1-10) were similar to the positive control (SV40 Large T-antigen and p53), while the interaction between MRJ and IFT88(TPR 4-10) was substantially more robust (Fig. 1B). Moreover, MRJ specifically interacts with IFT88, but not IFT57, IFT52 or IFT20, which lack TPR repeats (Fig.1C). These data indicate that in yeast MRJ binds to the TPR repeats of IFT88.

Fig. 1
Yeast two-hybrid and GST pull down analysis of MRJ binding to IFT88

Since TPR repeats are present in many proteins we determined whether MRJ interacts with another TPR containing protein, conventional kinesin light chain (KLC1) that is not part of the IFT pathway. We cloned a domain (aa 176-414) containing 5 TPR repeats of KLC1 (Fig. 1D) and detected a weak interaction with MRJ in quantitative assays (Fig. 1D). Unlike the interaction with IFT88(TPR1-3) and IFT88(TPR1-10), however, this interaction was below that of the positive control. This suggests that while MRJ interacts strongly with IFT88, it may also associate with other proteins that contain TPR repeats. This is not surprising because MRJ is likely to have multiple functions as a co-chaperone in the HSP70/HSC70 system (38).

GST-MRJ Binds Both Recombinant and Endogenous IFT88

We next independently confirmed the interaction between MRJ and IFT88 using GST pull-down assays (Fig 1E-F). First, we separately expressed and purified GST-MRJ and either His (data not shown) or GST tagged IFT88, and performed cell free binding assays using different concentrations of IFT88; the GST-tag on IFT88 was cleaved during purification. GST-MRJ directly interacts with IFT88 in a concentration dependent and saturable manner whereas beads alone do not bind IFT88 (Fig. 1E). Densitometric analysis of bands in these assays relative to known concentrations of recombinant IFT88 permitted us to estimate an equilibrium dissociation constant for IFT88-MRJ binding of ~0.8 μM. Second, GST-MRJ was used in pull-down assays with a tissue extract from retina (Fig. 1F) where it specifically pulled down native IFT88. These pull down assays also co-precipitated IFT57 and the Kif3 complex subunit, KIF3A (Fig. 1F). We previously demonstrated that IFT88 exists predominantly in a complex with other IFT proteins in retinal extracts (4). Thus, the GST-MRJ pull-down assays suggest that MRJ can interact with native IFT88 in the context of an IFT particle.

MRJ and HSC70 Co-IP with IFT Proteins and KIF3A

Dnaj proteins such as MRJ are known to bind HSP/HSC70 family members and to activate their ATPase activity. This suggests that both MRJ and HSC70 could be associated with IFT protein complexes. Consistent with this, HSC70* (encoded by the Hspa8 gene) was co-precipitated along with IFT88, IFT57, and KIF3A in GST-MRJ pull-down assays (Fig. 1F). However, this could have been due to the known direct binding of MRJ to HSC70 (38). We therefore carried out IP experiments using retinal extracts and found that anti-IFT88 and anti-MRJ antibodies reciprocally co-immunopreciptate the other protein (Fig. 2A). Furthermore, multiple antibodies against IFT proteins, MRJ, and HSC70 co-precipitate MRJ and IFT88 (Fig. 2A). In addition, antibodies to the IFT subunits and both chaperones (MRJ and HSC70) co-precipitate IFT88, KIF3A, HSC70, and IFT57 (Fig. 2B). These data indicate the existence of native complexes containing both chaperones along with IFT and motor proteins. The co-IP of IFT88 with MRJ and HSC70 antibodies, and the similarity of IPs using HSC70 and IFT antibodies for western blotting suggest that HSC70 is associated with most IFT complexes.

Fig. 2
Co-immunoprecipitation of MRJ and HSC70 with IFT proteins

In our experiments antibodies to IFT88 often recognized a doublet of proteins at approximately 90 kDa MW (Fig. 2B), but in many experiments the two bands were not resolved (see Fig. 2A); resolution of only a single band was particularly evident when low percentage gels were used. The fact that either N- or C-terminal peptide antibodies recognize both bands (Fig. 2B, lane 1) suggests that they are variants of IFT88 that could be generated through proteolysis, post-translational modification, or alternative splicing. Data base analysis suggests the existence of splice variants of IFT88 (Ensembl Gene;, that would differ by as much as 1 kDa in size while retaining both N- and C-terminal epitopes. Interestingly, these two bands are differentially immunoprecipitated by MRJ and IFT antibodies. Antibodies to IFT52, IFT20, and MRJ IP both (Fig. 2B, lanes 3, 4, and 7) while those to IFT57 and HSC70 (Fig. 2B, lanes 2 and 5) IP predominantly the lower band. Such data suggest variability in the composition of two forms of IFT88 in IFT complexes.

IFT-Cargo Complexes Containing Photoreceptor Transmembrane Guanylyl Cyclase 1 (GC1) and Rhodopsin (RHO)

One goal of this study was to determine if photoreceptor OS proteins are associated with IFT proteins in IFT-cargo complexes. Since IFT protein complexes could be pulled down with GST-MRJ (Fig. 1F), we looked for photoreceptor specific OS proteins in silver stained gels from GST-MRJ pull down experiments similar to that in Figure 1F using isolated bovine OS. A prominent ≈115 kDa protein band detected in silver stained gels (Fig. 3A) was excised, digested with trypsin, and subjected to MALDI-TOF analysis. 27 peptides matched bovine photoreceptor guanylyl cyclase 1 (Gucy2e), henceforth referred to as GC1. The top matches also included 10-14 peptides from human, mouse (4 sequences), and dog GC1. This identification was confirmed by western blotting with an anti-GC1 antibody (Fig. 3B). In this experiment GC1 was pulled down, but RHO, a much more abundant OS protein, was not detected.

Fig. 3
GST-bMRJ pulls down GC1 from bovine photoreceptors

The identification of GC1 and IFT proteins in bMRJ pull down assays (see Fig. 3B and C) suggests the existence of an IFT-cargo complex containing GC1. However, it was also possible that MRJ directly interacts with both IFT88 and GC1 and that the two are pulled down independently. To test for a direct interaction between MRJ and GC1, we cloned a cytosolic segment (aa 494-844) of mouse GC1, and separately expressed, and purified GST- and His-tagged GC1498-844 proteins. AA 494-844 of GC1 was used because it contains the highly conserved kinase homology domain whose function is poorly understood; this region of the human gene contains multiple mutations that cause photoreceptor degeneration (39-42). Pull-down assays show that GST-bMRJ specifically pulls down His-GC1 (Fig. 3C), and in the reciprocal experiment GST-GC1 pulls down His-mMRJ (Fig. 3D). Using 1.0 μM GST-bMRJ and varying concentrations of GC1494-844 (Fig. 3E) we found that the MRJ/GC1 interaction was concentration dependent and saturated at 0.25 to 0.5 μM GST-bMRJ. Densitometric analysis of the bands relative to lanes with known concentrations of GC1494-844 showed significant binding at 0.03 μM (Fig. 3E) compared to 0.25 μM in similar assays for IFT88 binding (Fig. 1E).

To answer the separate question of whether GC1 is found in IFT protein complexes, IP assays similar to those in Figure 2 were blotted for GC1. GC1, IFT88 and HSC70 were all co-precipitated using multiple antibodies to IFT proteins, MRJ and HSC70 (Fig. 3F). The principal variation was that the anti-GC1 antibody co-precipitated a large amount of the GC1 and a lesser amount of IFT88 compared to the IFT and MRJ antibodies, indicating that only a small fraction of total GC1 is associated with IFT-cargo complexes. HSC70 and IFT88 were also present in each IP; the larger amount of HSC70 in the IP with the MRJ antibody was expected because of its known direct binding to MRJ. However, comparison of the relative blot intensities for GC1, IFT88, and HSC70 in the four IFT IPs (Fig. 3, lanes 6-9) suggests heterogeneity in the relative composition of cargo complexes containing GC1. Finally, in contrast to the GST-MRJ pull-down experiments (Fig. 3B), a small amount of RHO was found in each IP (data not shown); RHO was therefore evaluated in subsequent experiments (see Fig. 4). Our data indicate that GC1 (and RHO) are associated with IFT protein complexes in retinal extracts.

