PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jvirolPermissionsJournals.ASM.orgJournalJV ArticleJournal InfoAuthorsReviewers
 
J Virol. 2010 February; 84(4): 1847–1855.
Published online 2009 November 25. doi:  10.1128/JVI.01317-09
PMCID: PMC2812357

Immunization with Live Attenuated Influenza Viruses That Express Altered NS1 Proteins Results in Potent and Protective Memory CD8+ T-Cell Responses[down-pointing small open triangle]

Abstract

The generation of vaccines that induce long-lived protective immunity against influenza virus infections remains a challenging goal. Ideally, vaccines should elicit effective humoral and cellular immunity to protect an individual from infection or disease. Cross-reactive T- and B-cell responses that are elicited by live virus infections may provide such broad protection. Optimal induction of T-cell responses involves the action of type I interferons (IFN-I). Influenza virus expressed nonstructural protein 1 (NS1) functions as an inhibitor of IFN-I and promotes viral growth. We wanted to examine the priming of CD8+ T-cell responses to influenza virus in the absence of this inhibition of IFN-I production. We generated recombinant mouse-adapted influenza A/PR/8/34 viruses with NS1 truncations and/or deletions that also express the gp33-41 epitope from lymphocytic choriomeningitis virus. Intranasal infection of mice with the attenuated viruses primed long-lived T- and B-cell responses despite significantly reduced viral replication in the lungs compared to wild-type virus. Antigen-specific CD8+ T cells expanded upon rechallenge and generated increased protective memory T-cell populations after boosting. These results show that live attenuated influenza viruses expressing truncated NS1 proteins can prime protective immunity and may have implications for the design of novel modified live influenza virus vaccines.

Influenza virus infections remain an important global health issue, particularly among the young and elderly. The natural host of influenza viruses is water birds, however, influenza viruses can also infect a wide variety of other hosts, including other birds, humans and pigs (36). The ability of influenza viruses to survive and adapt in different hosts has precipitated three human pandemics in the last century alone (in 1918 [H1N1], 1957 [H2N2], and 1968 [H3N2]), as well as numerous epidemics, including the recent H1N1 swine influenza outbreak (12). Despite our increasing understanding of influenza viruses, their life cycle, pathogenicity, and immunogenicity, the production of vaccines that generate long-lived cross-protective immunity against seasonal strains or pandemic strains of the virus remains a challenging goal (5).

An effective vaccine against influenza should ideally elicit both humoral and cellular immunity. Current inactivated influenza virus vaccines induce largely antibody-mediated responses that are effective in providing protection against homologous influenza virus infections and yet are inadequate against heterologous infections, where many of the viral proteins are distinct (3, 31). Influenza virus causes repeated infections by undergoing antigenic drift and occasionally antigenic shift to evade the host immune response. Neutralizing antibodies against the viral glycoproteins hemagglutinin (HA) and neuraminidase (NA) are required for resistance against respiratory infection, potentially by slowing the rate of viral replication and spread to allow time for the cellular immune response to mediate viral clearance (7). Indeed, protective cell-mediated immunity to virulent influenza virus infection requires CD8+ T cells (4), and these may need to reside in the respiratory tract to control initial viral replication until secondary effectors arrive (38).

Interestingly, influenza viruses can still cause disease in immune individuals despite the high conservation of T-cell epitopes, suggesting that the virus may also use mechanisms to subvert the immune system. The nonstructural (NS1) protein of influenza virus is a virulence factor with multiple functions in infected cells. In addition to potentially controlling viral RNA replication (9) and viral protein synthesis (18), one of the major functions of the NS1 protein is the inhibition of host interferon (IFN) responses (14). This can occur via inhibition of the IRF-3, NF-κB, and c-Jun/ATF-2 transcription factors (16, 32), possibly by preventing intracellular sensing of viral single-stranded RNA by preventing RIG-I activation (13, 27). The NS1 protein can also block the function of 2′-5′-oligoadenylate synthetase and serine/threonine protein kinase R (25, 26), as well as inhibit host mRNA processing and activate the phosphatidylinositol 3-kinase pathway (15), thus potentially influencing multiple aspects of innate immune activation and apoptosis in infected host cells.

Type I IFNs (IFN-I) are produced by infected or activated cells during viral infection. Some specialized cell types, such as plasmacytoid DC, are capable of producing very large amounts of IFN-I. The optimal priming of both CD8+ and CD4+ T-cell responses involves direct signaling through the IFN-I receptor (IFN-IR) (8, 19, 24). T cells lacking the IFN-IR show reduced expansion and memory formation after infection. It has been demonstrated that expression of the NS1 protein by influenza viruses can significantly reduce the production of inflammatory cytokines after infection (21), as well as increase pathogenicity in a manner independent of its IFN-I blocking action (22). Viruses lacking NS1 function are highly attenuated and may be useful for the design of new generation influenza virus vaccines (32). In the absence of NS1, or in virus mutants with truncated NS1 proteins, influenza viruses can induce adaptive immune responses in different animal models, such as mice, pigs, and macaques (2, 10, 29, 33) and stimulate more effective dendritic cell maturation and migration (11).

