PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Biochim Biophys Acta. Author manuscript; available in PMC 2011 February 1.
Published in final edited form as:
PMCID: PMC2818386
NIHMSID: NIHMS156608

Interactions of oxidosqualene cyclase (Erg7p) with 3-keto reductase (Erg27p) and other enzymes of sterol biosynthesis in yeast

SUMMARY

In Saccharomyces cerevisiae and Candida albicans, two enzymes of the ergosterol biosynthetic pathway, oxidosqualene cyclase (Erg7p) and 3-keto reductase (Erg27p) interact such that loss of the 3-keto reductase also results in a concomitant loss of activity of the upstream oxidosqualene cyclase. This interaction wherein Erg27p has a stabilizing effect on Erg7p was examined to determine whether Erg7p reciprocally has a protective effect on Erg27p. To this aim, three yeast strains each lacking the ERG7 gene were tested for 3-ketoreductase activity by incubating either cells or cell homogenates with unlabeled and radiolabeled 3-ketosteroids. In these experiments, the ketone substrates were effectively reduced to the corresponding alcohols, providing definitive evidence that oxidosqualene cyclase is not required for the 3-ketoreductase activity. This suggests that, in S. cerevisiae, the protective relationship between the 3-keto reductase (Erg27p) and oxidosqualene cyclase (Erg7p) is not reciprocal. However, the absence of the Erg7p, appears to affect other enzymes of sterol biosynthesis downstream of lanosterol formation. Following incubation with radiolabeled and non-radiolabeled 3-ketosteroids we detected differences in hydroxysteroid accumulation and ergosterol production between wild-type and ERG7 mutant strains. We suggest that oxidosqualene cyclase affects Erg25p (C-4 sterol oxidase) and/or Erg26p (C-3 sterol dehydrogenase/C-4 decarboxylase), two enzymes that, in conjunction with Erg27p are involved in C-4 sterol demethylation.

Keywords: Saccharomyces cerevisiae, Ergosterol, Erg7, Erg27, 3-keto reductase, oxidosqualene cyclase, protein-protein interactions

1. Introduction

Sterol biosynthesis (Fig. 1) is a complex pathway in which the enzyme oxidosqualene cyclase (OSC) connects two sharply different parts: (i) the “assembly section”, a sort of assembly line, which gathers all the components required to form the open triterpene 2,3-oxidosqualene, and (ii) a “tailoring section”, which remodels the steroid-intermediates to produce the final product (cholesterol, ergosterol or phytosterols, in animal, fungal, or plant cells, respectively). For the cyclization of oxidosqualene, the critical task of the OSC enzyme is to properly fold the open triterpene oxidosqualene to generate the four membered steroid ring. Despite its structurally critical role, oxidosqualene cyclase is not considered a regulatory enzyme in sterol biosynthesis, as are HMGCoA-reductase [1,2] and squalene epoxidase [3,4]. In mammals, OSC indirectly plays a role in lipid regulatory processes owing to its ability to cyclize dioxidosqualene to 24,25-epoxylanosterol, a precursor of 24,25-epoxycholesterol which is one of the most potent naturally occurring ligand activators of the liver X receptor [5,6,7,8]. Thus, in mammals, OSC appears to interact via dioxidosqualene formation with an impressive series of regulatory processes that control lipid metabolism [8]. In yeast, interactions involving OSC are less defined although recent studies have demonstrated that OSC is not a solitary protein. The OSC enzyme directly interacts with another enzyme of sterol biosynthesis, the 3-ketosterol reductase (Erg27p), an enzyme involved in C-4 demethylation of intermediates of ergosterol biosynthesis [9,10]. In yeast cells in which the ERG27 gene is deleted, oxidosqualene cyclase (Erg7p) is inactive and thus the “tailoring section” of sterol biosynthesis, which includes the 3-ketoreductase-catalyzed step, appears to affect the step which generates the steroid nucleus. The protective effect of Erg7p by Erg27p, is only one example of protein-protein interactions in sterol biosynthesis. Mo et al. suggested that all the members of the C-4 demethylation apparatus, Erg25p, Erg26p, Erg27p and Erg28p, interact as a complex [11]. More recently, a split-ubiquitin two hybrid analysis of the ergosterol biosynthetic pathway predicted several protein-protein interactions, some of which included OSC, suggesting that the entire pathway may be organized into an enzyme complex [12].

Fig. 1
The S. cerevisiae ergosterol biosynthetic pathway from squalene to the end-product ergosterol. Compounds in bold match to the mixture of 3-ketosteroid 1, compounds in bold and underlined to the mixture of 3-ketosteroid 2. Genes in the pathway blocked ...