Fig. 4
Co-immunoprecipitation of GC1, rhodopsin, and MRJ with IFT88 is enhanced by addition of Mg/ATP

Mg-ATP Enhances the co-IP of GC1 and RHO with IFT88

The association of both MRJ and HSC70 with IFT-cargo complexes (Figs. 2B, ,3E)3E) and the fact that MRJ activates HSC70 ATPase activity raises the possibility that ATP would modulate the binding of cargo protein or chaperones. Therefore, we examined the effect of ATP and its non-hydrolyzable analogues, AMP-PNP and ATP-γS, on the association of GC1, RHO, HSC70, and MRJ with IFT88 by IP (Fig. 4). First, anti-IFT88C in the presence of 1 mM ATP and 5 mM MgCl2 co-precipitates more GC1 from retinal extracts compared to control (Fig. 4, compare lanes 3 and 4). In contrast, IPs carried out in the presence of Mg-AMP-PNP, a weakly hydrolysable ATP analogue (43), ATP-γS, a non-hydrolyzable ATP analogue, or ATP in the absence of Mg2+ had no effect (Fig. 4, lanes 5, 6, and 8). Furthermore, the effect of Mg-ATP was blocked by addition of either EDTA (lane 7) or NaN3 (lane 9). The later effects are consistent with the known requirement of Mg2+ in the hydrolysis of ATP by HSC70 (43), and the common use of NaN3 as an inhibitor of ATP hydrolysis (44). Interestingly, a similar Mg-ATP dependence of RHO's association with IFT88 was seen, although its interaction was not completely blocked in the presence of NaN3 (Fig. 4, lane 9). Furthermore, this effect was specific for monomeric RHO. RHO typically forms oligomers in SDS-PAGE (see multiple bands in Fig. 4, lane 10), but only the monomeric form co-precipitated. Finally, the pattern of MRJ binding paralleled that of GC1 binding in that it was easily detectible only in the presence of Mg-ATP (Fig. 4, lane 4). These results indicate that the presence of Mg-ATP enhances the co-IP of MRJ, GC1 and RHO with IFT88. Since RHO was not identified in GST pull-down assays using MRJ (Fig. 3B), it is likely that RHO binds to IFT-cargo complexes independently of MRJ and GC1.

The effect of Mg-ATP on the GC1 and RHO content in IPs using anti-IFT88C was concentration dependent (Fig. 5A), and readily reproducible under a variety of experimental conditions. For example, in experiments evaluating effects of MgCl2 and NaCl concentration, 4 mM ATP had similar effects at 1 or 4 mM MgCl2 and at 150 or 250 mM NaCl at either MgCl2 concentration (Fig. 5B). The only salt effect detected was an apparent enhancement of the ATP dependent co-IP of RHO at 250 mM NaCl, and a reversal of this effect at 4 mM MgCl2. Interestingly, in this experiment a doublet of IFT88 was precipitated (see also Fig. 2) in the 0 ATP condition under all salt conditions, while in the presence of ATP, the upper IFT88 band was predominant. A similar effect was seen in the ATP dose dependence data (Fig. 5A), suggesting that the IFT-cargo complexes recovered using the IFT88C antibody contain mainly the larger form of IFT88.

Fig. 5
A. Dose dependent effect of ATP ATP concentration (mM) is indicated at the top and Western blot antibodies are shown on the right. 150 μg of retinal extract (RE) was loaded as a positive control (lane 9). Controls are protein G beads plus RE but ...

Unlike MRJ, the co-IP of HSC70 with IFT88C was abundant in all treatments with the possible exception of Mg-ATPγS (Fig. 4, lane 6). Although addition of ATP analogues appeared to enhance the co-IP of HSC70, conditions expected to inhibit ATP hydrolysis also revealed abundant HSC70 (Fig. 4, lanes 7-9). Furthermore, Mg-ATP concentration had little effect on the co-IP of HSC70 with IFT88 (Fig. 5A). HSC70 detected with two different antibodies was relatively abundant in IPs at all ATP concentrations (Fig. 5A). These results suggest that a significant amount of HSC70 is constitutively associated with IFT proteins in our experiments.

MRJ Localization in Photoreceptor OS and Kidney Epithelial Cilia

We next evaluated MRJ localization in retina and in kidney epithelial cells. Double label IC of bovine retina (Fig. 6A-F) using a rabbit antibody to MRJ (green) along with a monoclonal antibody to K26 (red), a connecting cilium specific glycoprotein (45), revealed that while MRJ is present in all retinal layers. It was most highly concentrated within the photoreceptor inner segments immediately proximal to the connecting cilium. Within the OS MRJ was much less abundant and was diffusely distributed (Fig. 6A and D). To evaluate the MRJ distribution within the OS at higher resolution, we used isolated mouse OS counter stained with a monoclonal antibody to acetylated α-tubulin (Fig. 6G-L). In these preparations the axoneme (tubulin, red) was intensely stained proximally, but this staining was greatly attenuated distally. MRJ did not specifically co-localize with the axoneme, suggesting that it is more closely associated the membrane or cytoplasmic compartments within the OS. Both HSC70 and HSP70 are known to be constitutively expressed in rat photoreceptors and to localize to both inner and outer segments (46). Consistent with this, HSC70 was also present in the inner segment and basal body region of mouse photoreceptors, and, similar to MRJ, was diffusely distributed in the OS (Fig. 6M-Q).

Fig. 6
Localization of MRJ and HSC70 in photoreceptors

MRJ is also associated with sensory cilia in kidney epithelial cells. IC on mouse IMCD3 (not shown) and porcine LLC-PK1 (Fig. 7A) cells readily detected cilia with the anti-acetylated α-tubulin antibody (green) and both IFT88 and IFT57 (red) showed the expected punctate pattern along the length of the cilium. MRJ (red) was also found in cilia in a punctate pattern similar to that seen for IFT proteins (Fig. 7A). Unlike IFT proteins, however, MRJ was present in multiple cytoplasmic compartments, including junctional regions between adjacent cells.

Fig. 7
Localization of endogenous MRJ in kidney epithelial cells

To further study MRJ in epithelial cells a mouse His-MRJ expression vector was constructed, and stably transfected IMCD3 lines were created using antibiotic selection. As shown by western blot analysis (Fig. 7B), a ~32 kDa protein recognized by an anti-His antibody was expressed at moderate levels compared to that seen in transient transfections. IC of His-mMRJ using the anti-His antibody in the same cells showed staining along the cilia (Fig. 7C). As was true for endogenous MRJ (Fig. 7A), His-mMRJ was also present within cytoplasmic compartments. Overall our results indicate that, while MRJ is present in cilia of both photoreceptors and kidney epithelial cells, it is most abundant in cytoplasmic compartments.

Knockdown of MRJ Reduces GC1-GFP in the Cilium

In order to establish a model system for evaluation of membrane protein trafficking into the sensory cilium, we created stably transfected IMCD3 cell lines expressing GC1 with GFP fused in frame at its C-terminus (GC1-GFP). Stable lines expressing moderate to low levels of GC1-GFP as judged by western blot analysis (Fig. 8A) were most useful for evaluating GC1 localization in sensory cilia. In such cultures virtually all cells make sensory cilia stainable with anti-acetylated α-tubulin and these cilia all contain GC1-GFP (Fig. 8B). In many cases the GC1-GFP in the cilium was organized in descrete puncta; it also concentrated at the base of the cilium (Fig. 8C). Analysis of cultures stained with anti-GFP antibodies reveal a similar pattern of staining, and co-localization studies using Hoechst to stain nuclei show that virtually all cells in the culture make cilia containing GC1-GFP (data not shown).

Fig. 8
GC1-GFP in cilia of stably transfected IMCD3 cells

We used IMCD3 cells expressing GC1-GFP in a test of the idea that MRJ is required for GC1-GFP trafficking into the sensory cilium (Fig. 9). In these experiments the GC1-GFP plasmid was co-transfected with control or a MRJ specific shRNA plasmid prior to selection. We used the Super Array SureSilencing™ plasmid based RNA interference system and quantitative PCR to measure the level of knockdown. One shRNA plasmid (M1) reduced MRJ mRNA by 70% compared to the control vector encoding a scrambled RNA sequence not represented in the mouse genome (data not shown). Western blot analysis 5 days after plating shows that this shRNA reduces MRJ protein to virtually undetectable levels compared to the control vector (Fig. 9A). In the control experiment GC1-GFP is found in cilia in virtually all cells (Fig. 9B, D, left panels). In contrast, the shRNA vector directed at MRJ dramatically reduces GC1-GFP in cilia without affecting cilium length (Fig. 9C, D, right panels). These experiments indicate that MRJ is necessary for GC1-GFP trafficking into the sensory cilium.