To better understand the capacity of mutant influenza viruses with compromised NS1 function to elicit protective cell-mediated immune responses, in particular CD8+ T-cell responses, we inserted the lymphocytic choriomeningitis virus (LCMV) gp33-41 epitope into the influenza virus A/PR/8/34 NA stalk. Using reverse genetics, this segment was incorporated into recombinant influenza viruses that expressed truncated NS1 proteins or lacked expression of NS1 via a complete deletion. These mutant viruses displayed reduced viral growth and pathology in mice after intranasal infection and yet generated long-lived antigen-specific T- and B-cell responses. Responses were readily detectable both systemically and in the lungs after infection. Mice containing effector or memory CD8+ T cells primed by the live attenuated viruses cleared virus more rapidly after rechallenge, whereas prime-boost vaccination could further expand the size of the memory pool generated. Together, our data suggest that NS1 mutant viruses might provide a safe and effective means of generating potent cellular and humoral immune responses against influenza viruses.

MATERIALS AND METHODS

Generation of recombinant influenza viruses.

Recombinant influenza viruses were produced by using an established eight-plasmid influenza virus reverse genetics system (20, 28). The plasmids used in the construction of the recombinant influenza viruses have been previously described (35). The LCMV gp33-41 epitope (KAVYNFATM) was inserted into the NA of A/PR/8/34 (H1N1) at residue 42 by PCR mutagenesis using the primers 5′-CAAACTGGAAGTAAAGCCGTTTATAATTTTGCCACCATGAACATCATTACC-3′ and 5′-GGTAATGATGTTCATGGTGGCAAAATTATAAACGGCTTTACTTCCAGTTTG-3′ (italics represent the inserted KAVYNFATM epitope). A corresponding number of amino acids (nine, QNHTGICNQ) were deleted from the recombinant viruses to maintain the protein length equal to the wild-type NA protein. In order to generate NS1 truncations, we pursued a previous strategy described by Solorzano et al. (30). We generated every NS1 truncation by amplification of two PCR fragments and subsequent ligation in the pDZ vector (28): the 5′-end portion of the segment, common for all truncations, was obtained with two primers, 5′-GCGCTTAATTAAGAGGGAGCAATTGTTGGCG-3′ (NS1-153) and 5′-CATCGCTCTTCTATTAGTAGAAACAAGGGTGTTTTTTATTATTAAATAAG-3′. The 3′-end portion containing either the first 73, 113, or 126 amino acids of NS1 was obtained by using the primers 5′-GCGCTTAATTAATCAAGATCTAGGATTCTTCTTTCAGAATCC-3′ (NS1-73), 5′-GCGCTTAATTAATCAAGATCTAGCCTGCCACTTTCTGCTTGGG-3′ (NS1-113), and 5′-GCGCTTAATTAATCAAGATCTACTTATCCATGATCGCCTGG-3′ (NS1-126), respectively, together with 5′-GATCGCTCTTCTGGGAGCAAAAGCAGGGTGACAAAGAC-3′. NS1 truncations did not affect the sequence of NEP. To generate the NS segment containing a complete deletion of NS1, we amplified NEP by two PCRs using two pairs of primers: (i) NS1-BspMI,3 (GCGCACCTGCTTTTTCAGGACATACTGCTGAGGATG and 5′-GATCGCTCTTCTGGGAGCAAAAGCAGGGTGACAAAGAC-3′) and (ii) NS1-BspMI,5 (GCGCACCTGCTTTTCTGAAAGCTTGACACAGTG and 5′-CATCGCTCTTCTATTAGTAGAAACAAGGGTGTTTTTTATTATTAAATAAG-3′).

Mice, virus, and infections.

Thy1.1+ (B6.PL-Thy1a/CyJ) mice were bred to P14 transgenic mice and maintained in our colony. Splenocytes from naive Thy1.1+ P14 transgenic mice containing 105 antigen-specific CD8+ T cells were transferred into 6-week-old female C57BL/6J (B6) mice (the Jackson Laboratory). Given a “take” of ca. 10%, this transfer reflected ~104 P14 CD8+ T cells per recipient mouse. The following day, the mice were infected with 200 PFU of recombinant influenza virus PR8-33 (referred to as PR8 or wild-type [WT] virus) or either of the NS1 mutant viruses (NS1-73, NS1-113, NS1-126, or ΔNS1) intranasally. For challenge experiments, mice were infected with 5 × 106 PFU of a recombinant vaccinia virus expressing gp33-41 (VVgp33) (17) intranasally. Titers of VVgp33 in lung homogenates were determined by plaque assay on Vero cells as previously described (17). Influenza virus titers were determined by using monolayers of Madin-Darby canine kidney (MDCK) cells. MDCK cells were infected with dilutions of lung tissue homogenates in Dulbecco modified Eagle medium (DMEM) for 1 h at 37°C before they were overlaid with 1% agarose in DMEM supplemented with 5% fetal bovine serum and 1 μg of TPCK (tolylsulfonyl phenylalanyl chloromethyl ketone)-trypsin/ml. Cells were incubated for 3 days and stained with crystal violet (0.1% [wt/vol] in 20% methanol) to count plaques.

Hemagglutinin inhibition assay.