In the present study, we further examined the interaction between oxidosqualene cyclase (Erg7p) and 3-keto reductase (Erg27p) in yeast in order to establish whether the protective action of Erg27p toward Erg7p is reciprocal. Additionally, we investigated possible interactions of Erg7p with other enzymes of the post-squalene section of sterol biosynthesis by following the metabolic fate of radiolabeled and non-radiolabeled substrates such as 3-ketosteroids in yeast strains lacking the ERG7 gene. Our data showed that the interaction between oxidosqualene cyclase and 3-keto reductase is not reciprocal, while the absence of Erg7p affects other enzymes of the C-4 demethylation complex.

2. Materials and methods

2.1 S. cerevisiae strains and growth conditions

The genotypes of strains used in this study are listed in Table 1. The ERG7 allele in strain STY2 was disrupted by using one-step PCR deletion-disruption [13]. The primers F erg7del (5’-GCCTCTCCAGTAATGTACTGCTGTGCCCAATAACCTTACCAATAATCGTCG Tggcgggtgtcggggctggc-3’) and R erg7del (5’-GCGTATGTGTTTCATATGCCCTGCTGTACATA CCTAATGCCTTAATAGGGttgccgatttcggcctattg-3’) were used to generate a 1.5-kilobase (kb) erg7 recombinogenic DNA fragment containing HIS3 as a selectable marker and using pRS303 [14] vector as template. Bases in lowercase correspond to conserved regions flanking the HIS3 gene in the pRS303 vector, and bases in uppercase refer to upstream and downstream ERG7 sequence. The ERG7 knockout was confirmed by the sterol GC profile as well as by diagnostic PCR using a primer sequence up-stream of the ERG7 deleted sequence as well as a primer in the HIS3 gene. Strain STY32 was constructed by integrating a 2.3-kb HindIII-SpeI ERG7 DNA fragment into the multiple-cloning site of the high-copy plasmid pRS426Gal (to generate the plasmid pST8) and subsequently transforming STY2 (erg7).

Table 1
S. cerevisiae strains and plasmids used in this study. Growth conditions are reported in the Materials and methods section.

All plasmids were maintained in Escherichia coli DH5α cultured in LB medium supplemented with ampicillin (100 µg/ml). PCR reactions were performed on a Thermocycler apparatus using the Promega Taq polymerase kit.

Wild-type strains were grown to early stationary phase in YPD medium (1% yeast extract, 2% peptone, 2% glucose) at 30°C. Mutants disrupted for either ERG7 or ERG27 were supplemented with ergosterol (0.02 mg/ml). SMY8, an erg7 mutant which additionally is a heme auxotroph (hem1::TRP1) was grown aerobically in media supplemented with hemin (0.013 mg/ml). The yeast erg7 mutant STY2, that contains upc2-1, was grown aerobically as this allele allows for aerobic sterol uptake [15]. The ERG7 deletant strain GDY7 and the ERG27 deletant strain SDG115, were also able to grow under aerobic conditions, with sterol supplementation and were therefore grown aerobically. The strains STY32 and SMY8[pSM61.21], overexpressing ERG7 under control of GAL1 promoter, were grown in the presence of galactose. Transformants were grown on complete synthetic-dropout media containing 0.67% yeast nitrogen base, 2% glucose/galactose, 0.2% aminoacids and 0.5% ammonium sulphate, supplemented with ergosterol (0.02 mg/ml).

2.2 Chemicals

Buffers, culture media, cholesterol, ergosterol and bovine albumin, used as a standard for protein determination, were purchased from Sigma-Aldrich (Italy).

2.3 Radiolabeled substrates

Radiolabeled (R,S)-[2-14C]mevalonic acid (2.04 GBq/mmol) and [2-14C]acetic acid (2.04 GBq/mmol) were purchased from Amersham Pharmacia Biotech (UK).