Fig. 9
MRJ Knockdown reduces GC1-GFP in sensory cilia


IFT-Cargo Complexes Containing GC1, RHO and the MRJ/HSC70 Chaperone Pair

Our central finding is the identification of protein complexes containing IFT proteins, the KIF3A motor subunit, the MRJ/HSC70 chaperone pair, and the photoreceptor membrane proteins, GC1 and RHO. Our previous work on photoreceptors demonstrating a 17S IFT particle and the co-IP of all three subunits of the Kif3 complex with IFT proteins (4) implies that we are dealing with IFT particles bound to the Kif3 complex. We propose that these protein assemblages are involved in the transport of GC1 and RHO into the OS, and accordingly call them “IFT-cargo complexes”. The key events involve the interactions of MRJ with GC1, IFT88, and HSC70 (Fig. 10). In particular, MRJ's known function as an activator of HSC70 ATPase activity and the effects of Mg-ATP on the co-IP of both GC1 and RHO suggest that the HSC70 ATPase cycle plays a role in the formation or stabilization of IFT-cargo complexes. Both HSC70 and HSP70 (46) as well as MRJ (Fig. 6) are constitutively expressed in photoreceptors, and may be particularly important factors supporting the extraordinarily high level of membrane protein trafficking into the OS. However, MRJ's expression in multiple tissue types (38, 47) and its role in GC1-GFP trafficking in IMCD3 cells (see Fig. 9) raise the possibility that it may play a similar role in multiple types of cilia.

Fig. 10
Conceptual models for the role of MRJ/HSC70 in binding of GC1 to the IFT particle

In photoreceptors MRJ and HSC70 could associate with IFT-cargo complexes within the inner segment, the connecting cilium, and/or the OS. Our IP data revealing IFT-cargo complexes utilizes cell extracts and does not specify the relevant compartment, but a growing body of evidence suggests that IFT complexes are initially formed in the vicinity of the basal body. This is consistent with the finding that MRJ is considerably more abundant within the cell bodies of both kidney epithelial cells and photoreceptors (Fig. 6 and and9).9). Furthermore, both HSC70 and HSP70 are constitutively expressed at significant levels in photoreceptors with more in the inner segment (46).

The idea of chaperones associated with cilia and IFT is not entirely new. The Chlamydomonas radial spoke protein RSP16 has been identified as a type II DnaJ protein similar to MRJ (48), and it has been suggested that RSP16 protein serves as a co-chaperone with HSP70 in the final assembly of the radial spoke in the distal cilium. In addition, HSP70 has been identified within Chlamydomonas flagella (49, 50) and Tetrahymena cilia (51), and in a discussion of an early study of an IFT protein complex (15) HSP70 was reported as a co-fractionating protein. Although this finding did not hold up in subsequent high stringency purification of IFT particles (10), HSP70 was identified in subsequent proteomic studies (52); (28, 29). Furthermore, recent expression studies reveal that HSP70a is distributed along the flagellum in a punctate pattern similar to that of the Chlamydomonas fla10 kinesin, suggesting that HSP70 is specifically associated with IFT in Chlamydomonas (50). Finally, both HSP70 and MRJ were identified in a mammalian motile cilium proteome (52) and in a mouse photoreceptor OS proteome (53).

Although photoreceptor HSC70, MRJ, and putative cargo co-IP with IFT proteins, it is likely that binding of both chaperones and cargo is labile and transient. In previous work in Chlamydomonas IFT sub-complexes A and B have been characterized using sucrose density sedimentation and gel filtration chromatography (10-12), but cargo proteins and IFT motors did not co-fractionate using those techniques (10, 30). Nonetheless, both IFT motors and components of the axoneme were found to be associated with IFT proteins by co-IP (30). It is likely that cargo proteins are identified by IP because the conditions are less stringent, permitting capture of complexes in which binding is more labile. Our results using mammalian retina is similar to that in Chlamydomonas in that we have not detected co-fractionating GC1, RHO, or IFT motors in sucrose density gradients (unpublished data) that readily identify a photoreceptor 17S IFT B sub-particle (4). Although our IP protocols are of sufficiently low stringency to permit capture of IFT-cargo complexes, the enhancement of co-precipitating GC1, RHO, and MRJ relative to IFT88 by Mg-ATP argues for a specific pathway regulating their binding.

MRJ is likely to play a critical role in “IFT-cargo complexes” because it binds directly to GC1, HSC70 and IFT88. MRJ binds HSC70 via its J-domain (54), but the activation of HSC70 ATPase activity by N-terminally truncated MRJ suggests that broader interaction is possible (38). Our data indicate that the N-terminal 44 aa are not required for IFT88 or GC1 binding, but at present we do not know whether distinct binding domains would permit MRJ to bind IFT88 and GC1 simultaneously to form a ternary complex. Resolution of this issue requires additional fine mapping data.

While MRJ association with the IFT particle appears to be regulated by Mg-ATP in a manner similar to that of GC1 and rhodopsin, HSC70 is present in IFT complexes under all IP conditions used in these studies. The only conditions obviously affecting HSC70 levels were addition of EDTA, NaN3, or ATP without Mg2+. Those treatments resulted in increased HSC70 without increased MRJ or cargo proteins. This favors a model in which HSC70 is constitutively present on IFT particles (Fig. 10A), as opposed to one in which HSC70 is recruited to the IFT particle by MRJ (Fig. 10B). In this regard, it is of interest that the HSC70 C-terminus is known to bind to proteins with TPR repeats (55, 56). In addition to IFT88 several additional IFT proteins including IFT172 within IFT sub-particle B contain TPR repeats (11, 27, 57). Thus, it is possible that HSC70 can bind directly to IFT88 or to one or more additional TPR containing proteins within the IFT particle. IFT88 along with HSC70 bound to the particle could in turn recruit MRJ bound cargo proteins such as GC1.

A Role for the HSC70 ATPase Cycle in IFT Cargo Loading?

HSC70 and other HSP70 family members along with their Dnaj co-chaperones function in numerous biochemical and cellular pathways (58, 59). These pathways generally begin with substrate binding in which specificity is conferred by members of the Dnaj family of proteins, which bind to both substrate and HSC70. For example, mitochondrial HSP70 along with a Dnaj protein and a nucleotide exchange factor is critical for both translocation of proteins across the inner mitochondrial membrane and for protein folding in the mitochondrial matrix (60, 61). In another well-studied example, auxillin, a DnaJ protein, binds to clathrin coated vesicles where it recruits and activates HSC70 to un-coat the vesicle (62) while a distinct DnaJ protein recruits HSC70 during coated vesicle endocytosis (63). Finally, it has been reported that HSP70 ATPase activity dissociates conventional kinesin membrane vesicle cargo (64). In each case the function of the chaperone pair can be best understood in relationship to an ATPase cycle in which HSC70 oscillates between an ATP bound, “open” conformation and an ADP bound, “closed” conformation (58, 59). DnaJ proteins interact with HSC70 in its “open” conformation and activate its inherently low ATPase activity. The “closed” conformation is often associated with a higher affinity for substrate, and is reversed on exchange of ADP for ATP, which can be stimulated by nucleotide exchange factors. The enhanced binding of GC1 and RHO to IFT complexes in the presence of Mg-ATP, suggest a role for the ATPase cycle of HSC70 in the formation of IFT-cargo complexes. Although the plausibility of this model is supported by the known enhancement of HSC70 ATPase activity by MRJ (38), further analysis of the role of Mg-ATP in stabilizing IFT cargo complexes is necessary because other pathways such as protein phosphorylation could also modulate critical steps of IFT-cargo complex assembly.

Ciliary Membrane Proteins as IFT Cargo

Our data extend prior genetic and cell biological studies implicating IFT in membrane protein trafficking in photoreceptors and other systems. For example, mis-localization of RHO in mice with a mutation in IFT88/polaris (8) or a deficiency in the KIF3A subunit of the Kif3 complex (35, 36) have provided genetic evidence that RHO is transported by IFT. We have additional data showing that GC1 is also mis-localized in Tg737orpk mice (unpublished) in a manner similar to RHO. Although such mis-localization could be an indirect consequence of the mutations, our data provide a direct biochemical linkage between GC1 and RHO and the IFT pathway. Linkages to cilia and a role for IFT have also emerged for other membrane receptors including polycystins 1 and 2 (65-68), olfactory cyclic nucleotide gated channels (69), and the smoothened (Smo) receptor for hedgehog signaling (70). Finally, it should be mentioned that movement of TRPV channels in parallel with IFT particles has been directly imaged in living C. elegans sensory cilia (71).