One part serum was added to three parts receptor destroying enzyme (RDE; Accurate Chemical & Scientific) and incubated at 37°C overnight. The RDE was inactivated the following morning by incubating the samples at 56°C for 1 h. Samples were then serially diluted with phosphate-buffered saline (PBS) in 96-well V-bottom plates, and eight hemagglutination units (as determined by incubation with 0.5% turkey red blood cells [RBCs] in the absence of serum) of influenza virus was added to each well. After 30 min at room temperature, 50 μl of 0.5% turkey RBCs (Lampire Biological Laboratories) suspended in PBS-0.5% bovine serum albumin was added to each well, and the plates were shaken manually. After an additional 30 min at room temperature, the serum titers were read as the reciprocal of the final dilution for which no hemagglutination was observed.

Lymphocyte isolation.

Lymphocytes were isolated from lungs by treatment with 1.3 mM EDTA in Hanks balanced salt solution for 30 min at 37°C with shaking at 200 rpm, followed by incubation with 100 U of collagenase (Invitrogen Life Technologies)/ml in 5% RPMI 1640 supplemented with 2 mM CaCl2 and 2 mM MgCl2 (60 min at 37°C, shaking at 200 rpm). Single-cell suspensions were obtained by pushing spleens, lymph nodes, or digested lungs through 70-μm-pore-size nylon mesh filters (Becton Dickinson). Lymphocytes from lungs were purified by centrifugation on a 44/67% Percoll gradient (800 × g for 20 min at 20°C).

Antibodies and flow cytometry.

Single-cell suspensions were stained with anti-CD8α-APC (53-6.7), Thy1.1-PerCP (OX-7), CD62L-FITC (MEL-14), CD43-FITC (1B11), gamma interferon (IFN-γ)-FITC (XMG1.2), tumor necrosis factor alpha (TNF-α)-APC (MP6-XT22), and interleukin-2 (IL-2)-APC (JES6-5H4) (BD Pharmingen); CD127-PE (A7R34) (eBioscience); or anti-human granzyme B-PE (Caltag Laboratories). Intracellular staining for granzyme B directly ex vivo or for IFN-γ, TNF-α, or IL-2 after 5 h in vitro stimulation with 0.1 μg of LCMV gp33-41 peptide or influenza np366-374 peptide/ml was performed by using a Cytofix/Cytoperm kit according to the manufacturer's instructions (BD Pharmingen). Samples were analyzed by using a Becton Dickinson FACSCalibur apparatus.

Memory cell transfers.

Thy1.1+ P14 transgenic CD8+ T cells were isolated from the spleens or lungs of mice infected with the indicated viruses. Naive B6 recipient mice (Thy1.2+) received 1 × 104 Thy1.1+ CD8+ memory cells to track expansion in the blood or 5 × 104 cells to measure protection upon recall with VVgp33.

Statistical analysis.

Data are expressed as the means ± the standard deviation. Statistical analysis was performed by two-tailed Student t test with 95% confidence intervals, using Prism software (GraphPad).

RESULTS

Generation of recombinant influenza viruses expressing mutant NS1 proteins.

The influenza A virus NS1 protein can be divided into three domains: the N-terminal RNA-binding domain (amino acids [aa] 1 to 73), the effector domain (aa 74 to 207), and a short C-terminal region (~20 aa). Numerous functions have been attributed to the NS1 protein, including binding to double-stranded RNA via the N-terminal region. In addition, the C-terminal effector domain may stabilize and support the function of the NS1 RNA-binding domain (34). We previously demonstrated that progressive truncation of the carboxy-terminal region of the NS1 protein results in recombinant influenza viruses with different degrees of inhibition of IFN-I induction that correlate with their attenuation in vivo (28, 30, 32). Infection with NS1 mutant viruses primed immune responses and protection against lethal infection by heterologous influenza virus (Fig. (Fig.1A).1A). We wanted to more carefully examine CD8+ T-cell responses primed by influenza viruses with truncated or deleted NS1 proteins. To do this, we generated a recombinant influenza A/PR/8/34 virus (H1N1) with a CD8+ T-cell epitope from the LCMV glycoprotein (gp33-41) inserted into the NA stalk (Fig. (Fig.1B).1B). Using reverse genetics, PR8-33 viruses (referred to as wild-type PR8 from hereon) were then produced that lacked expression of the NS1 protein (ΔNS1) or expressed truncations of the NS1 protein representing the first 73, 113, or 126 aa of the protein from the N-terminal end (Fig. (Fig.1B)1B) instead of the 230-aa wild-type NS1 protein.

FIG. 1.
(A) Mice were infected intranasally with 105 PFU of a recombinant influenza A/PR/8 virus (H1N1) containing the first 126 aa at the N-terminal end of NS1. Control mice were given PBS. Three weeks later the mice were challenged with 106 PFU of WT influenza ...