[14C](3S)-2,3-oxidosqualene was prepared as previously reported [16]. [14C]lanosterol was prepared according to a protocol described for preparing radiolabeled oxidosqualene [16], with modifications. Briefly, 0.85 mL of a pig liver S10 preparation (25 mg protein) was incubated for 3 h at 37°C with (R,S)-[2-14C]mevalonic acid (0.5 µCi, 2.04 GBq/mmol) in 0.1 M Tris buffer (pH 7.4, final volume 1 mL) containing 0.1 mM Ketoconazole. The incubation mixture also contained Tween 80 (0.1 mg/mL), 5 mM MgCl2, 2 mM MnCl2, 30 mM nicotinamide, 1 mM ATP and a NADPH generating system (1 mM NADP+, 3 mM glucose-6-phosphate and 6 units of G-6-P dehydrogenase). The addition of ATP and the NADPH generating system was repeated at the end of the first and second h. The reaction was stopped by adding 1 mL of methanolic KOH (15% w/v) and lipids were saponified at 80°C for 30 min. The nonsaponifiable lipids were then extracted three times with 2 mL of petroleum ether and separated by TLC on silica gel plates (20×20 cm × 0.25 mm) using cyclohexane/ethyl acetate (85:15; v/v) as the developing system. The radioactive band corresponding to lanosterol was scraped off and eluted with dichloromethane. The [14C]lanosterol extract was then dried under nitrogen and dissolved in benzene. The average yield of the preparation was 0.035 µCi.

The radiolabeled substrate for the 3-ketoreductase activity assay was prepared by incubating a homogenate from an ERG27 knockout strain, SDG115, with [14C]lanosterol. Briefly, 0.85 mL of a SDG115 homogenate (40–50 mg of protein) was incubated with [14C]lanosterol (0.1 µCi) in the presence of Tween 80 (0.1 mg/mL), 1 mM ATP, 1 mM NAD+ and a NADPH generating system (described above). The incubation lasted for 16 h at 30°C with vigorous shaking. Addition of the ATP and NADPH generating system was repeated at each h for the first four h. The reaction was stopped by adding 1 mL of methanolic KOH (15% w/v), and lipids were saponified at 80°C for 30 min. The nonsaponifiable lipids were extracted three times with 2 mL of petroleum ether and separated by TLC on silica gel plates (20×20 cm ×0.25 mm) using cyclohexane/ethyl acetate (85:15; v/v). The two main radioactive chromatographic bands, designated 3-ketosteroid 1 and 2 (Rf 0.75 and 0.54, respectively) were scraped off and eluted with dichloromethane. The extracts were dried under nitrogen and each ketosteroid was dissolved in benzene.

The ketonic nature of the compounds was established by treatment with NaBH4. An aliquot (9×10−4 µCi) of each radiolabeled compound was then incubated with 5 mg of NaBH4 in 1 mL of ethanol for 30 min with magnetic stirring. The reaction was stopped by adding 1 mL of water, and the reaction mixture was extracted twice with 1 mL of petroleum ether and separated on silica gel plates using cyclohexane/ethyl acetate (85:15; v/v). The transformation yield for both 3-ketosteroid substrates, 1 and 2, was >90 % as judged by the distribution of radioactivity following chemical reduction.

2.4 Sterol accumulation in an erg7 strain grown with different sterols

The GDY7 (erg7) strain was grown overnight in YPD media supplemented with ergosterol, cholesterol, lanosterol or ergosta-7,22-diene-3-one (0.02 mg/mL). Cells were harvested and saponified for 1 h at 80°C in ethanolic KOH (25% w/v). The nonsaponifiable lipids were extracted once with one volume of n-heptane and analyzed by GC-MS. Gas-chromatographic-mass spectrometric analyses to determine sterol profiles was carried out as described [17].

2.5 Incorporation of [2-14C]acetate into cells

Sterol biosynthesis in whole yeast cells was followed by incorporation of [2-14C]acetate into nonsaponifiable lipids as described previously [18]. Briefly, washed cells (1×108 cells) were resuspended in 1 mL of fresh media, incubated with 0.1 µCi of [2-14C]acetate and shaken for 3 h at 30°C. Cells were then saponified in 1 mL of methanolic KOH (15% w/v) for 30 min at 80°C. Nonsaponifiable lipids were extracted twice with 1.5 mL of petroleum ether and separated on TLC plates (20×20 cm ×0.25 mm) using cyclohexane/ethyl acetate (85:15; v/v). Squalene, oxidosqualene, dioxidosqualene, lanosterol and ergosterol were used as references. Radioactivity in separated bands was determined using a System 200 Imaging Scanner (Hewlett-Packard, Palo Alto, CA, USA).