Trafficking and Photoreceptor Degeneration

Growing evidence indicates that some hereditary photoreceptor diseases result from defective intracellular protein transport. For example, the most common cause of Retinitis Pigmentosa (RP), a common hereditary retinal dystrophy, is mutation of the rhodopsin gene (72), and several of its mutations are thought to involve trafficking (73). Similarly, mutations in GC1 are known to cause a range of different inherited diseases including Lebers Congenital Amaurosis and cone-rod dystrophies in humans (42, 74, 75), and deletion of both photoreceptor membrane cyclases (GC1 and GC2) in mice results in abnormal trafficking of several outer segment proteins (76). The most clearly understood of the human GC1 mutations are in dimerization and catalytic domains that are thought to result in loss of enzyme activity, and clear examples of mutations affecting trafficking have not been identified (74). Our data show that MRJ interacts with a GC1 peptide (aa 494-844) that includes a kinase homology domain (KHD) of unknown function and a portion of the dimerization domain. The KHD of GC1 contains disease-causing mutations of unknown molecular consequence (42, 75). Our data linking the IFT pathway directly to GC1 via binding of MRJ to GC1494-844 suggests that mutations in the KHD lead to defective trafficking and human disease.

Experimental Procedures


Antibodies used for immunocytochemistry for IFT and MRJ proteins were gifts of Gregory Pazour (8) and Chig-Hwa Sung (38) respectively. For double labeling mouse monoclonal antibodies directed at acetylated-a-tubulin (Sigma, St. Louis, MO) or the ciliary K26 antigen (45) were used. In Western blotting and immunoprecipitation assays goat antibodies IFT88N, IFT88C, and IFT57N as well as KIF3A (Covance, Berkeley, CA) and KIF3B (BD Biosciences, Palo Alto, CA) are as described previously (4). New affinity purified antibodies directed at synthetic peptides from the C- termini of IFT57 (peptide CSEARERYQQGNGGVT, called IFT57C, and IFT52 (peptide CLQEGDENPRDFTTLF, called IFT52C) were produced at Bethyl Laboratories (Montgomery, TX) using goat as the host species. The affinity purified IFT20 antibody used in this work was produced in guinea pig (Covance, Berkeley, CA) using full-length recombinant IFT20 as the antigen. Alexander M. Dizhoor (Pennsylvania College of Optometry) and Robert Molday (University of British Columbia) provided the rabbit and monoclonal (6H2) antibodies to GC1 respectively. The anti-HSP70 antibody (SPA-820, Stressgen Bioreagents, Victoria Canada) was a mouse monoclonal antibody, which detects both HSP70 and HSC70. The HSC70 specific antibody (ab19136, Abcam, Cambridge, MA) was a rat monoclonal antibody. The mouse monoclonal anti-polyhistidine antibody was from Sigma (St Louis, MO).

Yeast Two Hybrid Library Screen

The Matchmaker Gal4 Two Hybrid System 3 (Clontech, Palo Alto, CA) was used following the manufacturers instructions (Clonetch, PT3024-1). The bait plasmid pGBKT7-IFT88(TPR1-3) included the coding sequencing of the N-terminal TPR array of mouse IFT88 (aa 177-317 of Genbank acc # AAB59705) in frame with the GAL4 DNA binding domain; additional IFT88 constructs used in the analysis encoded aa 392-727 (IFT88(TPR4-10)) and aa 176-727 (IFT88(TPR1-10)) of mouse IFT88. The bovine retinal cDNA library, cloned into the pACT2 vector, was provided by Dr. Ching-Hwa Sung (38). Plasmids were introduced into AH109 yeast cells by Lithium acetate (LiAc)-mediated co-transformation and plated on high stringency (SD-adenine-histidine-leucine-tryptophan) plates. After three weeks at 30 °C 100 colonies (≥ 2 mm diameter) were selected, inoculated into 0.5 ml of SD-adenine-histidine-leucine-tryptophan medium, and grown to saturation at 30 °C with shaking.

For plasmid DNA sequencing and restriction enzyme analysis, E. coli (DH5α) were transformed with plasmids from each yeast colony, and plated on LB-ampicillin plates for selection. Plasmids were harvested by standard alkaline lysis using a spin plasmid miniprep kit (Qiagen, Valencia, CA), double digested with XhoI and EcoRI, and examined on 1% agarose gels to verify the presence of cDNA inserts; inserts were sequenced using a dye terminator cycle sequencing kit and the ABI Prism 310 Genetic Analyzer (Applied Biosystems, Foster City, CA). After the initial step of the screen 100 colonies were selected, 9 of which were MRJ; eleven gene products remained after growth on high stringency plates. After exclusion of clones that self-activated in the absence of bait, only MRJ (Dnajb6) and one other gene product (steroid sensitive gene, Ccdc1) were identified.

Yeast Two-Hybrid Re-transformation and α-Gal Quantitative Assays

To verify that the proteins encoded by the cDNA inserts interact with the IFT88 (TPR1-3), plasmids were co-transformed with pGBKT7-IFT88-TPR1-3 plasmid or with the empty vector, pGBKT7, into yeast AH109 cells using a small-scale transformation method (Clontech, PT3024-1). Cells grown on low stringency (SD-leucine-tryptophan) plates for three days at 30 °C, were transferred to SD-adenine-histidine-leucine-tryptophan plates supplemented with 20 μg/ml X-α-Gal (5 –Bromo-4-chloro-3-indolyl-α-D-galactopyranoside) for high stringency selection. The formation of yeast colonies and expression of galactosidase activity were examined after growth for three days.

Quantitative α-Galactosidase (α-Gal) assays were also conducted to determine the relative strength of the interaction. The catalytic activity of α-galactosidase was monitored colorimetrically by measuring the rate of hydrolysis of p-nitrophenyl-α-D-galactoside (PNP-α-Gal) to p-nitrophenol, which displays a strong absorption band at 410 nm (Yeast Protocols Handbook, Clontech). Every re-transformation sample was assayed in triplicate in one experiment, and three independent experiments were conducted.

GST Pull Down Assays

The GST-bMRJ construct, generously provided by Dr. Ching-Hwa Sung (Cornell University) encoded the C-terminal 198 residues of bovine MRJ 3′ to the GST open reading frame in the pGEX-5X-2 vector (38). It was expressed in E. coli BL21 cells, and large scale production of GST-fusion and cleaved proteins followed the protocol of Guan and Dixon (78). The retinal extract for pull-down assays was prepared by the method of Aslanukov and colleagues (79). Briefly 20 (~10 g) fresh frozen bovine retinas (Emmpak Foods, Milwaukee, WI) were ground into a fine powder on dry ice followed by homogenization (30-40 strokes) in a glass homogenizer with 30 ml of cold homogenization buffer (1% Nonidet P-40, 20mM Tris-HCl,pH 6.8, 250 mM NaCl, 2mM 2-mercaptoethanol, 0.02% NaN3, 5% (v/v) glycerol and a cocktail of protease inhibitors). Homogenates were centrifuged at 10,000g at 4°C for 20 min and pre-cleared with 5.0 ml of swollen glutathione sepharose beads and 500 μg of recombinant glutathione S-transferase for about 30 min at 4°C.

For pull-down assays about 2 μM of the GST-fused protein was incubated with retinal extract containing 1 mM Pefabloc SC (Boehringer Mannheim) for 1 hr in a nutator mixer followed by an additional incubation for 1 hour with 60 μl of 50% glutathione Sepharose 4B beads (Amersham Pharmacia Biotech, Piscataway, NJ) in 50mM Tris-HCl (pH 7.5), 100 mM NaCl, 2 mM MgCl2, and 1% NP-40. Beads were centrifugation (2-3 sec at 10,000 g) and washed four times with 0.5 ml of cold 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 2mM MgCl2, 0.2% Triton X-100.