We first examined the ability of the mutant NS1 viruses to infect mice after intranasal administration. Administration of a low titer of recombinant wild-type PR8 virus (102 PFU) resulted in rapid viral growth in the lungs within 2 days, peaking at around 4 days after infection (Fig. (Fig.1C).1C). Since NS1-deficient viruses are highly attenuated in IFN-competent systems, we infected mice with a higher dose of the mutant viruses (105 PFU). In mice infected with the NS1 mutant viruses, no significant changes in body weight or signs of morbidity were observed after infection. Infection of mice with the mutant viruses expressing truncated NS1 proteins demonstrated different degrees of viral growth in the lungs. Virus titers were highest in mice infected with the PR8/NS1-73 (73) virus, followed by the 113 and 126 viruses, respectively (Fig. (Fig.1C).1C). Similar to that observed with truncated NS1 proteins from swine or equine influenza viruses, the length of the protein correlated inversely with viral growth and IFN inhibition (28, 30). This likely reflects differential stability of the truncated NS1 proteins in infected cells (30). All viruses with truncated NS1 proteins stimulated long-lived humoral immunity in the mice, albeit at lower titers than that after infection with wild-type virus (Fig. (Fig.1D).1D). No virus was detected in the lungs of mice after infection with the ΔNS1 virus (Fig. (Fig.1C).1C). However, low yet detectable hemagglutination inhibition (HI) titers were observed in these mice for at least 90 days (Fig. (Fig.1D).1D). Thus, the NS1 mutant viruses were capable of infecting mice via the lungs and stimulating long-lived host immunity.

Priming of effector CD8+ T-cell responses by NS1 mutant influenza viruses.

To determine CD8+ T-cell responses after infection with the attenuated influenza viruses, mice were given TCR transgenic P14 T cells specific for the LCMV gp33-41 epitope prior to infection. These transferred T cells were undetectable in the spleens of uninfected mice. Eight days after infection, responding Thy1.1+ CD8+ T cells were examined in the spleen and lungs of the mice. Substantial responses were detected in the tissues of mice infected with each of the NS1 mutant viruses (Fig. (Fig.2A).2A). Quantitation of the responding effector T-cell responses in the spleen and lungs (Fig. (Fig.2B)2B) reflected the degree of viral infection in the lungs (see Fig. Fig.1C).1C). Although an order of magnitude less than that after infection with wild-type PR8 virus, infection of mice with the ΔNS1 virus primed considerable T-cell responses in the spleen and lungs, despite a lack of any detectable virus in the lungs after infection. Furthermore, P14 CD8+ T cells primed by the NS1 mutant viruses upregulated CD44 after infection, demonstrating effective activation of the cells (data not shown).

FIG. 2.
T-cell responses in the spleen and lungs of mice 8 days after infection with the NS1 mutant viruses. (A) Mice were given LCMV gp33-41-specific P14 Thy1.1+ CD8+ T cells prior to infection, and responding P14 cells were examined in the indicated ...

Effector CD8+ T cells primed after NS1 mutant influenza virus infection were functional and produced the cytokines IFN-γ and TNF-α after restimulation with peptide (Fig. (Fig.2C).2C). Interestingly, a higher proportion of cells produced IL-2 8 days after infection with the 126 or ΔNS1 viruses. Downregulation of CD62L and upregulation of the activated isoform of CD43 recognized by the antibody 1B11 also correlated with the size of the expanded CTL populations and viral growth in the lungs (Fig. (Fig.2D).2D). Moreover, expression of the effector molecule granzyme B was lowest after ΔNS1 virus infection, whereas higher expression was detected in effector CD8+ T cells primed by the 73 and 113 viruses (Fig. (Fig.2E).2E). Together, this suggested that the CD8+ T cells primed by the NS1 mutant viruses were less highly activated 8 days after infection, possibly reflecting incomplete activation of the antigen-specific CD8+ T-cell population or a more rapid transition to memory.

Long-lived memory CD8+ T-cell responses after NS1 mutant influenza virus infection.

Memory CD8+ T-cell populations were analyzed in mice 3 months after infection with the different NS1 mutant influenza viruses (Fig. (Fig.3).3). All recombinant viruses primed populations of memory cells that were readily detectable in the spleen and lungs (Fig. (Fig.3A).3A). The size of the memory populations detected in the tissues largely reflected the size of the effector pools observed 8 days after infection (Fig. (Fig.3B).3B). However, contraction of the CD8+ T-cell pool in the spleen after ΔNS1 infection was reduced, such that the size of the memory population remained similar to that detected at day 8. This may have reflected early or reduced contraction of the response after infection with the highly attenuated virus.

FIG. 3.
Long-lived memory CD8 T-cell populations are primed by infection with the NS1-mutant viruses. (A) Memory Thy1.1+ CD8+ T cells were examined in the indicated tissues 3 months after infection with the indicated viruses. The numbers in upper ...

Memory cells primed by the mutant NS1 viruses were highly functional and produced IFN-γ and TNF-α after restimulation (Fig. (Fig.3C).3C). A considerable proportion of the memory cells produced IL-2 in both the spleen and the lungs, a finding indicative of long-lived resting memory T cells. The majority of the memory cells had also regained expression of CD62L and expressed low levels of 1B11 (Fig. (Fig.3D).3D). Similarly, endogenous influenza virus np366-specific CD8+ T cells were primed after infection with the mutant NS1 viruses, and significant numbers of cells remained detectable in these mice for at least 3 months (Fig. (Fig.3E).3E). Together, this demonstrates that infection of mice with the mutant NS1 viruses primed CD8+ T cells with the phenotypic and functional properties of long-lived memory cells.

Recall responses by memory cells after NS1 mutant influenza virus infection.