2.6 Erg7 and Erg27 enzyme assays with radiolabeled substrates

Cell-free homogenates were prepared as described [19]. After lysis of the yeast cell wall with lyticase, spheroplasts were homogenized with a Potter device. Proteins in the homogenate were quantified using the SIGMA Protein Assay Kit [20] with bovine serum albumin as a standard. The enzyme assay for Erg7p has been described previously [19]. Cell homogenates (1.5 mg protein) were incubated for 1 h at 35°C with [14C](3S)-2,3-oxidosqualene (4.5×10−4 µCi) and the enzymatic reaction resulting in lanosterol was terminated by adding 1 mL of methanolic KOH (15% w/v). Lipids were saponified at 80°C for 30 min and nonsaponifiable lipids were extracted with petroleum ether. Extracts were then spotted on TLC plates using cyclohexane/ethyl acetate (85:15; v/v) as the developing solvent. The conversion of labeled oxidosqualene to labeled lanosterol was quantified with a System 200 Imaging Scanner (Hewlett-Packard, Palo Alto, CA, USA).

The 3-ketoreductase (Erg27p) activity was assayed by a novel procedure in which a radiolabeled 3-ketosteroid intermediate of ergosterol biosynthesis was used as a substrate. The yeast cell homogenates (3 mg protein) were incubated with 7×10−4 µCi of either [14C]3-ketosteroid 1 or 2 in the presence of Tween 80 (0.1 mg/mL), 1 mM ATP and an NADPH generating system (indicated above) in 0.1 M Tris (pH 7.4, final volume 0.5 mL) buffer containing 5 mM MgCl2, 2 mM MnCl2, 30 mM nicotinamide, for 3 h at 30°C with vigorous shaking. The reaction was terminated by adding 1 mL of methanolic KOH (15% w/v), and lipids were saponified at 80°C for 30 min. The nonsaponifiable lipids were extracted twice with 1.5 mL of petroleum ether and spotted on TLC plates using cyclohexane/ethyl acetate (85:15; v/v) as the developing solvent. The conversion of labeled 3-ketosteroids to labeled reaction products was quantified with a System 200 Imaging Scanner (Hewlett-Packard, Palo Alto, CA, USA). Enzyme activity was expressed as a ratio of products formed/starting compound. The actual enzyme specific activity (amount of product formed/time/mg protein) could not be calculated as the specific radioactivity of the radiolabeled substrates could not be determined.

3. Results

3.1 Incubation with radiolabeled acetate and oxidosqualene

Cells of ERG7 deletant strains were incubated with radiolabeled acetate to assess possible differences in sterol profiles resulting from different strain backgrounds. As expected, all erg7 strains accumulate labeled oxido- and dioxidosqualene with the latter predominanting. In two of them, STY2 and SMY8, dioxidosqualene accounts for more than 90% of the non saponifiable lipids (Table 2). The absence of oxidosqualene cyclase activity in erg7 strains was confirmed by incubation of cell homogenates with radiolabeled oxidosqualene (Table 3). Accumulation of radioactivity into end-product ergosterol in wt and ERG7-overexpressing strains STY32 and SMY8[pSM61.21] verified the integrity of the post-squalene pathway. Surprisingly, in the STY32 strain oxido- and dioxidosqualene also accumulate. However, oxidosqualene cyclase activity detected in the homogenate prepared from this strain is comparable to that measured in both wt and the other ERG7-overexpressing strains (Table 3).

Table 2
Incorporation of [14C]acetate into nonsaponifiable lipid fraction
Table 3
Erg7p specific activity in homogenates

3.2 Sterol accumulation in an erg7 strain grown with ergosta-7,22-diene-3-one

We initially approached the question of the effect of the absence of Erg7p on 3-ketosterol reductase (Erg27p) activity by growing an ERG7 deletant strain (GDY7) with ergosta-7,22-diene-3-one, a substrate of Erg27p. In parallel, cells were grown separately with cholesterol, ergosterol or lanosterol. As expected, cells accumulated oxy- and dioxysqualene regardless of the sterol added to the growth medium. In cells incubated with ergosta-7,22-diene-3-one, 75% of this sterone was converted to ergosta-7,22-diene-3-ol, clearly indicating that the 3-ketoreductase enzyme was active in the absence of oxidosqualene cyclase. The observation that more than half of the total sterol was end-product ergosterol in the same ketone-fed cells clearly suggests that not only was ergosta-7,22-diene-3-one actively reduced to the corresponding alcohol, but also the latter was converted to end-product ergosterol (Table 4).