For recombinant in-vitro assays 1.0 μM of GST bMRJ was incubated with different concentrations of affinity purified, recombinant IFT88 ranging from 0.25 to 2.0 μM for 45 min in 1% Nonidet P-40 homogenization buffer at 4°C. Then 60 μl of glutathione sepharose beads in incubation buffer was added, further incubated for 60 min at 4°C, and washed four times. An additional set of in-vitro assays was carried out using affinity-purified recombinant His or GST tagged mouse GC1 (Gucy2e) and GST or His tagged MRJ. The His tagged proteins were captured using Ni-NTA agarose beads (Invitrogen). Quantitative analysis involved use of GC1 ranging from 0.03 to 0.5 μM in combination with 0.50 μM GST-bMRJ. Finally, the retinal co-precipitates were resuspended in 1× SDS sample buffer (62.5 mM Tris-HCl, (pH 6.8) 2% SDS, 5% 2-mercaptoethanol, 10% Glycerol) and boiled for 3-5 min, and resolved by SDS-PAGE. Proteins were analyzed by western blotting. In the semi-quantitative analyses bMRJ binding to IFT88 (Fig. 2A) and GC1494-844 (Fig. 3E) bands from digital images were scanned using LabWorks (UVP, Upland, CA) image analysis software, and protein concentration of pull-downs was estimated from scans of lanes on the same blot loaded with known concentrations of recombinant IFT88 or GC1494-844.

Isolation and identification of GC1 by MS

GC1 was isolated in a pull-down assay using recombinant GST-bMRJ incubated with glutathione beads at 4°C for 2 hrs, followed by incubation for an additional 2 hrs with an extract prepared from a purified bovine rod OS fraction (80) rather than whole retinal extract. GST beads were collected by centrifugation, washed, boiled with SDS sample buffer, and examined on SDS-PAGE with silver staining (81). At the Medical College of Wisconsin Protein and Nucleic Acid Core Facility, the sample band and neighboring blank gel pieces were digested by trypsin and then subjected to Zip-Tip cleanup. Finally, the peptides were analyzed with the Voyager-DE PRO MALDI-TOF mass spectrometer (Applied Biosystems, Foster City, CA). The Protein Prospector program ( was used to search the database for peptide identification. The top match was bovine GC1 (score 1.89e14) with 27 of 68 peptides and 39% coverage. The top 7 matches included human, mouse (4 sequences), dog and rat GC1 with 10 to 14 peptides each. Three proteins of unknown function with scores and coverage similar to the non-bovine GC1's were identified. They were Tacc2 (Q9JJGO), Ccdc46 (Q5PR68) and Zc3h3 (Q8IXZ2). For these proteins and the non bovine GC1 proteins the score dropped dramatically to the range of 2-4e4.

Immunoprecipitation Assays

Immunoprecipitation (IP) assays were carried as described by Aslanukov and colleagues (79). Briefly, for each IP reaction about 4 μg of antibody was used per 20 μl of Protein G Sepharose beads in phosphate-buffered saline, pH 7.4; antibodies were incubated for 45 min at room temperature. Approximately, 200 μl of NP-40 (1% Nonidet P-40, 250mM NaCl, 20 mM Tris-HCl, pH 6.8) solubilized retinal extract was incubated with the antibody bound beads for 60 min at 4°C. The beads with retinal extract were then loaded onto spin filters (Millipore, Bedford, MA) and washed three times with 0.5 ml of the NP-40 buffer followed by the elution of the bound protein complexes with 60 μl of SDS-sample buffer. Eluants were boiled and resolved on SDS-PAGE gels, and analyzed by western blotting. IPs in the presence of Mg-ATP and its analogues or inhibitors of ATPase activity were incubated for one hour at 4°C with the additions prior to the addition of antibody attached to protein G sepharose beads.


Pig kidney tubular epithelial cells (LLC-PK1) or mouse IMCD3 cells were grown to confluency on coverslips in medium 199 (Gibco 12340-030) supplemented with 3% fetal bovine serum (Gibco 16000-036) and 1× penicillin-streptomycin-glutamine (Gibco 10378-016) at 37°C with 5% CO2 in air atmosphere. They were fixed for 10 min in a mixture of methanol and acetone at -20°C, rinsed with PBS, and blocked and permeabilized for 1 h at 30°C in 3% fetal bovine serum and 0.5% Triton X-100 in medium 199. For double labeling the coverslips were immersed in 60 μL of blocking buffer containing mouse monoclonal anti-acetylated α-tubulin antibody (1:100, Sigma, St Louis, MO), rabbit anti-IFT88 antibody (1:200), rabbit anti-IFT57 (1:200), or rabbit anti-MRJ antibody (1:20) for 1 h at 30°C in a humid chamber. After rinsing with PBS, the coverslips were incubated for 1 h at 30°C with a 1:500 dilution of the corresponding secondary antibodies: Alexa 488 conjugated goat anti-mouse IgG or Alexa 594 conjugated goat anti-rabbit IgG (Molecular Probes, Inc., Eugene, OR). Hoechst dye (2 μg/ml) was used to label the nuclei. Slides were coversliped using Fluoromount G (EMS, Fort Washington, PA) and observed using a Nikon epifluorescence inverted microscope.

Fresh bovine retinal sections were incubated with rabbit anti-MRJ and K26 antibodies, which were detected with goat anti-rabbit or goat anti-mouse IgG conjugated with Alexa 488 or Alexa 594 (Molecular Probes, Inc., Eugene, OR). The monoclonal antibody K26, which detects a unique epitope on the connecting cilium of bovine photoreceptor cells, was used as a marker for connecting cilium (45). Mouse photoreceptors were isolated by shaking freshly dissected retinas in PBS on microscope slides. Cells were fixed with 4% paraformadehyde and stained as above.

Construction of Mouse MRJ, KLC1 and GC1 Expression Vectors

To obtain full-length mouse MRJ sequence RNA from C57Bl/6 mouse retina was isolated using Trizol according to the manufacturer's instruction (Life Technologies, Rockville, MD) and reverse transcribed using a reverse transcription system (Promega, Madison, WI). After separating the PCR product on a 1% agarose gel, the band with the expected length (~750 bp) was excised and the DNA was purified using a GENECLEAN TURBO kit (Bio 101, Inc). This DNA fragment was cloned into the mammalian expression vector pcDNA4/HisMax (Invitrogen, San Diego, CA) for expression of His-tagged mouse MRJ protein.

The sequence encoding 5 TPR repeats of KlC1 (kinesin light chain 1, aa 176-417) was amplified from C57Bl/6 mouse brain total RNA using Accu script RT-PCR kit (Stratagene, La Jolla, CA) and cloned in pGBKT7 vector (82). The full-length sequence of mouse IFT88 (Genbank Acc# AAB59705) kindly provided by Gregory Pazour (83) was cloned into pTrcHis-TOPO and pGEX-4T-1 to obtain pTrcHis/mIFT88 and pGEX-4T-1/mIFT88 for recombinant IFT88 protein expression in E coli. The sequence encoding aa 494-844 of mouse photoreceptor GC1 (Gycy2e) was cloned into pTrcHis-TOPO and pGEX-4T-1 (Amersham Pharmacia Biotech, Piscataway, NJ) to obtain pTrcHis/mGC1F2 and pGEX-4T-1/mGC1F2. The eGFP tagged GC1 was constructed by amplifying full length mouse GC1 using Stratascript RT-PCR system (Stratagene, La Jolla, CA). The DNA fragment was then cloned in frame in pEGFP-N3 vector (Clontech). The resulting clone expresses eGFP fused with the C terminus of GC1. The accuracy of clones was verified by DNA sequencing using a dye terminator cycle sequencing kit (Applied Biosystems, Foster City, CA). The shRNA plasmids for MRJ with an insert sequence called M1 (CGTGACGCACTTCCTGTTTGT) and a Negative control with insert sequence (GGAATCTCATTCGATGCATAC) were from Superarray Biosciences (Frederick, MD).

Creation of Stable His-MRJ Cell Lines

Mouse kidney inner medullar collecting duct (IMCD3) cells were grown in DMEM/F12 medium (Gibco 11330-032) supplemented with 10% fetal bovine serum and 1× Penicillin-streptomycin-glutamine at 37°C with 5% CO2 in air atmosphere. Cells at ≈90% confluency were transfected with 5 μg of pcDNA4/His-mMRJ plasmid using LipofectAMINE 2000 (Life technologies, Rockville, MD) and OptiMEM media (Gibco) according to the manufacturer's protocol. 30 hours after transfection cells were subcultured in 10 cm tissue culture dishes at a density of 10,000 cells/dish in normal growth media. 48 hours after transfection cells were supplied with fresh medium containing 100 μg/ml Zeocin (Invitrogen, San Diego, CA), and kept in the selection medium until colonies were formed. Colonies were expanded and western blotted with mouse monoclonal anti-polyhistidine antibody (Sigma, St Louis, MO) to check for the expression of His-tagged MRJ protein. The localization of His-MRJ in the stable cell line was examined by immunocytochemistry using anti-polyhistidine antibody (Sigma, St Louis, MO).