We next wanted to evaluate the recall capacity of memory CD8+ T cells generated after infection of mice with the NS1 mutant influenza viruses. Normalized numbers of P14 Thy1.1+ CD8+ memory T cells (5 × 104), isolated from the spleens of immune mice, were transferred into naive mice prior to intranasal challenge with a recombinant vaccinia virus expressing the gp33 epitope (VVgp33) (Fig. (Fig.4A).4A). Expansion of the memory CD8+ T cells was followed in the blood of mice that had received cells from PR8-, 73-, 113-, 126-, or ΔNS1-immune mice (Fig. (Fig.4B).4B). Expansion peaked around day 16 postinfection. Interestingly, memory cells from mice infected with the NS1 mutant viruses expanded slightly better than those primed by wild-type PR8 infection. Together, this demonstrated that the attenuated influenza viruses containing truncated or deleted NS1 proteins primed functional memory CD8+ T cells capable of responding and expanding upon rechallenge.

FIG. 4.
Recall of memory P14 cells primed by NS1 mutant viruses. (A) Mice were given 5 × 104 memory P14 cells from mice initially primed with the NS1 viruses 3 months earlier and challenged with VVgp33 intranasally. (B) Expansion of the CD8+Thy1.1 ...

Rapid prime-boost responses after immunization with NS1 mutant influenza viruses.

Although the mutant NS1 influenza viruses primed highly functional memory T-cell populations, the size of the memory pool was smaller than that induced after wild-type PR8 infection (see Fig. Fig.3).3). However, infection of mice with the ΔNS1 virus induced long-lived memory T cells, despite a lack of detectable virus in the lungs and no significant malaise or weight loss in the mice (Fig. (Fig.11 and data not shown). Interestingly, effector CD8+ T cells primed after ΔNS1 infection were less activated, and a greater proportion of the cells produced IL-2 as early as 8 days after infection (Fig. (Fig.2).2). The transition from an effector to central memory phenotype involves re-expression of CD62L and the capacity to produce IL-2 over time (23, 37). Our data indicated that stimulation of the P14 CD8+ T cells after ΔNS1 infection may have resulted in a brief effector period, followed by more rapid transition to memory.

We sought to determine whether it was possible to increase the size of the memory T-cell pool generated by boosting the CD8+ T cells only a short period after infection. To ascertain the capacity of the activated T cells to respond to an antigen boost soon after infection, P14 Thy1.1+ CD8+ T cells were isolated from mice infected with ΔNS1 9 days earlier, and transferred into naive mice (Fig. 5A and B). The mice were then infected with VVgp33 intranasally, and the expansion and protective capacity of the CD8+ T cells was determined 5 days later. Expansion of the ΔNS1-primed CD8+ T cells in the spleen and lungs after VVgp33 boost was significantly greater than that of cells primed by PR8 infection (Fig. (Fig.5C).5C). The ΔNS1-primed and VVgp33-boosted effector cells mediated rapid clearance of vaccinia virus from the lungs, although only slightly faster than that in mice containing WT PR8-primed CD8+ T cells (Fig. (Fig.5D).5D). This demonstrated that the cells remained responsive to antigen signals after primary immunization and were susceptible to boost vaccination to increase the size of the antigen-specific T-cell populations in the tissues.

FIG. 5.
Accelerated prime-boost responses soon after infection with NS1 mutant virus. (A) Example of effector P14 CD8+ T-cell responses in the spleen and lungs 8 days after WT PR8 or ΔNS1 infection. (B) Day 9 P14 cells were isolated from mice ...

We next wanted to more directly test the capacity of effector CD8+ T cells primed with the mutant NS1 viruses to be boosted by a second, rapid immunization. Mice containing naive P14 CD8+ T cells were infected with wild-type PR8 or ΔNS1 viruses and boosted with VVgp33 8 days later. The resulting populations of memory cells in the spleen and lungs of mice after boosting was significantly greater than that in mice immunized with just the primary dose of ΔNS1 (Fig. (Fig.5E).5E). Similar results were also obtained in mice immunized with the NS1 truncated influenza viruses (NS1-73, NS1-113, and NS1-126) after boosting with VVgp33 (data not shown), suggesting that boosting was capable of improving the immune response to all mutant strains. This was in contrast to mice immunized with PR8, which did not demonstrate an increase in numbers of memory T cells in the spleen or lungs after VVgp33 boosting. Homologous boosting of the immune response with a second dose of the ΔNS1 virus also induced increased memory CD8+ T responses in mice, which were significantly larger after two immunizations (Fig. (Fig.5F).5F). Similarly, increased populations of endogenous LCMV gp33- and influenza virus np366-specific CD8+ T-cell populations were also observed after ΔNS1 influenza virus prime-boosting in B6 mice that did not receive P14 cell transfers (data not shown).

To determine the protective capacity of these increased populations of antigen-specific memory CD8+ T cells after prime-boost vaccination, mice were given two doses of ΔNS1 influenza virus 10 days apart and then rested for 8 weeks. The mice were then challenged by respiratory infection with the recombinant VVgp33 virus. Clearance of virus from the lungs was more rapid in mice containing ΔNS1-primed memory CD8+ T cells (Fig. (Fig.5G).5G). Similar results were observed in mice immunized with NS1-73, NS1-113 or NS1-126 viruses (data not shown). Thus, vaccination with attenuated influenza viruses expressing truncated or deleted NS1 proteins induced long-lived memory CD8+ T-cell populations with the capacity to mediate rapid clearance of virus from the tissues.