Table 4
GC profiles of GDY7 (erg7) strain grown in presence of various sterols

3.3 Preparation and characterization of the radiolabeled physiological substrates of 3-ketosterol reductase

A problem we initially encountered was the preparation of a proper radiolabeled substrate for determining 3-ketosterol reductase activity as no radiolabeled 3-ketosteroid is commercialy available. Since our aim was to test Erg27p activity with authentic keto-intermediates of ergosterol biosynthesis, we prepared biological relevant substrates using a yeast strain lacking ERG27. However, since an erg27 strain is unable to cyclize oxidosqualene [21,9], we could not generate ketosteroid intermediates by incubating cells with radiolabeled mevalonate or acetate. Therefore, we employed a SDG115 (erg27) cell-free system incubated with radiolabeled lanosterol, an intermediate downstream of oxidosqualene cyclase. Incubation with labeled lanosterol gave two steroids designated ketosteroid 1 and 2 (Fig. 2), which were identified as keto compounds by treatment with NaBH4 (Fig. 3).

Fig. 2
Synthesis of 3-ketosteroids. Radiochromatogram of non-saponifiable lipids extracted from cell homogenates of strain SDG115 (erg27) incubated with radiolabeled lanosterol. Lanosterol (peak a) was converted into 3-ketosteroid 1 (peak c) and 3-ketosteroid ...
Fig. 3
Chemical reduction of [14C]3-ketosteroid 1 with NaBH4. Radiochromatogram of the compounds resulting from reduction of 3-ketosteroid 1 with excess NaBH4 (see Exp. Section). Peak c is 3-ketosteroid 1, peak a is the β-hydroxy derivative of 3-ketosteroid ...

Both radiolabeled compounds gave more polar derivatives on a TLC plate as expected when alcohol derivatives are formed from treating ketone compounds with NaBH4. From 3-ketosteroid compound 1, two more polar compounds (Rf 0.62 and 0.39) were formed, presumably corresponding to α- and β-hydroxy derivatives resulting from the reduction of the keto group of the starting radiolabeled compound. The alpha and beta configurations at C-3 could be attributed by both chemical and biochemical observations. In steroids, due to the chair conformation of ring A, the alpha and beta bonds at C-3 are oriented axial and equatorial, respectively. Since a bulky hydroxyl-substituent at C-3 will preferably adopt the equatorial orientation, the beta configuration should predominate in the alpha/beta mixture that results from the reduction of the corresponding 3-keto compound. The compound bearing the beta-equatorial hydroxyl group should be more polar (with a lower Rf value on TLC silica gel plates), as the polar substituent is more exposed to the solvent than the alpha-axial hydroxyl group. We therefore attributed the beta configuration to the more abundant and more polar compound reported in Fig. 3. This attribution was confirmed by comparing the chemical (alpha/beta-generating) and biochemical (solely beta-generating) reduction of the intermediate ketosteroid 1 (Fig. 4A). The 3-ketosteroid compound 2, treated with NaBH4, gave a unique even more polar compound (Rf 0.27), which was presumably a mixture of α- and β –hydroxyderivatives indistinguishable by TLC.

Fig. 4
Incubation of homogenates from the erg7 strain SMY8 (Radiochromatogram A) and the ERG7-overexpressing strain SMY8[pSM61.21] (Radiochromatogram B) with [14C]3-ketosteroid 1. In A, the 3-ketosteroid 1 (peak b) was transformed only into the 3-hydroxy derivative ...

To further characterize these radiolabeled products, a small amount (approx. 0.05 mg) of non-radioactive 3-ketosteroids 1 and 2 was prepared by incubating the cell homogenate with non radioactive lanosterol under similar conditions. Chromatographic bands corresponding to 3-ketosteroid 1 and 2 were scraped off, extracted, and analyzed by GC-MS: 3-ketosteroid 1 gave two major peaks identified as 4-methylzymosterone and 4-methylfecosterone + 4-methylepisterone (both in one huge GLC peak); 3-ketosteroid 2 gave three peaks identified as zymosterone, ergosta-7,22-diene-3-one and episterone. Some of these 3-ketosteroids have been previously identified by GLC-MS in another erg27 strain (SDG110) [21]. As expected, the main structural difference between the mixtures referred to as ketosteroid 1 and ketosteroid 2 is the presence of a methyl group at C-4, that explains the different TLC behaviour: the less polar methyl-bearing compounds (“ketosteroid 1”) have a higher Rf value on TLC than “ketosteroid 2” (Fig. 2).

Thus, GLC-MS analysis revealed that all unlabeled compounds co-chromatographing on TLC with radiolabeled ketosteroid 1 and 2 were ketone compounds. This confirmed that the radiolabeled compounds called ketosteroid 1 and 2 are actually keto intermediates of ergosterol biosynthesis and can be properly used as radiolabeled substrates to test the activity of 3-ketosterol reductase.