Preparation of GC1-GFP stable cell lines and MRJ knockdown

Mouse IMCD3 cells were grown up to 90-95% confluency as above in DMEM medium (Invitrogen, 11965-092) with 10% fetal bovine serum and 1× Penicillin-streptomycin-glutamine at 37°C with 5% CO2 in air atmosphere, and were transfected with 2.0 μg of GC1-GFP alone or with 3.0 μg MRJ shRNA or negative control plasmid by using LipofectAMINE 2000 reagent (Invitrogen, San Diego, CA) and OptiMEM media (Gibco). After 48h at 37°C in a C02 incubator cells were subcultured in 10 cm dishes with fresh medium. 48 hours after plating, the cells were given fresh medium supplemented with 200 μg/ml of Geneticin or G418 (Invitrogen, San Diego, CA) and maintained in this medium until colonies formed. After further growth colonies were subjected to western blotting and IC for identification of positive clones. Colonies were subjected to RT-PCR and western blotting to estimate the level of MRJ knockdown. For western blotting cells that had been transfected with GC1-GFP, GC1-GFP/-ve Control and GC1-GFP/MRJ shRNA plasmid were washed with ice-cold PBS, and lysed on ice in HMDEK buffer (Cole et al., 1998) containing 1% Triton-X 100. Cells were homogenized by repeated passage through a 22-gauge needle and centrifuged at 10,000×g for 15 min at 4 °C. Protein concentrations were determined using the BCA method (Pierce), and samples (~150 μg) were separated by SDS-PAGE and transferred to PVDF membranes.


The authors thank Dr. Ching-Hwa Sung from Weill Medical School of Cornell University for graciously providing the bovine retinal yeast library, antiserum to the MRJ protein, and an expression plasmid for bovine MRJ. We thank Gregory Pazour from the University of Massachusetts for providing the rabbit antibodies to IFT88 and IFT57 and a plasmid encoding mouse IFT88. We thank Robert Molday from the University of British Columbia for providing GC1 monoclonal antibodies, and Alexander Dizhoor from Pennsylvania College of Optometry for a rabbit antibody to GC1. The authors also thank Win Sale, Greg Pazour, and Wolgang Baehr for their comments on an early version of the manuscript. This work was supported by NIH research grant EY03222 (JCB), NIH Core Grant for Vision Research P30-EY01931, and Development Funds from the Medical College of Wisconsin. SAB and CI were supported in part by a NIH Training Grant in Vision Science, T32-EY014537.

Abbreviations List

dynein heavy chain 1b
retinal transmembrane guanylyl cyclase 1, mouse Gucy2e
glutathione-S transferase
heat shock protein 70
heat shock cognate protein 70
intraflagellar transport
heavy chain A of Kif3 complex
kinesin light chain 1
mammalian relative of DnaJ, DnaJb6
outer segment
tetratricopeptide repeat


*HSP/HSC70 family proteins function in the same way but differ in whether their expression is constitutive (heat shock cognate protein 70, HSC70, or is induced by stress stimuli such as heat shock (HSP70). We refer to the protein in this analysis as HSC70 (Hspa8) because it binds a HSC70 specific antibody. However, the antibody used in the early stages of this work recognized both HSP70 an d HSC70, and it is likely that MRJ can interact via its J-domain with multiple members of the gene family.