DISCUSSION

Influenza viruses can cause severe respiratory infection marked by high virus titers, fever, malaise, and weight loss. Recovery from infection is mediated by adaptive immune responses, which are generally very robust and long-lived. In contrast, immunization with vaccines composed of inactivated viral components, typically via the intramuscular route, may induce less effective cell-mediated immunity and require yearly administration to counter seasonal strains. The search for a universal influenza virus vaccine, which could generate long-lived immunity against heterologous virus strains, has recently focused on live attenuated viruses with the propensity to stimulate effective respiratory immunity without significant symptoms of disease. We generated live attenuated influenza A/PR/8/34 viruses expressing truncations or a deletion of the NS1 protein. The viruses were differentially attenuated in their growth both in vitro and in vivo in mice and yet all stimulated strong and specific CD8+ T-cell immunity that was both long-lasting and capable of mediating faster clearance of virus from infected mice. Memory CD8+ T-cell responses were primed in mice after infection with a ΔNS1 virus, which lacked expression of the NS1 protein and was undetectable in the lungs of mice after infection. Moreover, the attenuated influenza viruses induced T-cell responses that were amenable to very rapid boosting with heterologous or homologous viruses, thereby enabling the generation of enhanced, protective, memory populations.

Rapid prime-boost regimes may be beneficial for the administration of effective vaccines in humans since immunity could be generated fairly rapidly, with minimal time between doses. Boosting to increase immunity can require long intervals between immunizations to ensure effectiveness. If the T cells are not adequately rested, boosting during this period may have little effect (23). However, it has been shown that immunization with peptide-coated dendritic cells generated effector cells, or early memory cells, which were highly amenable to rapid boosting within 1 week (1). We demonstrate that immunization of mice with live attenuated influenza viruses with altered NS1 protein function was also able to induce T cells that were amenable to rapid boosting. This was particularly true of recombinant viruses with the least NS1 function (ΔNS1 and NS1-126). It also suggests that priming with more highly attenuated viruses, followed by a less attenuated strain, may be useful to induce strong immune memory, as well as minimizing detrimental symptoms from the vaccinating virus.

The search for new vaccine vectors for immunization against influenza viruses, particularly potential pandemic strains, is a topic of considerable research and debate. Recently, the use of live attenuated strains has been the focus of attention, particularly in relation to the current swine influenza outbreak (6). The NS1 mutant viruses utilized in the present study, in addition to having a reduced ability to replicate in vitro and in vivo, most likely also show reduced immunomodulatory effects due to their lack of NS1 function. NS1 functions, in part, as a negative regulator of host interferon responses, facilitating replication of the virus in IFN-I-producing cells. Lack of NS1 function in a viral vaccine vector may have a number of benefits. Among these would be improved T-cell responses due to release of IFN-I (24). In addition, viruses with reduced NS1 function grow and spread considerably less aggressively, making them a safer option. However, if viral growth is too attenuated, antigen may be limiting. Nevertheless, despite showing a reduced ability to grow to high titers after infection in mice, the NS1 mutant viruses primed functional CD8+ T-cell effector and memory responses. These responses provided protection against heterologous infections and were amenable to rapid prime-boosting to increase virus-specific memory T-cell populations. Together, these findings demonstrate the potential effectiveness of such attenuated viruses as influenza virus vaccine vehicles for generating cell-mediated immunity.

Acknowledgments

This study was supported by grant U01 AI70469 from NIAID (to A.G.-S. and R.A.) and by CRIP (Center for Research on Influenza Pathogenesis; NIAID contract HHSN266200700010C to A.G.-S.). E.C. was the recipient of a postdoctoral fellowship from the Fundacion Ramon Areces.

We thank Richard Cadagan for excellent technical assistance.

Footnotes

[down-pointing small open triangle]Published ahead of print on 25 November 2009.