3.4 Incubation of homogenates from cells lacking the ERG7 gene with radiolabeled 3-ketosteroids

To evaluate the effect of the absence of oxidosqualene cyclase (Erg7p) on 3-ketosterol reductase (Erg27p) activity, three yeast strains lacking the ERG7 gene were compared to a wild-type strain and strains overexpressing ERG7. Homogenates from all strains were incubated aerobically with radiolabeled 3-ketosteroids 1 and 2 under conditions indicated in Materials and Methods. In both erg7 mutant and ERG7 (wild-type and overexpressing) strains, sterone substrates 1 and 2 were effectively transformed into more polar compounds, which were likely to be the corresponding alcohols (Fig. 4 and and5;5; Table 5 and and6).6). The alcoholic nature of the products formed was inferred by comparing their chromatographic behaviour with those of compounds obtained by treating radiolabeled sterones 1 and 2 with NaBH4. The biological reduction gave compounds co-chromatographing with those obtained from chemical reduction. Particularly, enzymatic reduction of sterone 1 resulted in a compound that co-chromatographed with the more polar (beta-hydroxy substituent) which resulted from chemical reduction. In experiments with radiolabeled 3-ketosteroid 1 as the substrate, we observed a strong difference between erg7 and ERG7 strains. In the homogenates from the erg7 strains, the 3-hydroxy product of the 3-ketoreductase activity was no longer transformed to the end-product ergosterol (Fig. 4; Table 5), whereas in both wild-type and overexpressing strains, ergosterol was synthesized. To reinforce the results and conclusions obtained from radiolabeling experiments and confirm the chemical identity of the products formed by enzymatic reduction of ketosteroid 1, parallel experiments with non radioactive ketosteroid 1 were performed. GLC analysis of the chromatographic band recovered from the experiments with “ketosteroid 1” revealed the presence of a mixture of methylzymosterol and methylfecosterol. With radiolabeled 3-ketosteroid 2, the difference between erg7 and ERG7 strains could not be determined as the transformation product of the sterone substrate co-localized with ergosterol on TLC plates (Fig. 5; Table 6).

Fig. 5
Radiochromatogram of non-saponifiable lipids extracted from cell homogenates of the ERG7-overexpressing strain SMY8[pSM61.21] incubated with [14C]3-ketosteroid 2. 3-ketosteroid 2 (peak b) was converted into 3-hydroxyderivate (peak a), which was indistinguishable ...
Table 5
Incubation of homogenates with [14C]3-ketosteroid 1
Table 6
Incubation of homogenates with [14C]3-ketosteroid 2

4. Discussion

In the present study, we demonstrated that the strong interaction between Erg7p and Erg27p in yeast is not reciprocal in that the requirement of Erg27p for oxidosqualene cyclase (Erg7p) activity is absolute [8], whereas Erg27p activity is independent of the Erg7p: the 3-ketosterol reductase (Erg27p) in strains lacking Erg7p is as active as in the wild-type strain. The absence of oxidosqualene cyclase, however, seems to greatly affect the functionality of several other enzymes in the post-squalene biosynthetic pathway. The following evidence supports this conclusion: when homogenates prepared from erg7 strains were incubated with one of the radiolabeled sterone substrates (3-ketosteroid 1), the post-squalene enzyme apparatus was unable to synthesize end-product ergosterol. Conversely, all control strains, either wild-type or ERG7-overexpressing strains, were able to convert radiolabeled ketosteroid 1 to ergosterol. These experiments do not allow us to unambiguously identify the enzyme(s) affected by the absence of oxidosqualene cyclase but suggest that the inability to synthesize oxidosqualene results in an inability to convert downstream sterol products. However, comparison between experiments with non radioactive ergosta-7,22,diene-3-one (section 3.2) and experiments with both radiolabeled and non-radiolabeled ketosteroid 1 strongly narrows the possible enzymes putatively affected by the absence of Erg7p. While the ERG7 deletant strains cannot carry out the transformation of ketosteroid 1 (actually, a mixture of monomethylsterones) beyond the reduction to the corresponding alcohol(s), one of these strains, incubated with nonradioactive ergosta-7,22,diene-3-one (a 4,4-desmethylsterone), not only reduces it to the hydroxy derivative but also converts the sterol intermediate to ergosterol. These results suggest that Erg6p, Erg3p and Erg4p, the enzymes required to bridge the gap that separates ergosta-7,22-diene-3-ol from ergosterol, are active in an erg7 strain. Thus, the enzymatic block that prevents radiolabeled ketosteroid 1 from further downstream conversions, beyond its reduction to the alcohol, seems to be the presence of the methyl group at C-4.