1. Rohlich P. The sensory cilium of retinal rods is analogous to the transitional zone of motile cilia. Cell Tissue Res. 1975;161:421–430. [PubMed]
2. Besharse JC, Forestner DM, Defoe DM. Membrane assembly in retinal photoreceptors III. distinct membrane domains of the connnecting cilium of developing rods. JNeurosci. 1985;5:1035–1048. [PubMed]
3. Besharse JC, Horst CJ. The photoreceptor connecting cilium A model for the transition zone. In: Bloodgood RA, editor. Ciliary and Flagellar Membranes. 1. New York: Plenum Publishing Corp; 1990. pp. 389–417.
4. Baker SA, Freeman K, Luby-Phelps K, Pazour GJ, Besharse JC. IFT20 links kinesin II with a mammalian intraflagellar transport complex that is conserved in motile flagella and sensory cilia. J Biol Chem. 2003;278(36):34211–34218. [PubMed]
5. Rosenbaum JL, Witman GB. Intraflagellar transport. Nat Rev Mol Cell Biol. 2002;3(11):813–825. [PubMed]
6. Young RW. The renewal of photoreceptor cell outer segments. JCell Biol. 1967;33:61–72. [PMC free article] [PubMed]
7. Rosenbaum JL, Cole DG, Diener DR. Intraflagellar transport: The eyes have it. JCell Biol. 1999;144:385–388. [PMC free article] [PubMed]
8. Pazour GJ, Baker SA, Deane JA, Cole DG, Dickert BL, Rosenbaum JL, Witman GB, Besharse JC. The intraflagellar transport protein, IFT88, is essential for vertebrate photoreceptor assembly and maintenance. J Cell Biol. 2002;157(1):103–113. [PMC free article] [PubMed]
9. Besharse JC, Baker SA, Luby-Phelps K, Pazour GJ. Photoreceptor intersegmental transport and retinal degeneration: a conserved pathway common to motile and sensory cilia. Adv Exp Med Biol. 2003;533:157–164. [PubMed]
10. Cole DG, Diener DR, Himelblau AL, Beech PL, Fuster JC, Rosenbaum JL. Chlamydomonas kinesin-II-dependent intraflagellar transport (IFT): IFT particles contain proteins required for ciliary assembly in Caenorhabditis elegans sensory neurons. JCell Biol. 1998;141:993–1008. [PMC free article] [PubMed]
11. Cole DG. The intraflagellar transport machinery of Chlamydomonas reinhardtii. Traffic. 2003;4(7):435–442. [PubMed]
12. Lucker BF, Behal RH, Qin H, Siron LC, Taggart WD, Rosenbaum JL, Cole DG. Characterization of the intraflagellar transport complex B core: direct interaction of the IFT81 and IFT74/72 subunits. J Biol Chem. 2005;280(30):27688–27696. [PubMed]
13. Kozminski KG, Johnson KA, Forscher P, Rosenbaum JL. A motility in the eukaryotic flagellum unrelated to flagellar beating. ProcNatlAcadSciUSA. 1993;90:5519–5523. [PubMed]
14. Snow JJ, Ou G, Gunnarson AL, Walker MR, Zhou HM, Brust-Mascher I, Scholey JM. Two anterograde intraflagellar transport motors cooperate to build sensory cilia on C. elegans neurons. Nat Cell Biol. 2004;6(11):1109–1113. [PubMed]
15. Piperno G, Mead K. Transport of a novel complex in the cytoplasmic matrix of Chlamydomonas flagella. Proc Natl Acad Sci U S A. 1997;94(9):4457–4462. [PubMed]
16. Kozminski KG, Beech PL, Rosenbaum JL. The Chlamydomonas kinesin-like protein FLA10 is involved in motility associated with the flagellar membrane. JCell Biol. 1995;131:1517–1527. [PMC free article] [PubMed]
17. Pan X, Ou G, Civelekoglu-Scholey G, Blacque OE, Endres NF, Tao L, Mogilner A, Leroux MR, Vale RD, Scholey JM. Mechanism of transport of IFT particles in C. elegans cilia by the concerted action of kinesin-II and OSM-3 motors. J Cell Biol. 2006;174(7):1035–1045. [PMC free article] [PubMed]
18. Scholey JM. Intraflagellar transport motors in cilia: moving along the cell's antenna. J Cell Biol. 2008;180(1):23–29. [PMC free article] [PubMed]
19. Cole DG, Chinn SW, Wedaman KP, Hall K, Vuong T, Scholey JM. Novel heterotrimeric kinesin-related protein purified from sea urchin eggs. Nature. 1993;366(6452):268–270. [PubMed]
20. Pazour GJ, Wilkerson CG, Witman GB. A dynein light chain is essential for the retrograde particle movement of intraflagellar transport (IFT) JCell Biol. 1998;141:979–992. [PMC free article] [PubMed]
21. Pazour GJ, Dickert BL, Witman GB. The DHC1b (DHC2) isoform of cytoplasmic dynein is required for flagellar assembly. JCell Biol. 1999;144:473–481. [PMC free article] [PubMed]
22. Porter ME, Bower R, Knott JA, Byrd P, Dentler W. Cytoplasmic dynein heavy chain 1b is required for flagellar assembly in Chlamydomonas. MolBiolCell. 1999;10:693–712. [PMC free article] [PubMed]
23. Signor D, Wedaman KP, Orozco JT, Dwyer ND, Bargmann CI, Rose LS, Scholey JM. Role of a class DHC1b dynein in retrograde transport of IFT motors and IFT raft particles along cilia, but not dendrites, in chemosensory neurons of living Caenorhabditis elegans. JCell Biol. 1999;147:519–530. [PMC free article] [PubMed]
24. Peden EM, Barr MM. The KLP-6 kinesin is required for male mating behaviors and polycystin localization in Caenorhabditis elegans. Curr Biol. 2005;15(5):394–404. [PubMed]
25. Insinna C, Pathak N, Perkins B, Drummond I, Besharse JC. The homodimeric kinesin, Kif17, is essential for vertebrate photoreceptor sensory outer segment development. Dev Biol. 2008;316(1):160–170. [PMC free article] [PubMed]
26. Li JB, Gerdes JM, Haycraft CJ, Fan Y, Teslovich TM, May-Simera H, Li H, Blacque OE, Li L, Leitch CC, Lewis RA, Green JS, Parfrey PS, Leroux MR, Davidson WS, et al. Comparative genomics identifies a flagellar and basal body proteome that includes the BBS5 human disease gene. Cell. 2004;117(4):541–552. [PubMed]
27. Avidor-Reiss T, Maer AM, Koundakjian E, Polyanovsky A, Keil T, Subramaniam S, Zuker CS. Decoding cilia function: defining specialized genes required for compartmentalized cilia biogenesis. Cell. 2004;117(4):527–539. [PubMed]
28. Pazour GJ, Agrin N, Leszyk J, Witman GB. Proteomic analysis of a eukaryotic cilium. J Cell Biol. 2005;170(1):103–113. [PMC free article] [PubMed]
29. Gherman A, Davis EE, Katsanis N. The ciliary proteome database: an integrated community resource for the genetic and functional dissection of cilia. Nat Genet. 2006;38(9):961–962. [PubMed]
30. Qin H, Diener DR, Geimer S, Cole DG, Rosenbaum JL. Intraflagellar transport (IFT) cargo: IFT transports flagellar precursors to the tip and turnover products to the cell body. J Cell Biol. 2004;164(2):255–266. [PMC free article] [PubMed]
31. Luby-Phelps K, Fogerty J, Baker SA, Pazour GJ, Besharse JC. Spatial Distribution of Intraflagellar Transport Proteins in Vertebrate Photoreceptors. Vision Res. 2008;48:413–423. [PMC free article] [PubMed]
32. Beech PL, Pagh-Roehl K, Noda Y, Hirokawa N, Burnside B, Rosenbaum JL. Localization of kinesin superfamily proteins to the connecting cilium of fish photoreceptors. JCell Sci. 1996;109:889–897. [PubMed]
33. Insinna C, Pathak P, Perkins B, Drummond I, Besharse JC. The homodimeric kinesin, Kif17, is essential for vertebrate photoreceptor sensory outer segment development. DevBiol. 2008 (in press) Published early online. [PMC free article] [PubMed]
34. Mikami A, Tynan SH, Hama T, Luby-Phelps K, Saito T, Crandall JE, Besharse JC, Vallee RB. Molecular structure of cytoplasmic dynein 2 and its distribution in neuronal and ciliated cells. J Cell Sci. 2002;115(Pt 24):4801–4808. [PubMed]
35. Marszalek JR, Liu X, Roberts EA, Chui D, Marth JD, Williams DS, Goldstein LS. Genetic evidence for selective transport of opsin and arrestin by kinesin-II in mammalian photoreceptors. Cell. 2000;102(2):175–187. [PubMed]
36. Jimeno D, Feiner L, Lillo C, Teofilo K, Goldstein LS, Pierce EA, Williams DS. Analysis of kinesin-2 function in photoreceptor cells using synchronous Cre-loxP knockout of Kif3a with RHO-Cre. Invest Ophthalmol Vis Sci. 2006;47(11):5039–5046. [PMC free article] [PubMed]
37. Moyer JH, Lee-Tischler MJ, Kwon HY, Schrick JJ, Avner ED, Sweeney WE, Godfrey VL, Cacheiro NL, Wilkinson JE, Woychik RP. Candidate gene associated with a mutation causing recessive polycistic kidney disease in mice. Science. 1994;264:1329–1333. [PubMed]
38. Chuang JZ, Zhou H, Zhu M, Li SH, Li XJ, Sung CH. Characterization of a brain-enriched chaperone, MRJ, that inhibits Huntingtin aggregation and toxicity independently. J Biol Chem. 2002;277(22):19831–19838. [PubMed]
39. Rozet JM, Perrault I, Gerber S, Hanein S, Barbet F, Ducroq D, Souied E, Munnich A, Kaplan J. Complete abolition of the retinal-specific guanylyl cyclase (retGC-1) catalytic ability consistently leads to leber congenital amaurosis (LCA) Invest Ophthalmol Vis Sci. 2001;42(6):1190–1192. [PubMed]
40. Perrault I, Rozet JM, Gerber S, Ghazi I, Ducroq D, Souied E, Leowski C, Bonnemaison M, Dufier JL, Munnich A, Kaplan J. Spectrum of retGC1 mutations in Leber's congenital amaurosis. Eur J Hum Genet. 2000;8(8):578–582. [PubMed]