REFERENCES

1. Badovinac, V. P., K. A. Messingham, A. Jabbari, J. S. Haring, and J. T. Harty. 2005. Accelerated CD8+ T-cell memory and prime-boost response after dendritic-cell vaccination. Nat. Med. 11:748-756. [PubMed]
2. Baskin, C. R., H. Bielefeldt-Ohmann, T. M. Tumpey, P. J. Sabourin, J. P. Long, A. Garcia-Sastre, A. E. Tolnay, R. Albrecht, J. A. Pyles, P. H. Olson, L. D. Aicher, E. R. Rosenzweig, K. Murali-Krishna, E. A. Clark, M. S. Kotur, J. L. Fornek, S. Proll, R. E. Palermo, C. L. Sabourin, and M. G. Katze. 2009. Early and sustained innate immune response defines pathology and death in nonhuman primates infected by highly pathogenic influenza virus. Proc. Natl. Acad. Sci. U. S. A. 106:3455-3460. [PubMed]
3. Belshe, R. B., and P. M. Mendelman. 2003. Safety and efficacy of live attenuated, cold-adapted, influenza vaccine-trivalent. Immunol. Allergy Clin. N. Am. 23:745-767. [PubMed]
4. Bender, B. S., T. Croghan, L. Zhang, and P. A. Small, Jr. 1992. Transgenic mice lacking class I major histocompatibility complex-restricted T cells have delayed viral clearance and increased mortality after influenza virus challenge. J. Exp. Med. 175:1143-1145. [PMC free article] [PubMed]
5. Brown, L. E., and A. Kelso. 2009. Prospects for an influenza vaccine that induces cross-protective cytotoxic T lymphocytes. Immunol. Cell Biol. 87:300-308. [PubMed]
6. Butler, D. 2009. Vaccine decisions loom for new flu strain. Nature 459:144-145. [PubMed]
7. Cox, R. J., K. A. Brokstad, and P. Ogra. 2004. Influenza virus: immunity and vaccination strategies: comparison of the immune response to inactivated and live, attenuated influenza vaccines. Scand. J. Immunol. 59:1-15. [PubMed]
8. Curtsinger, J. M., J. O. Valenzuela, P. Agarwal, D. Lins, and M. F. Mescher. 2005. Type I IFNs provide a third signal to CD8 T cells to stimulate clonal expansion and differentiation. J. Immunol. 174:4465-4469. [PubMed]
9. Falcon, A. M., R. M. Marion, T. Zurcher, P. Gomez, A. Portela, A. Nieto, and J. Ortin. 2004. Defective RNA replication and late gene expression in temperature-sensitive influenza viruses expressing deleted forms of the NS1 protein. J. Virol. 78:3880-3888. [PMC free article] [PubMed]
10. Ferko, B., J. Stasakova, J. Romanova, C. Kittel, S. Sereinig, H. Katinger, and A. Egorov. 2004. Immunogenicity and protection efficacy of replication-deficient influenza A viruses with altered NS1 genes. J. Virol. 78:13037-13045. [PMC free article] [PubMed]
11. Fernandez-Sesma, A., S. Marukian, B. J. Ebersole, D. Kaminski, M. S. Park, T. Yuen, S. C. Sealfon, A. Garcia-Sastre, and T. M. Moran. 2006. Influenza virus evades innate and adaptive immunity via the NS1 protein. J. Virol. 80:6295-6304. [PMC free article] [PubMed]
12. Fraser, C., C. A. Donnelly, S. Cauchemez, W. P. Hanage, M. D. Van Kerkhove, T. D. Hollingsworth, J. Griffin, R. F. Baggaley, H. E. Jenkins, E. J. Lyons, T. Jombart, W. R. Hinsley, N. C. Grassly, F. Balloux, A. C. Ghani, N. M. Ferguson, A. Rambaut, O. G. Pybus, H. Lopez-Gatell, C. M. Apluche-Aranda, I. B. Chapela, E. P. Zavala, D. M. Guevara, F. Checchi, E. Garcia, S. Hugonnet, and C. Roth. 2009. Pandemic potential of a strain of influenza A (H1N1): early findings. Science 324:1557-1561. [PubMed]
13. Gack, M. U., R. A. Albrecht, T. Urano, K. S. Inn, I. C. Huang, E. Carnero, M. Farzan, S. Inoue, J. U. Jung, and A. Garcia-Sastre. 2009. Influenza A virus NS1 targets the ubiquitin ligase TRIM25 to evade recognition by the host viral RNA sensor RIG-I. Cell Host Microbe 5:439-449. [PMC free article] [PubMed]
14. Garcia-Sastre, A., A. Egorov, D. Matassov, S. Brandt, D. E. Levy, J. E. Durbin, P. Palese, and T. Muster. 1998. Influenza A virus lacking the NS1 gene replicates in interferon-deficient systems. Virology 252:324-330. [PubMed]
15. Hale, B. G., D. Jackson, Y. H. Chen, R. A. Lamb, and R. E. Randall. 2006. Influenza A virus NS1 protein binds p85beta and activates phosphatidylinositol-3-kinase signaling. Proc. Natl. Acad. Sci. U. S. A. 103:14194-14199. [PubMed]
16. Hale, B. G., R. E. Randall, J. Ortin, and D. Jackson. 2008. The multifunctional NS1 protein of influenza A viruses. J. Gen. Virol. 89:2359-2376. [PubMed]
17. Harrington, L. E., R. Most Rv, J. L. Whitton, and R. Ahmed. 2002. Recombinant vaccinia virus-induced T-cell immunity: quantitation of the response to the virus vector and the foreign epitope. J. Virol. 76:3329-3337. [PMC free article] [PubMed]
18. Hatada, E., M. Hasegawa, K. Shimizu, M. Hatanaka, and R. Fukuda. 1990. Analysis of influenza A virus temperature-sensitive mutants with mutations in RNA segment 8. J. Gen. Virol. 71(Pt. 6):1283-1292. [PubMed]