Therefore, we suggest that the inability of the erg7 deletant strains to form ergosterol from monomethyl intermediates of sterol biosynthesis depends on the loss of funtionality of the C-4 demethylation complex in the absence of Erg7p. This complex is made up of three enzymes, Erg25p, Erg26p, and Erg27p, which are involved in the removal of the C-4 methyl groups from 4,4-dimethylzymosterol. This complex requires a transmembrane scaffold protein, Erg28p, which anchors the enzymes to the endoplasmic reticulum. The evidence suggested in this study indicates that Erg27 activity does not require the presence of the Erg7p whereas either Erg25p (C-4 sterol oxidase), Erg26p (C-3 sterol dehydrogenase/C-4 decarboxylase) or both may be negatively affected by the absence of Erg7p. We cannot exclude the possibility that deletion of ERG7 has a negative effect on the ability of Erg28p to function as a scaffold protein of the C-4 demethylation complex.

In a recent study using the split-ubiquitin membrane protein yeast two-hybrid system, an interaction between Erg7p and three components of the complex, Erg25p, Erg27p and Erg28p, was predicted [12]. Our previous [9,10] and present results confirm this prediction, suggesting a subtle bidirectional relationship between Erg7p and the C-4 demethylation apparatus. The bidirectional control mechanism between the demethylation complex and oxidosqualene cyclase can be depicted as follows: the complex, formed by Erg25p, Erg26p, Erg27p and Erg28p, controls the functionality of oxidosqualene cyclase through a direct chaperone-like action of Erg27p toward Erg7p, and additionally, oxidosqualene cyclase controls the functionality of the complex by interacting with component(s) other than Erg27p. Whether the loss of Erg7p affects the stability of Erg25p, Erg26p or Erg28p remains to be established and will require future studies.

These findings lead us to speculate regarding possible novel roles of oxidosqualene cyclase(s) in the regulation of sterol biosynthesis. The C-4 demethylation complex catalyzes the reactions of the highest oxygen-consuming step of sterol biosynthesis, and is thought to play a specific role in oxygen sensing in eukaryotes [22]. Unravelling the interaction between enzymes of the C-4 demethylation complex and oxidosqualene cyclase (as well as other enzymes of sterol biosynthesis) may help to clarify mechanisms of adaptation to low oxygen levels, a condition that yeast cells share with many human cancer cells which are able to survive in oxygen starved tumors. An additional reason to further explore the interaction between oxidosqualene cyclase and the C-4 demethylation complex lies in the close link between the deficiency of one of the enzymes of this complex and the CHILD syndrome, a severe disorder of cholesterol biosynthesis [23].

Acknowledgments

We thank Drs. G. Daum and S.P.T. Matsuda for providing some of the yeast mutant strains. This investigation was supported by University of Turin and the regional government (Regione Piemonte, Italy) to G. B. and by a National Institutes of Health Grant GM62104 to M. B.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