41. Perrault I, Rozet JM, Calvas P, Gerber S, Camuzat A, Dollfus H, Chatelin S, Souied E, Ghazi I, Leowski C, Bonnemaison M, Le Paslier D, Frezal J, Dufier JL, Pittler S, et al. Retinal-specific guanylate cyclase gene mutations in Leber's congenital amaurosis. Nat Genet. 1996;14(4):461–464. [PubMed]
42. Yzer S, Leroy BP, De Baere E, de Ravel TJ, Zonneveld MN, Voesenek K, Kellner U, Ciriano JP, de Faber JT, Rohrschneider K, Roepman R, den Hollander AI, Cruysberg JR, Meire F, Casteels I, et al. Microarray-based mutation detection and phenotypic characterization of patients with Leber congenital amaurosis. Invest Ophthalmol Vis Sci. 2006;47(3):1167–1176. [PubMed]
43. Wilbanks SM, DeLuca-Flaherty C, McKay DB. Structural basis of the 70-kilodalton heat shock cognate protein ATP hydrolytic activity. I. Kinetic analyses of active site mutants. J Biol Chem. 1994;269(17):12893–12898. [PubMed]
44. Weber J, Senior AE. Effects of the inhibitors azide, dicyclohexylcarbodiimide, and aurovertin on nucleotide binding to the three F1-ATPase catalytic sites measured using specific tryptophan probes. J Biol Chem. 1998;273(50):33210–33215. [PubMed]
45. Horst CJ, Johnson LV, Besharse JC. Transmembrane assemblage of the photoreceptor connecting cilium and motile cilium transition zone contain a common immunologic epitope. Cell MotilCytoskeleton. 1990;17:329–344. [PubMed]
46. Dean DO, Kent CR, Tytell M. Constitutive and inducible heat shock protein 70 immunoreactivity in the normal rat eye. Invest Ophthalmol Vis Sci. 1999;40(12):2952–2962. [PubMed]
47. Seki N, Hattori A, Hayashi A, Kozuma S, Miyajima N, Saito T. Cloning, tissue expression, and chromosomal assignment of human MRJ gene for a member of the DNAJ protein family. J Hum Genet. 1999;44(3):185–189. [PubMed]
48. Yang C, Compton MM, Yang P. Dimeric novel HSP40 is incorporated into the radial spoke complex during the assembly process in flagella. Mol Biol Cell. 2005;16(2):637–648. [PMC free article] [PubMed]
49. Bloch MA, Johnson KA. Identification of a molecular chaperone in the eukaryotic flagellum and its localization to the site of microtubule assembly. JCell Sci. 1995;108:3541–3545. [PubMed]
50. Shapiro J, Ingram J, Johnson KA. Characterization of a molecular chaperone present in the eukaryotic flagellum. Eukaryot Cell. 2005;4(9):1591–1594. [PMC free article] [PubMed]
51. Williams NE, Nelsen EM. HSP70 and HSP90 homologs are associated with tubulin in hetero-oligomeric complexes, cilia and the cortex of Tetrahymena. J Cell Sci. 1997;110(Pt 14):1665–1672. [PubMed]
52. Ostrowski LE, Blackburn K, Radde KM, Moyer MB, Schlatzer DM, Moseley A, Boucher RC. A proteomic analysis of human cilia: identification of novel components. Mol Cell Proteomics. 2002;1(6):451–465. [PubMed]
53. Liu Q, Tan G, Levenkova N, Li T, Pugh EN, Jr, Rux JJ, Speicher DW, Pierce EA. The proteome of the mouse photoreceptor sensory cilium complex. Mol Cell Proteomics. 2007;6(8):1299–1317. [PMC free article] [PubMed]
54. Cheetham ME, Caplan AJ. Structure, function and evolution of DnaJ: conservation and adaptation of chaperone function. Cell Stress Chaperones. 1998;3(1):28–36. [PMC free article] [PubMed]
55. Scheufler C, Brinker A, Bourenkov G, Pegoraro S, Moroder L, Bartunik H, Hartl FU, Moarefi I. Structure of TPR domain-peptide complexes: critical elements in the assembly of the Hsp70-Hsp90 multichaperone machine. Cell. 2000;101(2):199–210. [PubMed]
56. Brychzy A, Rein T, Winklhofer KF, Hartl FU, Young JC, Obermann WM. Cofactor Tpr2 combines two TPR domains and a J domain to regulate the Hsp70/Hsp90 chaperone system. Embo J. 2003;22(14):3613–3623. [PubMed]
57. Jekely G, Arendt D. Evolution of intraflagellar transport from coated vesicles and autogenous origin of the eukaryotic cilium. Bioessays. 2006;28(2):191–198. [PubMed]
58. Bukau B, Weissman J, Horwich A. Molecular chaperones and protein quality control. Cell. 2006;125(3):443–451. [PubMed]
59. Vogel M, Bukau B, Mayer MP. Allosteric regulation of Hsp70 chaperones by a proline switch. Mol Cell. 2006;21(3):359–367. [PubMed]
60. Horst M, Oppliger W, Rospert S, Schonfeld HJ, Schatz G, Azem A. Sequential action of two hsp70 complexes during protein import into mitochondria. Embo J. 1997;16(8):1842–1849. [PubMed]
61. Liu Q, D'Silva P, Walter W, Marszalek J, Craig EA. Regulated cycling of mitochondrial Hsp70 at the protein import channel. Science. 2003;300(5616):139–141. [PubMed]
62. Xiao J, Kim LS, Graham TR. Dissection of Swa2p/auxilin domain requirements for cochaperoning Hsp70 clathrin-uncoating activity in vivo. Mol Biol Cell. 2006;17(7):3281–3290. [PMC free article] [PubMed]
63. Chang HC, Hull M, Mellman I. The J-domain protein Rme-8 interacts with Hsc70 to control clathrin-dependent endocytosis in Drosophila. J Cell Biol. 2004;164(7):1055–1064. [PMC free article] [PubMed]
64. Tsai MY, Morfini G, Szebenyi G, Brady ST. Release of kinesin from vesicles by hsc70 and regulation of fast axonal transport. Mol Biol Cell. 2000;11(6):2161–2173. [PMC free article] [PubMed]
65. Qin HM, Rosenbaum JL, Barr MM. An autosomal recessive polycystic kidney disease gene homolog is involved in intraflagellar transport in C-elegans ciliated sensory neurons. Curr Biol. 2001;11(6):457–461. [PubMed]
66. Pazour GJ, San Agustin JT, Follit JA, Rosenbaum JL, Witman GB. Polycystin-2 localizes to kidney cilia and the ciliary level is elevated in orpk mice with polycystic kidney disease. Curr Biol. 2002;12(11):R378–380. [PubMed]
67. Bae YK, Qin H, Knobel KM, Hu J, Rosenbaum JL, Barr MM. General and cell-type specific mechanisms target TRPP2/PKD-2 to cilia. Development. 2006;133(19):3859–3870. [PubMed]
68. Follit JA, Tuft RA, Fogarty KE, Pazour GJ. The intraflagellar transport protein IFT20 is associated with the Golgi complex and is required for cilia assembly. Mol Biol Cell. 2006;17(9):3781–3792. [PMC free article] [PubMed]
69. Jenkins PM, Hurd TW, Zhang L, McEwen DP, Brown RL, Margolis B, Verhey KJ, Martens JR. Ciliary targeting of olfactory CNG channels requires the CNGB1b subunit and the kinesin-2 motor protein, KIF17. Curr Biol. 2006;16(12):1211–1216. [PubMed]
70. Corbit KC, Aanstad P, Singla V, Norman AR, Stainier DY, Reiter JF. Vertebrate Smoothened functions at the primary cilium. Nature. 2005;437(7061):1018–1021. [PubMed]
71. Qin H, Burnette DT, Bae YK, Forscher P, Barr MM, Rosenbaum JL. Intraflagellar transport is required for the vectorial movement of TRPV channels in the ciliary membrane. Curr Biol. 2005;15(18):1695–1699. [PubMed]
72. Dryja TP. Doyne Lecture. Rhodopsin and autosomal dominant retinitis pigmentosa. Eye. 1992;6(Pt 1):1–10. [PubMed]
73. Sung CH, Tai SW. Rhodopsin trafficking and its role in retinal dystrophies. IntRevCytol. 2000;195:215–267. [PubMed]
74. Cremers FP, van den Hurk JA, den Hollander AI. Molecular genetics of Leber congenital amaurosis. Hum Mol Genet. 2002;11(10):1169–1176. [PubMed]
75. Booij JC, Florijn RJ, ten Brink JB, Loves W, Meire F, van Schooneveld MJ, de Jong PT, Bergen AA. Identification of mutations in the AIPL1, CRB1, GUCY2D, RPE65, and RPGRIP1 genes in patients with juvenile retinitis pigmentosa. J Med Genet. 2005;42(11):e67. [PMC free article] [PubMed]
76. Baehr W, Karan S, Maeda T, Luo DG, Li S, Bronson JD, Watt CB, Yau KW, Frederick JM, Palczewski K. The function of guanylate cyclase 1 and guanylate cyclase 2 in rod and cone photoreceptors. J Biol Chem. 2007;282(12):8837–8847. [PMC free article] [PubMed]
77. Horst CJ, Johnson LV, Besharse JC. A 425 kd glycoconjugate restricted to the photoreceptor connecting cilium is also found at the motile cilium transition zone. InvestOphthalmolVisSci(Suppl) 1989;30:157.
78. Guan KL, Dixon JE. Eukaryotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase. Anal Biochem. 1991;192(2):262–267. [PubMed]
79. Aslanukov A, Bhowmick R, Guruju M, Oswald J, Raz D, Bush RA, Sieving PA, Lu X, Bock CB, Ferreira PA. RanBP2 modulates Cox11 and hexokinase I activities and haploinsufficiency of RanBP2 causes deficits in glucose metabolism. PLoS Genet. 2006;2(10):e177. [PMC free article] [PubMed]
80. Horst CJ, Forestner DM, Besharse JC. Cytoskeletal-membrane interactions: a stable interaction between cell surface glycoconjugates and doublet microtubules of the photoreceptor connecting cilium. JCell Biol. 1987;105:2973–2987. [PMC free article] [PubMed]
81. Shevchenko A, Wilm M, Vorm O, Mann M. Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal Chem. 1996;68(5):850–858. [PubMed]
82. Sambrook J, Russell D. Molecular Cloning: A Laboratory Manual. Third. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 2001.
83. Pazour GJ, Dickert BL, Vucica Y, Seeley ES, Rosenbaum JL, Witman GB, Cole DG. Chlamydomonas IFT88 and its mouse homologue, polycystic kidney disease gene tg737, are required for assembly of cilia and flagella. J Cell Biol. 2000;151(3):709–718. [PMC free article] [PubMed]