19. Havenar-Daughton, C., G. A. Kolumam, and K. Murali-Krishna. 2006. Cutting edge: the direct action of type I IFN on CD4 T cells is critical for sustaining clonal expansion in response to a viral but not a bacterial infection. J. Immunol. 176:3315-3319. [PubMed]
20. Hoffmann, E., G. Neumann, Y. Kawaoka, G. Hobom, and R. G. Webster. 2000. A DNA transfection system for generation of influenza A virus from eight plasmids. Proc. Natl. Acad. Sci. U. S. A. 97:6108-6113. [PubMed]
21. Hyland, L., R. Webby, M. R. Sandbulte, B. Clarke, and S. Hou. 2006. Influenza virus NS1 protein protects against lymphohematopoietic pathogenesis in an in vivo mouse model. Virology 349:156-163. [PubMed]
22. Jackson, D., M. J. Hossain, D. Hickman, D. R. Perez, and R. A. Lamb. 2008. A new influenza virus virulence determinant: the NS1 protein four C-terminal residues modulate pathogenicity. Proc. Natl. Acad. Sci. U. S. A. 105:4381-4386. [PubMed]
23. Kaech, S. M., S. Hemby, E. Kersh, and R. Ahmed. 2002. Molecular and functional profiling of memory CD8 T-cell differentiation. Cell 111:837-851. [PubMed]
24. Kolumam, G. A., S. Thomas, L. J. Thompson, J. Sprent, and K. Murali-Krishna. 2005. Type I interferons act directly on CD8 T cells to allow clonal expansion and memory formation in response to viral infection. J. Exp. Med. 202:637-650. [PMC free article] [PubMed]
25. Min, J. Y., and R. M. Krug. 2006. The primary function of RNA binding by the influenza A virus NS1 protein in infected cells: inhibiting the 2′-5′ oligo(A) synthetase/RNase L pathway. Proc. Natl. Acad. Sci. U. S. A. 103:7100-7105. [PubMed]
26. Min, J. Y., S. Li, G. C. Sen, and R. M. Krug. 2007. A site on the influenza A virus NS1 protein mediates both inhibition of PKR activation and temporal regulation of viral RNA synthesis. Virology 363:236-243. [PubMed]
27. Pichlmair, A., O. Schulz, C. P. Tan, T. I. Naslund, P. Liljestrom, F. Weber, and E. S. C. Reis. 2006. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5′ phosphates. Science 314:997-1001. [PubMed]
28. Quinlivan, M., D. Zamarin, A. Garcia-Sastre, A. Cullinane, T. Chambers, and P. Palese. 2005. Attenuation of equine influenza viruses through truncations of the NS1 protein. J. Virol. 79:8431-8439. [PMC free article] [PubMed]
29. Romanova, J., B. M. Krenn, M. Wolschek, B. Ferko, E. Romanovskaja-Romanko, A. Morokutti, A. P. Shurygina, S. Nakowitsch, T. Ruthsatz, B. Kiefmann, U. Konig, M. Bergmann, M. Sachet, S. Balasingam, A. Mann, J. Oxford, M. Slais, O. Kiselev, T. Muster, and A. Egorov. 2009. Preclinical evaluation of a replication-deficient intranasal ΔNS1 H5N1 influenza vaccine. PLoS One 4:e5984. [PMC free article] [PubMed]
30. Solorzano, A., R. J. Webby, K. M. Lager, B. H. Janke, A. Garcia-Sastre, and J. A. Richt. 2005. Mutations in the NS1 protein of swine influenza virus impair anti-interferon activity and confer attenuation in pigs. J. Virol. 79:7535-7543. [PMC free article] [PubMed]
31. Subbarao, K., B. R. Murphy, and A. S. Fauci. 2006. Development of effective vaccines against pandemic influenza. Immunity 24:5-9. [PubMed]
32. Talon, J., M. Salvatore, R. E. O'Neill, Y. Nakaya, H. Zheng, T. Muster, A. Garcia-Sastre, and P. Palese. 2000. Influenza A and B viruses expressing altered NS1 proteins: a vaccine approach. Proc. Natl. Acad. Sci. U. S. A. 97:4309-4314. [PubMed]
33. Vincent, A. L., W. Ma, K. M. Lager, B. H. Janke, R. J. Webby, A. Garcia-Sastre, and J. A. Richt. 2007. Efficacy of intranasal administration of a truncated NS1 modified live influenza virus vaccine in swine. Vaccine 25:7999-8009. [PMC free article] [PubMed]
34. Wang, X., C. F. Basler, B. R. Williams, R. H. Silverman, P. Palese, and A. Garcia-Sastre. 2002. Functional replacement of the carboxy-terminal two-thirds of the influenza A virus NS1 protein with short heterologous dimerization domains. J. Virol. 76:12951-12962. [PMC free article] [PubMed]
35. Webby, R. J., S. Andreansky, J. Stambas, J. E. Rehg, R. G. Webster, P. C. Doherty, and S. J. Turner. 2003. Protection and compensation in the influenza virus-specific CD8+ T-cell response. Proc. Natl. Acad. Sci. U. S. A. 100:7235-7240. [PubMed]
36. Webster, R. G., W. J. Bean, O. T. Gorman, T. M. Chambers, and Y. Kawaoka. 1992. Evolution and ecology of influenza A viruses. Microbiol. Rev. 56:152-179. [PMC free article] [PubMed]
37. Wherry, E. J., V. Teichgraber, T. C. Becker, D. Masopust, S. M. Kaech, R. Antia, U. H. von Andrian, and R. Ahmed. 2003. Lineage relationship and protective immunity of memory CD8 T-cell subsets. Nat. Immunol. 4:225-234. [PubMed]
38. Woodland, D. L. 2003. Cell-mediated immunity to respiratory virus infections. Curr. Opin. Immunol. 15:430-435. [PubMed]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)