1. Lehoux JG, Lefebvre A, Bélisle S, Bellabarba D. On the control of HMG-CoA reductase, a key regulatory enzyme of adrenal cholesterol synthesis. J. Steroid Biochem. 1986;24:325–329. [PubMed]
2. Goldstein JL, Brown MS. Regulation of the mevalonate pathway. Nature. 1990;343:425–430. [PubMed]
3. Satoh T, Hidaka Y, Kamei T. Regulation of squalene epoxide activity in rat liver. J. Lipid Res. 1990;31:2095–2101. [PubMed]
4. Leber R, Landl K, Zinser E, Ahorn H, Spök A, Kohlwein SD, Turnowsky F, Daum G. Dual Localization of Squalene Epoxidase, Erg1p, in Yeast Reflects a Relationship between the Endoplasmic Reticulum and Lipid Particles. Mol. Biol. Cell. 1998;9:375–386. [PMC free article] [PubMed]
5. Nelson JA, Steckbeck SR, Spencer TA. Biosynthesis of 24,25-epoxycholesterol from squalene 2,3;22,23-dioxide. J. Biol. Chem. 1981;256:1067–1068. [PubMed]
6. Boutaud O, Dolis D, Schuber F. Preferential cyclization of 2,3(S):22(S),23- dioxidosqualene by mammalian 2,3-oxidosqualene-lanosterol cyclase. Biochem. Biophys. Res. Commun. 1992;188:898–904. [PubMed]
7. Rowe AH, Argmann CA, Edwards JY, Sawyez CG, Morand OH, Hegele RA, Huff MW. Enhanced synthesis of the oxysterol 24(S),25-epoxycholesterol in macrophages by inhibitors of 2,3-oxidosqualene:lanosterol cyclase: a novel mechanism for the attenuation of foam cell formation. Circ. Res. 2003;93:717–725. [PubMed]
8. Huff MW, Telford DE. Lord of the rings – the mechanism for oxidosqualene:lanosterol cyclase becomes crystal clear. TRENDS Pharmacol Sci. 2005;26:335–340. [PubMed]
9. Mo C, Milla P, Athenstaedt K, Ott R, Balliano G, Daum G, Bard M. In yeast sterol biosynthesis the 3-keto reductase protein (Erg27p) is required for oxidosqualene cyclase (Erg7p) activity. Biochim. Biophys. Acta. 2003;1633:68–74. [PubMed]
10. Teske B, Taramino S, Bhuiyan MSA, Kumaraswami NS, Randall SK, Barbuch R, Eckstein J, Balliano G, Bard M. Genetic analyses involving interactions between the ergosterol biosynthetic enzymes, lanosterol synthase (Erg7p) and 3-ketoreductase (Erg27p), in the yeast Saccharomyces cerevisiae. Biochim. Biophys. Acta. 2008;1781:359–366. [PMC free article] [PubMed]
11. Mo C, Valachovic M, Randall SK, Nickels JT, Bard M. Protein-protein interactions among C-4 demethylation enzymes involved in yeast sterol biosynthesis. Proc. Natl. Acad. Sci. USA. 2002;99:9739–9744. [PubMed]
12. Mo C, Bard M. A systematic study of yeast sterol biosynthetic protein-protein interactions using the split-ubiquitin system. Biochim. Biophys. Acta. 2005;1737:152–160. [PubMed]
13. Baudin A, Ozier-Kalogeropoulos O, Denouel A, Lacroute F, Cullin C. A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucleic Acids Res. 1993;21:3329–3330. [PMC free article] [PubMed]
14. Sikorski RS, Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 1989;122:19–27. [PubMed]
15. Wilcox LJ, Balderes DA, Wharton B, Tinkelenberg AH, Rao G, Sturley SL. Transcriptional Profiling Identifies Two Members of the ATP-binding Cassette Transporter Superfamily Required for Sterol Uptake in Yeast. J. Biol. Chem. 2002;227:32466–32472. [PubMed]
16. Milla P, Athenstaedt K, Viola F, Oliaro-Bosso S, Kohlwein SD, Daum G, Balliano G. Yeast Oxidosqualene Cyclase (Erg7p) Is a Major Component of Lipid Particles. J. Biol. Chem. 2002;277:2406–2412. [PubMed]
17. Gachotte D, Eckstein J, Barbuch R, Hughes T, Roberts C, Bard M. A novel gene conserved from yeast to humans is involved in sterol biosynthesis. J. Lipid Res. 2001;42:150–154. [PubMed]
18. Balliano G, Viola F, Ceruti M, Cattel L. Inhibition of sterol biosynthesis in Saccharomyces cerevisiae by N,N-diethylazasqualene and derivatives. Biochim. Biophys. Acta. 1988;959:9–19. [PubMed]
19. Oliaro-Bosso S, Viola F, Matsuda SPT, Cravotto G, Tagliapietra S, Balliano G. Umbelliferone aminoalkyl derivatives as inhibitors of oxidosqualene cyclases from Saccharomyces cerevisiae, Trypanosoma cruzi, and Pneumocystis carinii. Lipids. 2004;39:1007–1012. [PubMed]
20. Peterson GL. Anal. Biochem. 1977;83:346–356. [PubMed]
21. Gachotte D, Sen SE, Eckstein J, Barbuch R, Krieger M, Ray BD, Bard M. Characterization of the Saccharomyces cerevisiae ERG27 gene encoding the 3-keto reductase involved in C-4 sterol demethylation. Proc. Natl. Acad. Sci. USA. 1999;96:12655–12660. [PubMed]
22. Todd BL, Stewart EV, Burg JS, Hughes AL, Espenshade PJ. Sterol Regulatory Element Binding Protein Is a Principal Regulator of Anaerobic Gene Expression in Fission Yeast. Mol Cell Biol. 2006;26:2817–2831. [PMC free article] [PubMed]
23. Waterham HR. Defects in cholesterol biosynthesis. FEBS Letters. 2006;580:5442–5449. [PubMed]